[Bioperl-guts-l] [15377] bioperl-live/trunk: Should be Bio::Seq::Quality, not a simple Bio:: Seq

Christopher John Fields cjfields at dev.open-bio.org
Thu Jan 15 15:25:51 EST 2009


Revision: 15377
Author:   cjfields
Date:     2009-01-15 15:25:51 -0500 (Thu, 15 Jan 2009)

Log Message:
-----------
Should be Bio::Seq::Quality, not a simple Bio::Seq

Modified Paths:
--------------
    bioperl-live/trunk/Bio/SeqIO/alf.pm
    bioperl-live/trunk/Bio/SeqIO/pln.pm
    bioperl-live/trunk/t/SeqIO/alf.t
    bioperl-live/trunk/t/SeqIO/pln.t

Modified: bioperl-live/trunk/Bio/SeqIO/alf.pm
===================================================================
--- bioperl-live/trunk/Bio/SeqIO/alf.pm	2009-01-15 20:24:40 UTC (rev 15376)
+++ bioperl-live/trunk/Bio/SeqIO/alf.pm	2009-01-15 20:25:51 UTC (rev 15377)
@@ -77,7 +77,7 @@
   my($self, at args) = @_;
   $self->SUPER::_initialize(@args);  
   if( ! defined $self->sequence_factory ) {
-      $self->sequence_factory(Bio::Seq::SeqFactory->new(-verbose => $self->verbose(), -type => 'Bio::Seq'));      
+      $self->sequence_factory(Bio::Seq::SeqFactory->new(-verbose => $self->verbose(), -type => 'Bio::Seq::Quality'));      
   }
   unless ($READ_AVAIL) {
       Bio::Root::Root->throw( -class => 'Bio::Root::SystemException',
@@ -91,7 +91,7 @@
  Title   : next_seq
  Usage   : $seq = $stream->next_seq()
  Function: returns the next sequence in the stream
- Returns : Bio::SeqWithQuality object
+ Returns : Bio::Seq::Quality object
  Args    : NONE
 
 =cut

Modified: bioperl-live/trunk/Bio/SeqIO/pln.pm
===================================================================
--- bioperl-live/trunk/Bio/SeqIO/pln.pm	2009-01-15 20:24:40 UTC (rev 15376)
+++ bioperl-live/trunk/Bio/SeqIO/pln.pm	2009-01-15 20:25:51 UTC (rev 15377)
@@ -77,7 +77,7 @@
   my($self, at args) = @_;
   $self->SUPER::_initialize(@args);  
   if( ! defined $self->sequence_factory ) {
-      $self->sequence_factory(Bio::Seq::SeqFactory->new(-verbose => $self->verbose(), -type => 'Bio::Seq'));      
+      $self->sequence_factory(Bio::Seq::SeqFactory->new(-verbose => $self->verbose(), -type => 'Bio::Seq::Quality'));      
   }
   unless ($READ_AVAIL) {
       Bio::Root::Root->throw( -class => 'Bio::Root::SystemException',
@@ -91,7 +91,7 @@
  Title   : next_seq
  Usage   : $seq = $stream->next_seq()
  Function: returns the next sequence in the stream
- Returns : Bio::SeqWithQuality object
+ Returns : Bio::Seq::Quality object
  Args    : NONE
 
 =cut

Modified: bioperl-live/trunk/t/SeqIO/alf.t
===================================================================
--- bioperl-live/trunk/t/SeqIO/alf.t	2009-01-15 20:24:40 UTC (rev 15376)
+++ bioperl-live/trunk/t/SeqIO/alf.t	2009-01-15 20:25:51 UTC (rev 15377)
@@ -8,9 +8,7 @@
     use Bio::Root::Test;
     
     test_begin(-tests               => 8,
-			   -requires_modules    => [],
-			   -requires_networking => 0,
-			  );
+			   -requires_module     => 'Bio::SeqIO::staden::read');
 	
 	use_ok('Bio::SeqIO::alf');
 }
@@ -34,7 +32,7 @@
 	
 	# checking the first sequence object
 	my $seq_obj = $seqio_obj->next_seq();
-	isa_ok($seq_obj, 'Bio::Seq');
+	isa_ok($seq_obj, 'Bio::Seq::Quality');
 	my %expected = ('seq'         => '' .
 					'length'      => '',
 					'primary_id'  => '',

Modified: bioperl-live/trunk/t/SeqIO/pln.t
===================================================================
--- bioperl-live/trunk/t/SeqIO/pln.t	2009-01-15 20:24:40 UTC (rev 15376)
+++ bioperl-live/trunk/t/SeqIO/pln.t	2009-01-15 20:25:51 UTC (rev 15377)
@@ -7,7 +7,7 @@
 	use lib '.';
     use Bio::Root::Test;
     
-    test_begin(-tests => 3,
+    test_begin(-tests => 4,
 			   -requires_module => 'Bio::SeqIO::staden::read');
 	
     use_ok('Bio::SeqIO::pln');
@@ -19,4 +19,5 @@
 			 -verbose => $verbose,
 			 -file => test_input_file('test.pln'));
 ok(my $seq = $io->next_seq);
+isa_ok($seq, 'Bio::Seq::Quality');
 is($seq->seq, "GATGATTCCGGCTTCGGACGACTCTAGAGGATCCCCATTTTTATAGTTTTTATCTTGTAATAGATGTTTAGATTTTTCGTTGTAATTATTTTCTTTATTGTTGAAATTAGTATCTCTGGGTAATTTATCATATTCTCTGGAAAATGATTTACTATCACTAGATACTTCATAAGATTTATAATCTTTATTATGAAAATCATCTCTATTTTTCAAATTATTATTATATCTATCAAAGTTTCTGTCTTCATTATATCTATTAGCATATCTATCTTTATCTTTATCCCTATCACTATATCTATCATATGGTTCATCTTGTTCAACCGATCAGACTCGATTCGCCATCGCCTCTAACGGATGGCCGCTCCCCCTCTCATACCTCGCTCCCCTCGACATCCCCCGTCTCGCCACCCTATCCGCCCCCTTCATCACCCCCCCTTATCCACACCCTCACCCCCCGCATCGCGCACCCACGACCACCCGAAGAACCGCCCTTACTCCCAAGTACGCCCCGACCTCCATCACCCTATGCGGTACCACTCCCACCACACCCAGTCCTACTTTCGCCCGCACATCGGCCCCGCTTCAGACAGCTCCCAACTACGCAACCCACGCTTGTTCTTGTTCACACTCGAATACTCGAATCTCTCATTACTCCGCGGACTCCGCCGCACCTGTGCACCATTAACTGTGTAGCGCCTGAACCGGCACCTCTGATTACCACTTCCTCCACCAGCACAGTCCTATTACCGCATGTCGCTCTGCTAAGACAGTGCAAGACTCTGCGGTCGCTCTGACCCGCATCCGCCAGGGCACCTCTCACCCTCGCTGGCCACCCCGCCCCCCTCTCCCTGCCCCTTCATTCCCCCAAACCGCTTTCAACGGGACACACCCCTCCGCGGCGGACCACAACTCGCCGTCGGCCACCACTCACACCTTCCCTCCTCCTTCCCCCACATCACGCCAACCCCGTGGG!
 ACGGCTCTCCCGCGGCTACGACGCGCAACCCCCCCTCGCCGCTTCCCCCCCAACTTCCCACGGGCTCCCCTCCGCCCCTTACCCGCGAGGAGCTTCACCCGCGAACCACCTCCCCCCTTTCCCAACAGCACCG");




More information about the Bioperl-guts-l mailing list