use integer and Bio::Seq

[haase@mips.biochem.mpg.de]

Full_Name: Dirk Haase
Module: Bio::Seq
Version: 0.6
OS: OSF1 V5.0 910 alpha
Submission from: oribi.mips.biochem.mpg.de (141.61.65.23)


Hi,

after switching from bioperl version 0.05 to 0.6, I
encountered strange behaviour of modules which use
Bio::Seq. I couldn't access the sequence of my 
sequence objects anymore... Which was no surprise, 
as the objects simply had no feature 'seq'! I found
out, that this only occurs when simultaneously the
pragma 'integer' is used (see example script).

Because usage of 'integer' was not vital in my case, a
fix was easy, but nevertheless I wanted to let 
you know...

While hunting this error, I met a typo in the
documentation to Bio::PrimarySeq. In the SYNOPSIS,
an 'r' is missing in the constructor call. Fatal 
for those stupid guys who use to copy/paste from 
documentations ;-)


Best wishes,
dirk

-------------------------------------------------
#!/usr/local/bin/perl

# test for Bio::Seq and integer pragma

use Bio::Seq;

$dna = "atggcaacggatacaacaactttttga";
$seq_obj = new Bio::Seq(-seq=>$dna,
			   -type=>'Dna');
print "without 'use integer':\nDna: ", $seq_obj->seq, "\n\n";
use integer;
$seq_obj2 =  new Bio::Seq(-seq=>$dna,
			   -type=>'Dna');
print "with 'use integer':\nDna: ", $seq_obj2->seq, "\n";

---------------------------------------------------
Output on my machine:

without 'use integer':
Dna: atggcaacggatacaacaactttttga

with 'use integer':
Dna: 


=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl-guts.html
====================================================================