Bioperl-guts: Re: repetitive DNA

Ian Holmes ihh@lanl.gov
Thu, 9 Sep 1999 02:49:43 -0600 (MDT)


'dust' is one of the most obscure and random heuristics i've ever seen,
but if that doesn't bother you.. ;-)

On Thu, 9 Sep 1999, Alessandro Guffanti wrote:

> Hi. I think a good solution could also be to use NCBI's DUST
> filter with a suitable cut-off, then retrieve the coordinates
> of masked sequences through a perl wrapper - c'est fait.
> You can retrieve DUST from WU ftp server:
> 
> ftp://blast.wustl.edu/pub/dust
> 
> >test
> acgatgacgatgatatatatatatatacataatatatatcacagggga
> atatatatatcccacataatata
> 
> dust test
> >test
> acgatgacgatgNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNcc
> cacataatata
> 
> dust test 45
> >test
> acgatgacgatgatatatatatatatacataatatatatcacaggggaatatatatatcc
> cacataatata
> 
> 
> Best Wishes,
> 
> Alessandro.
> 
> BTW, I think that this could be a good startup for a "filtering"
> module. Do you think this could be interesting ? It could be a
> method in a sequence object or a separate module per se. The outcome
> could be a list of coordinates in the sequence which correspond to
> masked areas. I would be happy to produce a rough version of this.
> 
> 
> -- 
> ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
>        Alessandro Guffanti - Informatics      
> The Sanger Centre, Wellcome Trust Genome Campus
>   Hinxton, Cambridge CB10 1SA, United Kingdom        
>     phone: +1223-834244 * fax: +1223-494919
>       http://www.sanger.ac.uk/Users/ag3
> =========== Bioperl Project Mailing List Message Footer =======
> Project URL: http://bio.perl.org
> For info about how to (un)subscribe, where messages are archived, etc:
> http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl-guts.html
> ====================================================================
> 

=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl-guts.html
====================================================================