[Bioperl-l] Forward of moderated message

Rob Edwards redwards at utmem.edu
Mon Mar 8 12:09:02 EST 2004

Are you sure that you are using the right module. This has been fixed 
in Bio::Restriction (ver. 1.4)


use Bio::Seq;
use Bio::Restriction::Enzyme;
use Bio::Restriction::Analysis;
use strict;

my $seq=Bio::Seq->new(-seq=>'GTACTTTTAGAGGATGAAACCT');
my $renz=Bio::Restriction::Enzyme->new(-enzyme=>'MnII', -seq=>'^CCTC');
my $ranal=Bio::Restriction::Analysis->new(-seq=>$seq, -enzymes=>$renz);
my $enz='MnII';
my @frags=$ranal->fragments($enz);

print join "\n", @frags, "\n";




On Mar 8, 2004, at 10:43 AM, bioperl-guts-l-bounces at portal.open-bio.org 

> From: Ruifang <zhangrf at xysm.net>
> Date: March 8, 2004 1:28:13 AM CST
> To: bioperl-guts-l at portal.open-bio.org
> Subject: a problem of RestrictionEnzyme
> Dear,
> I am a graduate student in National Lab of Medical Genetics of China.
> I am using Bioperl Module: RestrictionEnzyme.pm and I have encountered 
> a question about this code.
> I found  the restriction enzymes could not recognize the DAN sequence 
> which is reverse complement to the enzymes sequence.
> For example, the enzyme: MnlI, the recognize sequence :CCTC, the DNA 
> the DAN sequence include  GAGG , which is reverse complement to CCTC,  
> and the MnlI should cut this sequence, but the code could not give 
> this result.
> May I could have answer from you soon!
> Thanks!
> Best Wishes!
> Ruifang
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

More information about the Bioperl-l mailing list