[Bioperl-guts-l] [BioPerl - Bug #3328] (New) segregating sites calculation fails on gapped sequences
redmine at redmine.open-bio.org
redmine at redmine.open-bio.org
Fri Feb 17 12:39:41 EST 2012
Issue #3328 has been reported by Jason Stajich.
----------------------------------------
Bug #3328: segregating sites calculation fails on gapped sequences
https://redmine.open-bio.org/issues/3328
Author: Jason Stajich
Status: New
Priority: Normal
Assignee: Bioperl Guts
Category: Bio::PopGen
Target version:
URL:
I am Cheng-Ruei Lee, a graduate student in Duke Biology. I'm analyzing many DNA alignments of a plant species.
I first used (Bio::PopGen::Utilities -> aln_to_population()) to read in the fasta format alignment, and then use Bio::PopGen::Statistics to calculate some statistics without outgroup. Most gene work fine, but I think a bug happened when it meets alignments like this:
>Genotype1
ATGATCGTAGCTGATGCTGTGATCGATCGCTAGCTAGCTCGA
>Genotype2
------------GATGCTGTGATCGATCGCTAGCTAGCTCGA
>Genotype3
------------GATGCTGTGATCGATCGCTAGCTAGCTCGA
>Genotype4
------------GATGCTGTGATCGATCGCTAGCTAGCTCGA
I get this data set from other people. I guess due to the annotation program people used, the definition of coding sequence is much longer in genotype 1 than in other genotypes. This creates a long stretch of gap in the very beginning. Whenever Bio::PopGen meets this kind of genes, the number of singleton counts boost a lot - seems like the long stretch of sites with gap is also counted as singletons. Also, some Fu & Li statistics boosted. The "number of segregation sites" seems not to be affected. (And therefore, there are genes with hundreds of singleton sites but only a few total segregating sites.)
May be a possible bug in Bio::PopGen::Utilities when reading in the data? Or when calculating singletons?
Sincerely,
Cheng-Ruei Lee <cl134 at duke.edu>
----------------------------------------
You have received this notification because this email was added to the New Issue Alert plugin
--
You have received this notification because you have either subscribed to it, or are involved in it.
To change your notification preferences, please click here and login: http://redmine.open-bio.org
More information about the Bioperl-guts-l
mailing list