[Bioperl-guts-l] bioperl-live/Bio/Restriction Analysis.pm, 1.20, 1.21 Enzyme.pm, 1.19, 1.20 EnzymeCollection.pm, 1.13, 1.14

Senduran Balasubramaniam sendu at dev.open-bio.org
Thu Jun 14 10:16:15 EDT 2007


Update of /home/repository/bioperl/bioperl-live/Bio/Restriction
In directory dev.open-bio.org:/tmp/cvs-serv22328/Bio/Restriction

Modified Files:
	Analysis.pm Enzyme.pm EnzymeCollection.pm 
Log Message:
removed bad "new Bio::Module" syntax, replaced with "Bio::Module->new"

Index: EnzymeCollection.pm
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/Bio/Restriction/EnzymeCollection.pm,v
retrieving revision 1.13
retrieving revision 1.14
diff -C2 -d -r1.13 -r1.14
*** EnzymeCollection.pm	31 Oct 2006 13:30:20 -0000	1.13
--- EnzymeCollection.pm	14 Jun 2007 14:16:13 -0000	1.14
***************
*** 314,318 ****
  sub blunt_enzymes {
      my $self=shift;
!     my $bs = new Bio::Restriction::EnzymeCollection(-empty => 1);
      return $bs->enzymes(  grep { $_->overhang eq 'blunt' }  $self->each_enzyme );
  }
--- 314,318 ----
  sub blunt_enzymes {
      my $self=shift;
!     my $bs = Bio::Restriction::EnzymeCollection->new(-empty => 1);
      return $bs->enzymes(  grep { $_->overhang eq 'blunt' }  $self->each_enzyme );
  }
***************
*** 347,351 ****
              unless $size =~ /[+]?[\d\.]+/;
  
!         my $bs = new Bio::Restriction::EnzymeCollection(-empty => 1);
  
          foreach my $e ($self->each_enzyme) {
--- 347,351 ----
              unless $size =~ /[+]?[\d\.]+/;
  
!         my $bs = Bio::Restriction::EnzymeCollection->new(-empty => 1);
  
          foreach my $e ($self->each_enzyme) {
***************
*** 375,379 ****
          $inclusive = 0 if $exclusive;
  
!         my $bs = new Bio::Restriction::EnzymeCollection(-empty => 1);
          if ($inclusive) {
              foreach my $e ($self->each_enzyme) {
--- 375,379 ----
          $inclusive = 0 if $exclusive;
  
!         my $bs = Bio::Restriction::EnzymeCollection->new(-empty => 1);
          if ($inclusive) {
              foreach my $e ($self->each_enzyme) {

Index: Analysis.pm
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/Bio/Restriction/Analysis.pm,v
retrieving revision 1.20
retrieving revision 1.21
diff -C2 -d -r1.20 -r1.21
*** Analysis.pm	26 Sep 2006 22:03:12 -0000	1.20
--- Analysis.pm	14 Jun 2007 14:16:13 -0000	1.21
***************
*** 22,26 ****
  
    # get a DNA sequence from somewhere
!   my $seq = new Bio::PrimarySeq
        (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC',
         -primary_id => 'synopsis',
--- 22,26 ----
  
    # get a DNA sequence from somewhere
!   my $seq = Bio::PrimarySeq->new
        (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC',
         -primary_id => 'synopsis',
***************
*** 478,482 ****
    use Bio::PrimarySeq;
  
!   my $seq = new Bio::PrimarySeq
        (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATCCAAAAAAGAGTGAGCTTCTGAT',
         -primary_id => 'synopsis',
--- 478,482 ----
    use Bio::PrimarySeq;
  
!   my $seq = Bio::PrimarySeq->new
        (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATCCAAAAAAGAGTGAGCTTCTGAT',
         -primary_id => 'synopsis',
***************
*** 702,706 ****
      }
      $end = $self->{'maximum_cuts'} if $end > $self->{'maximum_cuts'};
!     my $set = new Bio::Restriction::EnzymeCollection(-empty => 1);
  
      #return an empty set if nothing cuts
--- 702,706 ----
      }
      $end = $self->{'maximum_cuts'} if $end > $self->{'maximum_cuts'};
!     my $set = Bio::Restriction::EnzymeCollection->new(-empty => 1);
  
      #return an empty set if nothing cuts

Index: Enzyme.pm
===================================================================
RCS file: /home/repository/bioperl/bioperl-live/Bio/Restriction/Enzyme.pm,v
retrieving revision 1.19
retrieving revision 1.20
diff -C2 -d -r1.19 -r1.20
*** Enzyme.pm	8 Mar 2007 17:02:39 -0000	1.19
--- Enzyme.pm	14 Jun 2007 14:16:13 -0000	1.20
***************
*** 25,29 ****
  
    # define a new enzyme with the cut sequence
!   my $re=new Bio::Restriction::Enzyme
        (-enzyme=>'EcoRI', -seq=>'G^AATTC');
  
--- 25,29 ----
  
    # define a new enzyme with the cut sequence
!   my $re=Bio::Restriction::Enzyme->new
        (-enzyme=>'EcoRI', -seq=>'G^AATTC');
  
***************
*** 455,459 ****
          # now set the recognition site as a new Bio::PrimarySeq object
          # we need it before calling cut() and complementary_cut()
!         $self->{_seq} = new Bio::PrimarySeq(-id=>$self->name,
                                              -seq=>$site,
                                              -verbose=>$self->verbose,
--- 455,459 ----
          # now set the recognition site as a new Bio::PrimarySeq object
          # we need it before calling cut() and complementary_cut()
!         $self->{_seq} = Bio::PrimarySeq->new(-id=>$self->name,
                                              -seq=>$site,
                                              -verbose=>$self->verbose,



More information about the Bioperl-guts-l mailing list