[Bioperl-guts-l] bioperl-live/t LargeLocatableSeq.t, 1.1, 1.2 LinkageMap.t, 1.2, 1.3 LiveSeq.t, 1.14, 1.15 LocatableSeq.t, 1.11, 1.12 LocusLink.t, 1.8, 1.9 largefasta.t, 1.8, 1.9 largepseq.t, 1.9, 1.10 lasergene.t, 1.2, 1.3
Christopher John Fields
cjfields at dev.open-bio.org
Wed Apr 11 17:48:11 EDT 2007
- Previous message: [Bioperl-guts-l] bioperl-live/t IUPAC.t, 1.2, 1.3 Index.t, 1.48, 1.49 InstanceSite.t, 1.5, 1.6 InterProParser.t, 1.11, 1.12 interpro.t, 1.3, 1.4 kegg.t, 1.2, 1.3
- Next message: [Bioperl-guts-l] bioperl-live/t lucy.t,1.2,1.3
- Messages sorted by:
[ date ]
[ thread ]
[ subject ]
[ author ]
Update of /home/repository/bioperl/bioperl-live/t
In directory dev.open-bio.org:/tmp/cvs-serv30093
Modified Files:
LargeLocatableSeq.t LinkageMap.t LiveSeq.t LocatableSeq.t
LocusLink.t largefasta.t largepseq.t lasergene.t
Log Message:
Finished L's (move to Test::More)
Index: largepseq.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/largepseq.t,v
retrieving revision 1.9
retrieving revision 1.10
diff -C2 -d -r1.9 -r1.10
*** largepseq.t 2 Nov 2001 18:48:09 -0000 1.9
--- largepseq.t 11 Apr 2007 21:48:09 -0000 1.10
***************
*** 11,26 ****
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
! plan tests => 22;
}
- use Bio::Seq::LargePrimarySeq;
- use Bio::Seq::LargeSeq;
- use Bio::Location::Simple;
- use Bio::Location::Fuzzy;
- use Bio::Location::Split;
my $pseq = Bio::Seq::LargePrimarySeq->new();
--- 11,26 ----
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
! plan tests => 27;
! use_ok('Bio::Seq::LargePrimarySeq');
! use_ok('Bio::Seq::LargeSeq');
! use_ok('Bio::Location::Simple');
! use_ok('Bio::Location::Fuzzy');
! use_ok('Bio::Location::Split');
}
my $pseq = Bio::Seq::LargePrimarySeq->new();
***************
*** 29,40 ****
$pseq->add_sequence_as_string('GTTTGGGGTTAAACCCCTTTGGGGGGT');
! ok $pseq->display_id('hello'), 'hello';
! ok $pseq->seq, 'ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT' , "Sequence is " . $pseq->seq;
! ok $pseq->subseq(3,7), 'GGGGT', "Subseq is ".$pseq->subseq(3,7);
my $location = new Bio::Location::Simple(-start => 4, -end => 8,
-strand => 1);
! ok($pseq->subseq($location), 'GGGTG');
my $splitlocation = new Bio::Location::Split;
--- 29,40 ----
$pseq->add_sequence_as_string('GTTTGGGGTTAAACCCCTTTGGGGGGT');
! is $pseq->display_id('hello'), 'hello';
! is $pseq->seq, 'ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT' , "Sequence is " . $pseq->seq;
! is $pseq->subseq(3,7), 'GGGGT', "Subseq is ".$pseq->subseq(3,7);
my $location = new Bio::Location::Simple(-start => 4, -end => 8,
-strand => 1);
! is($pseq->subseq($location), 'GGGTG');
my $splitlocation = new Bio::Location::Split;
***************
*** 48,52 ****
'-strand' => -1));
! ok( $pseq->subseq($splitlocation), 'ATGGGGTGGGGTGAACCCCCAA');
my $fuzzy = new Bio::Location::Fuzzy(-start => '<10',
--- 48,52 ----
'-strand' => -1));
! is( $pseq->subseq($splitlocation), 'ATGGGGTGGGGTGAACCCCCAA');
my $fuzzy = new Bio::Location::Fuzzy(-start => '<10',
***************
*** 54,91 ****
-strand => 1);
! ok( $pseq->subseq($fuzzy), 'GGTGAAACC');
! ok($pseq->trunc(8,15)->seq, 'GGGGTGAA',
'trunc seq was ' . $pseq->trunc(8,15)->seq);
! ok $pseq->alphabet('dna'), 'dna'; # so translate will not complain
! ok $pseq->translate()->seq, 'MGWGETLWGWGKCLGLNPFGG';
my $seq = new Bio::Seq::LargeSeq(-primaryseq => $pseq );
! ok $seq->display_id('hello'), 'hello';
! ok $seq->seq, 'ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT' , "Sequence is " . $seq->seq;
! ok $seq->subseq(3,7), 'GGGGT', "Subseq is ".$seq->subseq(3,7);
! ok ($seq->trunc(8,15)->seq, 'GGGGTGAA',
'trunc seq was ' . $seq->trunc(8,15)->seq);
! ok $seq->alphabet('dna'), 'dna'; # so translate will not complain
! ok $seq->translate()->seq, 'MGWGETLWGWGKCLGLNPFGG';
$seq = new Bio::Seq::LargeSeq( -display_id => 'hello');
$seq->seq('ATGGGGTGGGGT');
! ok $seq->display_id, 'hello';
! ok $seq->seq, 'ATGGGGTGGGGT' , "Sequence is " . $seq->seq;
! ok $seq->subseq(3,7), 'GGGGT', "Subseq is ".$seq->subseq(3,7);
! ok ($seq->trunc(8,12)->seq, 'GGGGT',
'trunc seq was ' . $seq->trunc(8,12)->seq);
! ok $seq->alphabet('dna'), 'dna'; # so translate will not complain
! ok $seq->translate()->seq, 'MGWG';
--- 54,91 ----
-strand => 1);
! is( $pseq->subseq($fuzzy), 'GGTGAAACC');
! is($pseq->trunc(8,15)->seq, 'GGGGTGAA',
'trunc seq was ' . $pseq->trunc(8,15)->seq);
! is $pseq->alphabet('dna'), 'dna'; # so translate will not complain
! is $pseq->translate()->seq, 'MGWGETLWGWGKCLGLNPFGG';
my $seq = new Bio::Seq::LargeSeq(-primaryseq => $pseq );
! is $seq->display_id('hello'), 'hello';
! is $seq->seq, 'ATGGGGTGGGGTGAAACCCTTTGGGGGTGGGGTAAATGTTTGGGGTTAAACCCCTTTGGGGGGT' , "Sequence is " . $seq->seq;
! is $seq->subseq(3,7), 'GGGGT', "Subseq is ".$seq->subseq(3,7);
! is ($seq->trunc(8,15)->seq, 'GGGGTGAA',
'trunc seq was ' . $seq->trunc(8,15)->seq);
! is $seq->alphabet('dna'), 'dna'; # so translate will not complain
! is $seq->translate()->seq, 'MGWGETLWGWGKCLGLNPFGG';
$seq = new Bio::Seq::LargeSeq( -display_id => 'hello');
$seq->seq('ATGGGGTGGGGT');
! is $seq->display_id, 'hello';
! is $seq->seq, 'ATGGGGTGGGGT' , "Sequence is " . $seq->seq;
! is $seq->subseq(3,7), 'GGGGT', "Subseq is ".$seq->subseq(3,7);
! is ($seq->trunc(8,12)->seq, 'GGGGT',
'trunc seq was ' . $seq->trunc(8,12)->seq);
! is $seq->alphabet('dna'), 'dna'; # so translate will not complain
! is $seq->translate()->seq, 'MGWG';
Index: LocatableSeq.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/LocatableSeq.t,v
retrieving revision 1.11
retrieving revision 1.12
diff -C2 -d -r1.11 -r1.12
*** LocatableSeq.t 13 Nov 2003 13:44:56 -0000 1.11
--- LocatableSeq.t 11 Apr 2007 21:48:09 -0000 1.12
***************
*** 3,22 ****
## $Id$
use strict;
! use constant NUMTESTS => 80;
BEGIN {
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
plan tests => NUMTESTS;
}
- use Bio::LocatableSeq;
- ok(1);
- use Bio::SimpleAlign;
- use Bio::AlignIO;
- use Bio::Root::IO;
my ($str, $aln, $seq, $loc);
--- 3,21 ----
## $Id$
use strict;
! use constant NUMTESTS => 84;
BEGIN {
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
plan tests => NUMTESTS;
+ use_ok('Bio::LocatableSeq');
+ use_ok('Bio::SimpleAlign');
+ use_ok('Bio::AlignIO');
+ use_ok('Bio::Root::IO');
}
my ($str, $aln, $seq, $loc);
***************
*** 27,59 ****
-alphabet => 'dna'
);
! ok $seq->alphabet, 'dna';
! ok $seq->start, 1;
! ok $seq->end, 6;
! ok $seq->strand, 1;
! ok $seq->no_gaps, 1;
! ok $seq->column_from_residue_number(4), 9;
ok $loc = $seq->location_from_column(4);
! ok $loc->isa('Bio::Location::Simple');
! ok $loc->to_FTstring, 2;
ok $loc = $seq->location_from_column(6);
! ok $loc->isa('Bio::Location::Simple');
! ok $loc->start, 3;
! ok $loc->location_type, 'IN-BETWEEN';
! ok $loc->to_FTstring, '3^4';
! ok $loc = $seq->location_from_column(2), undef;
$str = Bio::AlignIO->new(-file=> Bio::Root::IO->catfile("t","data","testaln.pfam"));
! ok defined($str) && ref($str) && $str->isa('Bio::AlignIO');
$aln = $str->next_aln();
ok $seq = $aln->get_seq_by_pos(1);
! ok ref($seq), 'Bio::LocatableSeq';
! ok $seq->get_nse, '1433_LYCES/9-246';
! ok $seq->id, '1433_LYCES';
# test revcom and trunc
--- 26,59 ----
-alphabet => 'dna'
);
! is $seq->alphabet, 'dna';
! is $seq->start, 1;
! is $seq->end, 6;
! is $seq->strand, 1;
! is $seq->no_gaps, 1;
! is $seq->column_from_residue_number(4), 9;
ok $loc = $seq->location_from_column(4);
! isa_ok $loc,'Bio::Location::Simple';
! is $loc->to_FTstring, 2;
ok $loc = $seq->location_from_column(6);
! isa_ok $loc,'Bio::Location::Simple';
! is $loc->start, 3;
! is $loc->location_type, 'IN-BETWEEN';
! is $loc->to_FTstring, '3^4';
! is $loc = $seq->location_from_column(2), undef;
$str = Bio::AlignIO->new(-file=> Bio::Root::IO->catfile("t","data","testaln.pfam"));
! ok defined($str);
! isa_ok $str,'Bio::AlignIO';
$aln = $str->next_aln();
ok $seq = $aln->get_seq_by_pos(1);
! is ref($seq), 'Bio::LocatableSeq';
! is $seq->get_nse, '1433_LYCES/9-246';
! is $seq->id, '1433_LYCES';
# test revcom and trunc
***************
*** 66,86 ****
my $seq2 = $seq->trunc(1,9);
! ok $seq2->seq, '--atg---g';
! ok $seq2->start, 1;
! ok $seq2->end, 4;
! ok $seq2->strand, $seq->strand;
$seq2 = $seq->trunc(3,8);
! ok $seq2->seq, 'atg---';
! ok $seq2->start, 1;
! ok $seq2->end, 3;
! ok $seq->strand(-1), -1;
! ok $seq->start, 1;
! ok $seq->end, 6;
$seq2 = $seq->trunc(3,8);
! ok $seq2->seq, 'atg---';
! ok $seq2->start, 4;
! ok $seq2->end, 6;
#use Data::Dumper;
#print Dumper $seq;
--- 66,86 ----
my $seq2 = $seq->trunc(1,9);
! is $seq2->seq, '--atg---g';
! is $seq2->start, 1;
! is $seq2->end, 4;
! is $seq2->strand, $seq->strand;
$seq2 = $seq->trunc(3,8);
! is $seq2->seq, 'atg---';
! is $seq2->start, 1;
! is $seq2->end, 3;
! is $seq->strand(-1), -1;
! is $seq->start, 1;
! is $seq->end, 6;
$seq2 = $seq->trunc(3,8);
! is $seq2->seq, 'atg---';
! is $seq2->start, 4;
! is $seq2->end, 6;
#use Data::Dumper;
#print Dumper $seq;
***************
*** 88,95 ****
#exit;
$seq2 = $seq->revcom();
! ok $seq2->seq, '--tac---cat--';
! ok $seq2->start, $seq->start;
! ok $seq2->end, $seq->end;
! ok $seq2->strand, $seq->strand * -1;
# test column-mapping for -1 strand sequence
--- 88,95 ----
#exit;
$seq2 = $seq->revcom();
! is $seq2->seq, '--tac---cat--';
! is $seq2->start, $seq->start;
! is $seq2->end, $seq->end;
! is $seq2->strand, $seq->strand * -1;
# test column-mapping for -1 strand sequence
***************
*** 99,112 ****
-alphabet => 'dna'
);
! ok $seq->column_from_residue_number(5),5;
! ok $seq->column_from_residue_number(4),9;
ok $loc = $seq->location_from_column(4);
! ok $loc->isa('Bio::Location::Simple');
! ok $loc->to_FTstring, 6;
ok $loc = $seq->location_from_column(6);
! ok $loc->isa('Bio::Location::Simple');
! ok $loc->start, 4;
! ok $loc->location_type, 'IN-BETWEEN';
! ok $loc->to_FTstring, '4^5';
--- 99,112 ----
-alphabet => 'dna'
);
! is $seq->column_from_residue_number(5),5;
! is $seq->column_from_residue_number(4),9;
ok $loc = $seq->location_from_column(4);
! isa_ok $loc,'Bio::Location::Simple';
! is $loc->to_FTstring, 6;
ok $loc = $seq->location_from_column(6);
! isa_ok $loc,'Bio::Location::Simple';
! is $loc->start, 4;
! is $loc->location_type, 'IN-BETWEEN';
! is $loc->to_FTstring, '4^5';
***************
*** 119,160 ****
-alphabet => 'dna'
);
! ok $seq->alphabet, 'dna';
! ok $seq->start, 1;
! ok $seq->end, 6;
! ok $seq->strand, -1;
! ok $seq->no_gaps, 1;
! ok $seq->column_from_residue_number(4), 5;
ok $seq2 = $seq->trunc(1,9);
! ok $seq2->seq, '--atg---g';
! ok $seq2->start, 3;
! ok $seq2->end, 6;
! ok $seq2->strand, $seq->strand;
! ok $seq->location_from_column(3)->start, 6;
! ok $seq->location_from_column(11)->start, 1;
! ok $seq->location_from_column(9)->start, 3;
ok $seq2 = $seq->trunc(7,12);
! ok $seq2->seq, '--gta-';
! ok $seq2->start, 1;
! ok $seq2->end, 3;
ok $seq2 = $seq->trunc(2,6);
! ok $seq2->seq, '-atg-';
! ok $seq2->start, 4;
! ok $seq2->end, 6;
ok $seq2 = $seq->trunc(4,7);
! ok $seq2->seq, 'tg--';
! ok $seq2->start, 4;
! ok $seq2->end, 5;
ok $seq = new Bio::LocatableSeq();
! ok $seq->seq, undef;
! ok $seq->start, undef;
! ok $seq->end, undef;
--- 119,160 ----
-alphabet => 'dna'
);
! is $seq->alphabet, 'dna';
! is $seq->start, 1;
! is $seq->end, 6;
! is $seq->strand, -1;
! is $seq->no_gaps, 1;
! is $seq->column_from_residue_number(4), 5;
ok $seq2 = $seq->trunc(1,9);
! is $seq2->seq, '--atg---g';
! is $seq2->start, 3;
! is $seq2->end, 6;
! is $seq2->strand, $seq->strand;
! is $seq->location_from_column(3)->start, 6;
! is $seq->location_from_column(11)->start, 1;
! is $seq->location_from_column(9)->start, 3;
ok $seq2 = $seq->trunc(7,12);
! is $seq2->seq, '--gta-';
! is $seq2->start, 1;
! is $seq2->end, 3;
ok $seq2 = $seq->trunc(2,6);
! is $seq2->seq, '-atg-';
! is $seq2->start, 4;
! is $seq2->end, 6;
ok $seq2 = $seq->trunc(4,7);
! is $seq2->seq, 'tg--';
! is $seq2->start, 4;
! is $seq2->end, 5;
ok $seq = new Bio::LocatableSeq();
! is $seq->seq, undef;
! is $seq->start, undef;
! is $seq->end, undef;
Index: LinkageMap.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/LinkageMap.t,v
retrieving revision 1.2
retrieving revision 1.3
diff -C2 -d -r1.2 -r1.3
*** LinkageMap.t 16 Sep 2005 12:22:36 -0000 1.2
--- LinkageMap.t 11 Apr 2007 21:48:09 -0000 1.3
***************
*** 12,33 ****
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
! plan tests => 16;
}
! # END {
! # }
!
! require 'dumpvar.pl';
!
! use Bio::Map::LinkagePosition;
! use Bio::Map::Microsatellite;
! use Bio::Map::LinkageMap;
- ok 1 ;
my $verbose = 0;
ok my $map = new Bio::Map::LinkageMap('-verbose' => $verbose,
--- 12,28 ----
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
! plan tests => 19;
! use_ok('Bio::Map::LinkagePosition');
! use_ok('Bio::Map::Microsatellite');
! use_ok('Bio::Map::LinkageMap');
}
! require_ok('dumpvar.pl');
my $verbose = 0;
ok my $map = new Bio::Map::LinkageMap('-verbose' => $verbose,
***************
*** 36,45 ****
'-units' => 'cM',
'-species' => "Brassica");
! ok ref($map), 'Bio::Map::LinkageMap';
! ok $map->name, 'Leviathon';
! ok $map->type, 'Genetic';
! ok $map->units, 'cM';
! ok $map->species, 'Brassica';
! ok $map->unique_id, '1';
ok my $position = new Bio::Map::LinkagePosition('-order' => 2,
--- 31,40 ----
'-units' => 'cM',
'-species' => "Brassica");
! is ref($map), 'Bio::Map::LinkageMap';
! is $map->name, 'Leviathon';
! is $map->type, 'Genetic';
! is $map->units, 'cM';
! is $map->species, 'Brassica';
! is $map->unique_id, '1';
ok my $position = new Bio::Map::LinkagePosition('-order' => 2,
***************
*** 48,60 ****
);
! ok $position->order, 2;
! ok $position->map, $map,
! ok $position->value, 22.3;
ok my $o_usat = new Bio::Map::Microsatellite('-name' => "Chad marker",
'-position' => $position);
! ok $o_usat->name, 'Chad marker';
! ok $o_usat->position, $position ;
ok $map->add_element($o_usat);
--- 43,55 ----
);
! is $position->order, 2;
! ok my $map2 = $position->map;
! is $position->value, 22.3;
ok my $o_usat = new Bio::Map::Microsatellite('-name' => "Chad marker",
'-position' => $position);
! is $o_usat->name, 'Chad marker';
! is $o_usat->position, $position ;
ok $map->add_element($o_usat);
***************
*** 65,74 ****
# print("position2 looks like this:\n");
# dumpValue($position2);
! #ok(($position2->each_position_value('fakemap'))[0] == 0);
! #ok $position2->order, 3;
#-------------
! #ok($position->order, 2);
! #ok(($position->each_position_value($map))[0], 22.3);
# what should be printed if this was ok?
# ok(1);
--- 60,69 ----
# print("position2 looks like this:\n");
# dumpValue($position2);
! #is(($position2->each_position_value('fakemap'))[0], 0);
! #is $position2->order, 3;
#-------------
! #is($position->order, 2);
! #is(($position->each_position_value($map))[0], 22.3);
# what should be printed if this was ok?
# ok(1);
***************
*** 77,82 ****
# '-position' => $position);
#
! #ok $o_usat->name, 'Chad marker';
! #ok $o_usat->position, $position ;
#ok $map->add_element($o_usat);
# what should be printed if this is ok?
--- 72,77 ----
# '-position' => $position);
#
! #is $o_usat->name, 'Chad marker';
! #is $o_usat->position, $position ;
#ok $map->add_element($o_usat);
# what should be printed if this is ok?
Index: largefasta.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/largefasta.t,v
retrieving revision 1.8
retrieving revision 1.9
diff -C2 -d -r1.8 -r1.9
*** largefasta.t 22 Oct 2001 08:22:59 -0000 1.8
--- largefasta.t 11 Apr 2007 21:48:09 -0000 1.9
***************
*** 1,17 ****
!
use strict;
BEGIN {
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
! plan tests => 15;
}
- use Bio::SeqIO;
use vars qw($tmpfile);
- use Bio::Root::IO;
END { unlink $tmpfile; }
--- 1,18 ----
! # This is -*-Perl-*- code
! # $Id$
use strict;
BEGIN {
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
! plan tests => 17;
! use_ok('Bio::Root::IO');
! use_ok('Bio::SeqIO');
}
use vars qw($tmpfile);
END { unlink $tmpfile; }
***************
*** 19,23 ****
my $seqio = new Bio::SeqIO('-format'=>'largefasta',
'-file' =>Bio::Root::IO->catfile("t","data","genomic-seq.fasta"));
! ok defined $seqio, 1, 'cannot instantiate Bio::SeqIO::largefasta';
my $pseq = $seqio->next_seq();
--- 20,24 ----
my $seqio = new Bio::SeqIO('-format'=>'largefasta',
'-file' =>Bio::Root::IO->catfile("t","data","genomic-seq.fasta"));
! is defined $seqio, 1, 'Instantiate Bio::SeqIO::largefasta';
my $pseq = $seqio->next_seq();
***************
*** 27,46 ****
my $last_3 = $pseq->subseq($plength-3,$plength);
! ok defined $pseq, 1, 'could not call next_seq';
! ok $plength > 0, 1, "could not call length, seq was empty";
! ok length($pseq->subseq(100, 299)), 200, 'error in subseq';
! ok $pseq->trunc(100,199)->length(), 100, 'error in trunc';
! ok $pseq->alphabet(), 'dna', 'alphabet was ' . $pseq->alphabet();
! ok $pseq->display_id(), 'HSBA536C5',"no display id";
! ok $pseq->accession_number(), 'unknown', "no accession";
! ok $pseq->desc, 'this is my description', 'no description';
! ok open(OUT, ">$tmpfile"), 1,'could not open output file';
my $seqout = new Bio::SeqIO('-format' => 'largefasta',
'-fh' => \*OUT );
! ok defined $seqout, 1,'could not open seq with outputstream';
! ok $seqout->write_seq($pseq), 1,'could not write seq';
$seqout->close();
close(OUT);
--- 28,47 ----
my $last_3 = $pseq->subseq($plength-3,$plength);
! is defined $pseq, 1;
! is $plength > 0, 1;
! is length($pseq->subseq(100, 299)), 200;
! is $pseq->trunc(100,199)->length(), 100;
! is $pseq->alphabet(), 'dna';
! is $pseq->display_id(), 'HSBA536C5';
! is $pseq->accession_number(), 'unknown';
! is $pseq->desc, 'this is my description';
! is open(OUT, ">$tmpfile"), 1;
my $seqout = new Bio::SeqIO('-format' => 'largefasta',
'-fh' => \*OUT );
! is defined $seqout, 1;
! is $seqout->write_seq($pseq), 1;
$seqout->close();
close(OUT);
***************
*** 48,56 ****
'-file' => $tmpfile);
my $pseq2 = $seqin->next_seq;
! ok ($plength, $pseq2->length(),
! "written file was not same length as expected");
! ok ($pseq->display_id(), $pseq2->display_id(),
! "display ids were not identical as expected");
! ok ($pseq->desc(), $pseq2->desc() ,
! "description was not identical (" . $pseq->desc() .
! "," . $pseq2->desc() . ")");
--- 49,53 ----
'-file' => $tmpfile);
my $pseq2 = $seqin->next_seq;
! is ($plength, $pseq2->length());
! is ($pseq->display_id(), $pseq2->display_id());
! is ($pseq->desc(), $pseq2->desc());
Index: LocusLink.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/LocusLink.t,v
retrieving revision 1.8
retrieving revision 1.9
diff -C2 -d -r1.8 -r1.9
*** LocusLink.t 8 Jun 2006 02:11:12 -0000 1.8
--- LocusLink.t 11 Apr 2007 21:48:09 -0000 1.9
***************
*** 7,42 ****
BEGIN {
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
eval {
require Graph::Directed;
- $HAVEGRAPHDIRECTED=1;
};
if ($@) {
! $HAVEGRAPHDIRECTED = 0;
! warn "Graph::Directed not installed, skipping tests\n";
}
! plan tests => ($NUMTESTS = 23);
}
END {
- foreach ( $Test::ntest..$NUMTESTS) {
- skip('Cannot complete LocusLink tests, skipping',1);
- }
unlink("locuslink-test.out.embl") if -e "locuslink-test.out.embl";
}
- exit(0) unless $HAVEGRAPHDIRECTED;
-
- use Bio::SeqIO;
- use Bio::Root::IO;
- use Bio::SeqFeature::Generic;
- use Bio::SeqFeature::AnnotationAdaptor;
-
- ok(1);
-
my $seqin = Bio::SeqIO->new(-file => Bio::Root::IO->catfile("t","data",
"LL-sample.seq"),
--- 7,33 ----
BEGIN {
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
eval {
require Graph::Directed;
};
if ($@) {
! plan skip_all => "Graph::Directed not installed, skipping tests";
! } else {
! plan tests => ($NUMTESTS = 26);
}
! use_ok('Bio::SeqIO');
! use_ok('Bio::Root::IO');
! use_ok('Bio::SeqFeature::Generic');
! use_ok('Bio::SeqFeature::AnnotationAdaptor');
}
END {
unlink("locuslink-test.out.embl") if -e "locuslink-test.out.embl";
}
my $seqin = Bio::SeqIO->new(-file => Bio::Root::IO->catfile("t","data",
"LL-sample.seq"),
***************
*** 67,77 ****
}
! ok (scalar(@seqs), 2);
! ok ($seqs[0]->desc,
"amiloride binding protein 1 (amine oxidase (copper-containing))");
! ok ($seqs[0]->accession, "26");
! ok ($seqs[0]->display_id, "ABP1");
! ok ($seqs[0]->species->binomial, "Homo sapiens");
--- 58,68 ----
}
! is (scalar(@seqs), 2);
! is ($seqs[0]->desc,
"amiloride binding protein 1 (amine oxidase (copper-containing))");
! is ($seqs[0]->accession, "26");
! is ($seqs[0]->display_id, "ABP1");
! is ($seqs[0]->species->binomial, "Homo sapiens");
***************
*** 80,105 ****
foreach (@dblinks) { $counts{$_->database()}++; }
! ok ($counts{GenBank}, 11);
! ok ($counts{RefSeq}, 4);
! ok ($counts{UniGene}, 1);
! ok ($counts{Pfam}, 1);
! ok ($counts{STS}, 2);
! ok ($counts{MIM}, 1);
! ok ($counts{PUBMED}, 6);
! ok (scalar(@dblinks), 27);
! ok ($seqs[1]->desc, "v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)");
! ok ($seqs[1]->display_id, "ABL2");
my $ac = $seqs[1]->annotation;
my @keys = $ac->get_all_annotation_keys();
! ok (scalar(@keys), 19);
my ($cmt) = $ac->get_Annotations('comment');
! ok (length($cmt->text), 403);
my @isoforms = qw(a b);
foreach ($ac->get_Annotations('PRODUCT')) {
! ok ($_->value,
"v-abl Abelson murine leukemia viral oncogene homolog 2 isoform ".
shift(@isoforms));
--- 71,96 ----
foreach (@dblinks) { $counts{$_->database()}++; }
! is ($counts{GenBank}, 11);
! is ($counts{RefSeq}, 4);
! is ($counts{UniGene}, 1);
! is ($counts{Pfam}, 1);
! is ($counts{STS}, 2);
! is ($counts{MIM}, 1);
! is ($counts{PUBMED}, 6);
! is (scalar(@dblinks), 27);
! is ($seqs[1]->desc, "v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)");
! is ($seqs[1]->display_id, "ABL2");
my $ac = $seqs[1]->annotation;
my @keys = $ac->get_all_annotation_keys();
! is (scalar(@keys), 19);
my ($cmt) = $ac->get_Annotations('comment');
! is (length($cmt->text), 403);
my @isoforms = qw(a b);
foreach ($ac->get_Annotations('PRODUCT')) {
! is ($_->value,
"v-abl Abelson murine leukemia viral oncogene homolog 2 isoform ".
shift(@isoforms));
***************
*** 113,119 ****
}
}
! ok (scalar(@goann), 4);
@goann = sort { $a->as_text() cmp $b->as_text() } @goann;
! ok ($goann[2]->as_text, "cellular component|cytoplasm|");
--- 104,110 ----
}
}
! is (scalar(@goann), 4);
@goann = sort { $a->as_text() cmp $b->as_text() } @goann;
! is ($goann[2]->as_text, "cellular component|cytoplasm|");
Index: LiveSeq.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/LiveSeq.t,v
retrieving revision 1.14
retrieving revision 1.15
diff -C2 -d -r1.14 -r1.15
*** LiveSeq.t 8 Jan 2002 01:20:46 -0000 1.14
--- LiveSeq.t 11 Apr 2007 21:48:09 -0000 1.15
***************
*** 15,45 ****
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
! $NUMTESTS = 48;
! plan tests => $NUMTESTS;
! $error = 0;
! eval { require 'IO/String.pm' };
if( $@ ) {
! print STDERR "IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping tests.\n";
! for( 1..$NUMTESTS ) {
! skip("IO::String not installed",1);
}
! $error = 1;
! }
! }
!
! if( $error == 1 ) {
! exit(0);
}
- require Bio::LiveSeq::IO::BioPerl;
- require Bio::Root::IO;
-
- ok(1);
-
my $loader=Bio::LiveSeq::IO::BioPerl->load(-db=>"EMBL",
-file=>Bio::Root::IO->catfile("t","data","factor7.embl"));
--- 15,33 ----
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
! eval { require IO::String };
if( $@ ) {
! plan skip_all => "IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping tests.";
! } else {
! plan tests => $NUMTESTS = 49;
}
! use_ok('Bio::LiveSeq::IO::BioPerl');
! use_ok('Bio::Root::IO');
}
my $loader=Bio::LiveSeq::IO::BioPerl->load(-db=>"EMBL",
-file=>Bio::Root::IO->catfile("t","data","factor7.embl"));
***************
*** 48,103 ****
ok $gene;
ok ref($gene), "Bio::LiveSeq::Gene";
! ok $gene->name, "factor7";
! ok $gene->get_DNA->alphabet, "dna";
! ok $gene->get_DNA->display_id, "HSCFVII";
! ok $gene->get_DNA->accession_number, "J02933";
! ok $gene, $gene->get_DNA->gene;
! ok $gene->get_DNA->desc, "Human blood coagulation factor VII gene, complete cds.";
! ok $gene->get_DNA->source, "Homo sapiens";
! ok $gene->get_DNA->start, 1;
! ok $gene->get_DNA->end, 12850;
! ok $gene->maxtranscript->start, 487;
! ok $gene->maxtranscript->end, 12686;
! ok $gene->upbound, 487;
! ok $gene->downbound, 12686;
ok not(defined($gene->get_Repeat_Units));
my @exons = @{$gene->get_Exons};
my @introns = @{$gene->get_Introns};
! ok scalar(@exons), 9;
! ok scalar(@introns), 8;
! ok $introns[4]->desc, "Intron D";
! ok $introns[4]->start, 6592;
! ok $introns[4]->end, 8306;
! ok $exons[1]->desc, "optional";
! ok $exons[4]->end, 6591;
my $transcript = $gene->get_Transcripts->[0];
my $translation = $gene->get_Translations->[0];
! ok $transcript , $translation->get_Transcript;
! ok $translation , $transcript->get_Translation;
@exons = $transcript->all_Exons;
! ok $exons[4]->end , 6591;
! ok $exons[4]->length , 114;
! ok $transcript->upstream_seq, "tcaacaggcaggggcagcactgcagagatttcatc";
! ok substr($transcript->downstream_seq,0,16), "cccagcagccctggcc";
! ok $transcript->position($transcript->label(666)), 666;
! ok $transcript->position($transcript->label(666),9419), 95;
! ok $transcript->labelsubseq(8447,undef,9419), "gt";
! ok $transcript->labelsubseq(8447,2), "gt";
! ok $gene->get_DNA->labelsubseq(8447,2), "gg";
! ok substr($gene->get_DNA->labelsubseq(8447,undef,9419),0,16), "ggtgaccaggcttcat";
! ok $gene->get_DNA, $transcript->{seq};
my ($nothing,$whichexon) = $transcript->in_which_Exon(9419);
! ok $whichexon , 7;
! ok $transcript->frame(9419) , 1;
! ok $transcript->frame(9420) , 2;
! ok substr($translation->seq,0,16), "MVSQALRLLCLLLGLQ";
! ok substr($transcript->seq,0,32), "atggtctcccaggccctcaggctcctctgcct";
ok $transcript->translation_table(2);
! ok $transcript->translation_table , 2;
! ok substr($translation->seq,0,16), "MVSQAL*"; # mitochondrial table creates stop codon
! ok $gene->verbose(2), 2;
ok $gene->delete_Obj(); # to free all memory, deleting circular references
--- 36,91 ----
ok $gene;
ok ref($gene), "Bio::LiveSeq::Gene";
! is $gene->name, "factor7";
! is $gene->get_DNA->alphabet, "dna";
! is $gene->get_DNA->display_id, "HSCFVII";
! is $gene->get_DNA->accession_number, "J02933";
! is $gene, $gene->get_DNA->gene;
! is $gene->get_DNA->desc, "Human blood coagulation factor VII gene, complete cds.";
! is $gene->get_DNA->source, "Homo sapiens";
! is $gene->get_DNA->start, 1;
! is $gene->get_DNA->end, 12850;
! is $gene->maxtranscript->start, 487;
! is $gene->maxtranscript->end, 12686;
! is $gene->upbound, 487;
! is $gene->downbound, 12686;
ok not(defined($gene->get_Repeat_Units));
my @exons = @{$gene->get_Exons};
my @introns = @{$gene->get_Introns};
! is scalar(@exons), 9;
! is scalar(@introns), 8;
! is $introns[4]->desc, "Intron D";
! is $introns[4]->start, 6592;
! is $introns[4]->end, 8306;
! is $exons[1]->desc, "optional";
! is $exons[4]->end, 6591;
my $transcript = $gene->get_Transcripts->[0];
my $translation = $gene->get_Translations->[0];
! is $transcript , $translation->get_Transcript;
! is $translation , $transcript->get_Translation;
@exons = $transcript->all_Exons;
! is $exons[4]->end , 6591;
! is $exons[4]->length , 114;
! is $transcript->upstream_seq, "tcaacaggcaggggcagcactgcagagatttcatc";
! is substr($transcript->downstream_seq,0,16), "cccagcagccctggcc";
! is $transcript->position($transcript->label(666)), 666;
! is $transcript->position($transcript->label(666),9419), 95;
! is $transcript->labelsubseq(8447,undef,9419), "gt";
! is $transcript->labelsubseq(8447,2), "gt";
! is $gene->get_DNA->labelsubseq(8447,2), "gg";
! is substr($gene->get_DNA->labelsubseq(8447,undef,9419),0,16), "ggtgaccaggcttcat";
! is $gene->get_DNA, $transcript->{seq};
my ($nothing,$whichexon) = $transcript->in_which_Exon(9419);
! is $whichexon , 7;
! is $transcript->frame(9419) , 1;
! is $transcript->frame(9420) , 2;
! is substr($translation->seq,0,16), "MVSQALRLLCLLLGLQ";
! is substr($transcript->seq,0,32), "atggtctcccaggccctcaggctcctctgcct";
ok $transcript->translation_table(2);
! is $transcript->translation_table , 2;
! is substr($translation->seq,0,16), "MVSQAL*"; # mitochondrial table creates stop codon
! is $gene->verbose(2), 2;
ok $gene->delete_Obj(); # to free all memory, deleting circular references
Index: LargeLocatableSeq.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/LargeLocatableSeq.t,v
retrieving revision 1.1
retrieving revision 1.2
diff -C2 -d -r1.1 -r1.2
*** LargeLocatableSeq.t 2 Feb 2004 11:19:43 -0000 1.1
--- LargeLocatableSeq.t 11 Apr 2007 21:48:09 -0000 1.2
***************
*** 5,35 ****
my $DEBUG = $ENV{'BIOPERLDEBUG'} || 0;
BEGIN {
! eval { require Test; };
if( $@ ) {
! use lib 't';
}
! use Test;
plan tests => 8;
}
-
- use Bio::Seq::LargeLocatableSeq;
- use Data::Dumper;
- ok 1;
-
ok my $llseq = Bio::Seq::LargeLocatableSeq->new(-seq => 'at-cg',
-display_id => 'seq1');
! print Dumper $llseq if $DEBUG;
!
! ok $llseq->isa("Bio::Seq::LargeSeqI");
!
! ok $llseq->seq, 'at-cg';
! ok $llseq->add_sequence_as_string('atcc'), 9;
! ok $llseq->start, 1;
! ok $llseq->end, 8;
! ok $llseq->length, 9;
! 1;
--- 5,27 ----
my $DEBUG = $ENV{'BIOPERLDEBUG'} || 0;
BEGIN {
! eval { require Test::More; };
if( $@ ) {
! use lib 't/lib';
}
! use Test::More;
plan tests => 8;
+ use_ok('Bio::Seq::LargeLocatableSeq');
}
ok my $llseq = Bio::Seq::LargeLocatableSeq->new(-seq => 'at-cg',
-display_id => 'seq1');
! isa_ok $llseq, "Bio::Seq::LargeSeqI";
! is $llseq->seq, 'at-cg';
! is $llseq->add_sequence_as_string('atcc'), 9;
! is $llseq->start, 1;
! is $llseq->end, 8;
! is $llseq->length, 9;
Index: lasergene.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/lasergene.t,v
retrieving revision 1.2
retrieving revision 1.3
diff -C2 -d -r1.2 -r1.3
*** lasergene.t 9 Jun 2006 04:26:20 -0000 1.2
--- lasergene.t 11 Apr 2007 21:48:09 -0000 1.3
***************
*** 6,24 ****
use vars qw($NUMTESTS);
BEGIN {
! $NUMTESTS = 11;
# to handle systems with no installed Test module
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test; };
if ( $@ ) {
! use lib 't';
}
! use Test;
plan tests => $NUMTESTS;
}
- use Bio::SeqIO::raw;
- use Bio::Root::IO;
-
my $verbose = $ENV{'BIOPERLDEBUG'};
--- 6,23 ----
use vars qw($NUMTESTS);
BEGIN {
! $NUMTESTS = 13;
# to handle systems with no installed Test module
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
! eval { require Test::More; };
if ( $@ ) {
! use lib 't/lib';
}
! use Test::More;
plan tests => $NUMTESTS;
+ use_ok('Bio::SeqIO::raw');
+ use_ok('Bio::Root::IO');
}
my $verbose = $ENV{'BIOPERLDEBUG'};
***************
*** 38,49 ****
ok($seq = $io->next_seq);
! ok($seq->length, 12*3);
! ok($seq->subseq(1,12) eq 'ATCGATCGATCG');
ok($seq = $io->next_seq);
! ok($seq->length, 200);
ok($seq = $io->next_seq);
! ok($seq->length, 70*5+12);
ok(not defined $io->next_seq);
--- 37,48 ----
ok($seq = $io->next_seq);
! is($seq->length, 12*3);
! is($seq->subseq(1,12), 'ATCGATCGATCG');
ok($seq = $io->next_seq);
! is($seq->length, 200);
ok($seq = $io->next_seq);
! is($seq->length, 70*5+12);
ok(not defined $io->next_seq);
***************
*** 64,67 ****
$io->next_seq;
};
! ok($@ =~ m/unexpected end of file/i);
--- 63,66 ----
$io->next_seq;
};
! like($@, qr/unexpected end of file/i);
- Previous message: [Bioperl-guts-l] bioperl-live/t IUPAC.t, 1.2, 1.3 Index.t, 1.48, 1.49 InstanceSite.t, 1.5, 1.6 InterProParser.t, 1.11, 1.12 interpro.t, 1.3, 1.4 kegg.t, 1.2, 1.3
- Next message: [Bioperl-guts-l] bioperl-live/t lucy.t,1.2,1.3
- Messages sorted by:
[ date ]
[ thread ]
[ subject ]
[ author ]
More information about the Bioperl-guts-l
mailing list