[Bioperl-guts-l] bioperl-live/t rnamotif.t,1.7,1.8

Christopher John Fields cjfields at dev.open-bio.org
Thu Jan 18 00:58:41 EST 2007


Update of /home/repository/bioperl/bioperl-live/t
In directory dev.open-bio.org:/tmp/cvs-serv4952

Modified Files:
	rnamotif.t 
Log Message:
Added Bio::Tools::Infernal tests

Index: rnamotif.t
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/t/rnamotif.t,v
retrieving revision 1.7
retrieving revision 1.8
diff -C2 -d -r1.7 -r1.8
*** rnamotif.t	11 Jan 2007 16:02:13 -0000	1.7
--- rnamotif.t	18 Jan 2007 05:58:39 -0000	1.8
***************
*** 25,33 ****
  	}
  	else {
! 		plan tests => 72;
  	}
  }
  
! use Bio::Tools::ERPIN;
  use Bio::Root::IO;
  my $verbose = $ENV{'BIOPERLDEBUG'} || 0;
--- 25,34 ----
  	}
  	else {
! 		plan tests => 116;
  	}
  }
  
! use_ok('Bio::Tools::ERPIN');
! use_ok('Bio::Tools::Infernal');
  use Bio::Root::IO;
  my $verbose = $ENV{'BIOPERLDEBUG'} || 0;
***************
*** 145,147 ****
  
  ### Infernal.pm tests ###
! ### FASTR.pm tests ###
\ No newline at end of file
--- 146,245 ----
  
  ### Infernal.pm tests ###
! 
! my @stats = (
! ['30260185','5181155','5181183',1,'CTTT.aacc--.CAACC.CCGTGA.GGTTG.a.GAAG',0,
!  'gi|30260185|gb|AE016879.1| Bacillus anthracis str. Ames, complete genome',
!  0,'1.68e-05'],
! ['30260185','3709092','3709121',-1,'CTTT.taatt-.CAGTC.CTGTGA.GACCG.g.AAAG',0,
!  'gi|30260185|gb|AE016879.1| Bacillus anthracis str. Ames, complete genome',
!  0,'5.61e-05'],
! ['30260185','3710524','3710553',-1,'TTTT.aaatg-.TAGTC.CTGTGA.GGCTG.c.CAAA',0,
!  'gi|30260185|gb|AE016879.1| Bacillus anthracis str. Ames, complete genome',
!  0,'1.31e-04'],
! ['30260185','3711223','3711251',-1,'CTTT.aaca--.CAGCC.CCGTGA.GGTTG.a.GAAG',0,
!  'gi|30260185|gb|AE016879.1| Bacillus anthracis str. Ames, complete genome',
!  0,'4.44e-06']
! );
! 
! $parser = Bio::Tools::Infernal->new(
!             -file => Bio::Root::IO->catfile('t','data','test.infernal'),
!             -motiftag => 'misc_binding',
!             -desctag => 'Purine riboswitch',
!             -cm    => 'Purine',
!             -rfam  =>  'RF00167',
!             -minscore => 20);
! 
! my $gene = $parser->next_prediction;
! # get query (model) data
! is($gene->display_name, 'Purine riboswitch','Infernal::display_name()');
! is($gene->seq_id, 'RF00167','Infernal::seq_id()');
! is($gene->primary_tag, 'misc_binding','Infernal::primary_tag()');
! is($gene->source_tag, 'Infernal 0.71','Infernal::source_tag()');
! is($gene->start, '1','Infernal::start()');
! is($gene->end, '102','Infernal::end()');
! is($gene->strand, '0','Infernal::strand()');
! is($gene->score, '78.40','Infernal::strand()');
! # get hit data
! $gene->invert;
! is($gene->display_name, 'Purine riboswitch','Infernal::display_name()');
! is($gene->seq_id, '2239287','Infernal::seq_id()');
! is($gene->primary_tag, 'misc_binding','Infernal::primary_tag()');
! is($gene->source_tag, 'Infernal 0.71','Infernal::source_tag()');
! is($gene->start, '15589','Infernal::start()');
! is($gene->end, '15691','Infernal::end()');
! is($gene->strand, '1','Infernal::strand()');
! is($gene->score, '78.40','Infernal::strand()');
! 
! is($gene->get_Annotations('model'),
!    'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcG.aGuaAauauuaaauauuu',
!    "Infernal::get_Annotations('model')");
! is($gene->get_Annotations('midline'),
!    ' A+ A+A+ AAAA A   :CUC:UAUAAU: :GGGAAUAUGGCCC: :AGUUUCUACC:GGCAACCGUAAAUUGCC:GACUA:G AG: AA + ++  +++++',
!    "Infernal::get_Annotations('midline')");
! is($gene->get_Annotations('hit'),
!    'CAUGAAAUCAAAACACGACCUCAUAUAAUCUUGGGAAUAUGGCCCAUAAGUUUCUACCCGGCAACCGUAAAUUGCCGGACUAUGcAGGGAAGUGAUCGAUAAA',
!    "Infernal::get_Annotations('hit')");
! is($gene->get_Annotations('secstructure'),
!    ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,)))).))))::::::::::::::',
!    "Infernal::get_Annotations('secstructure')");
! is($gene->get_Annotations('seq_name'),
!    'gi|2239287|gb|U51115.1|BSU51115',
!    "Infernal::get_Annotations('seq_name')");
! 
! $gene = $parser->next_prediction;
! # get query (model) data
! is($gene->display_name, 'Purine riboswitch','Infernal::display_name()');
! is($gene->seq_id, 'RF00167','Infernal::seq_id()');
! is($gene->primary_tag, 'misc_binding','Infernal::primary_tag()');
! is($gene->source_tag, 'Infernal 0.71','Infernal::source_tag()');
! is($gene->start, '1','Infernal::start()');
! is($gene->end, '102','Infernal::end()');
! is($gene->strand, '0','Infernal::strand()');
! is($gene->score, '81.29','Infernal::strand()');
! 
! $gene->invert; # switch to get hit data
! is($gene->display_name, 'Purine riboswitch','Infernal::display_name()');
! is($gene->seq_id, '2239287','Infernal::seq_id()');
! is($gene->primary_tag, 'misc_binding','Infernal::primary_tag()');
! is($gene->source_tag, 'Infernal 0.71','Infernal::source_tag()');
! is($gene->start, '11655','Infernal::start()');
! is($gene->end, '11756','Infernal::end()');
! is($gene->strand, '1','Infernal::strand()');
! is($gene->score, '81.29','Infernal::strand()');
! 
! is($gene->get_Annotations('model'),
!    'aAaaauaaAaaaaaaaauaCuCgUAUAaucucgggAAUAUGGcccgagaGUuUCUACCaGgcaaCCGUAAAuugcCuGACUAcGaGuaAauauuaaauauuu',
!    "Infernal::get_Annotations('model')");
! is($gene->get_Annotations('midline'),
!    'A AAAU AAA+AA A+   : CGUAUAAU::CG:GAAUAUGGC:CG::AGU UCUACCA:GC ACCGUAAAU GC:UGACUACG :   AU+U +++  UUU',
!    "Infernal::get_Annotations('midline')");
! is($gene->get_Annotations('hit'),
!    'AGAAAUCAAAUAAGAUGAAUUCGUAUAAUCGCGGGAAUAUGGCUCGCAAGUCUCUACCAAGCUACCGUAAAUGGCUUGACUACGUAAACAUUUCUUUCGUUU',
!    "Infernal::get_Annotations('hit')");
! is($gene->get_Annotations('secstructure'),
!    ':::::::::::::::::((((((((,,,<<<<<<<_______>>>>>>>,,,,,,,,<<<<<<<_______>>>>>>>,,))))))))::::::::::::::',
!    "Infernal::get_Annotations('secstructure')");
! is($gene->get_Annotations('seq_name'),
!    'gi|2239287|gb|U51115.1|BSU51115',
!    "Infernal::get_Annotations('seq_name')");
! 



More information about the Bioperl-guts-l mailing list