From limericksean at gmail.com  Wed Jun  1 07:43:03 2005
From: limericksean at gmail.com (Sean O'Keeffe)
Date: Wed Jun  1 07:41:57 2005
Subject: [Bioperl-l] Bio::SearchIO::hmmer
Message-ID: <462784640506010443329e049d@mail.gmail.com>

Hi,
I was wondering how Bio::SearchIO::hmmer parses hmmpfam/hmmsearch
result files. I have a set of hmmpam result hits without alignments in
a file which I generated using hmmpfam locally (-A0 option on the
command line). Is this considered a valid result by
Bio::SearchIO::hmmer? If so, what might be wrong with the code below
(which gets as far as the first while loop and doesn't enter any
other):

use strict;
use Bio::SearchIO;

my $inhmmfile = "test-hmm.smart";
my $outputfilename = "HMM-test.hmmer.parsed";
my $fastafilename = "$outputfilename".".fasta";
my $inevalue =1;
my $inlength =20;
my ($myresult,$myhit,$myhsp,$mysignificance,$mylength,
$mynohit,$mylasthit,$mylastresult,$mypercent) = 0;

unless (open(PARSEDFILE, ">$outputfilename")) {
                print "Could not open file $outputfilename !\n";
                exit;
        }
  
unless (open(FASTAFILE, ">$fastafilename")) {
                print "Could not open file $fastafilename !\n";
                exit;
        }
   
my $in = new Bio::SearchIO(-format => 'hmmer', -file => $inhmmfile);

while(my $result = $in->next_result ) {
	$myresult++;
	while (my $hit = $result->next_hit ) {
		$myhit++;
    		while (my $hsp = $hit->next_hsp ) {
			$myhsp++;
    			if( $hsp->length('total') >= $inlength ) {
       				$mylength++;
	       			if ( $hit->significance <= $inevalue ) {
					$mysignificance++;
					
					print PARSEDFILE $result->query_name,"\t",
				     	$result->query_description,"\t",
				     	$result->query_length, "\t",
				     	$hit->description, "\t",
				     	$hit->accession, "\t",
				     	$hit->bits, "\t",
				     	$hit->significance, "\t",
				     	$hsp->num_identical, "\t",
				     	$hsp->num_conserved,"\t",
				     	$hsp->start('query'),"\t",
				     	$hsp->end('query'),"\t",
				     	$hsp->start('hit'),"\t",
				     	$hsp->end('hit'),"\n";

		    			print FASTAFILE  "> ", $hit->description,"\n",
					$hsp->hit_string,"\n";
				}
			}
		}
	}
      	
	if ($myhit == 0) {
               $mynohit++;
        }
     
     	$myhit = 0;
}
       
$mypercent = $mynohit*100 / $myresult;

print "\n\n", $myresult, " query sequence(s)\n";
print "\n", $myhsp, " HSP sequence(s) \n";
print "\n", $mylength, " hit(s) presenting the minimum requested length\n";	
print "\n", $mysignificance, " hit(s) presenting the minimum requested
E-value\n";
print "\n", $mynohit, " query sequence(s) presenting < NO HITS > ";
close (PARSEDFILE);
close (FASTAFILE);
exit;


Output is:
Use of uninitialized value in numeric eq (==) at ../hmm-test-parse.pl
line 58, <GEN1> line 40126.


1 query sequence(s)

Use of uninitialized value in print at ../hmm-test-parse.pl line 68,
<GEN1> line 40126.
 HSP sequence(s)

Use of uninitialized value in print at ../hmm-test-parse.pl line 69,
<GEN1> line 40126.
 hit(s) presenting the minimum requested length

Use of uninitialized value in print at ../hmm-test-parse.pl line 70,
<GEN1> line 40126.
 hit(s) presenting the minimum requested E-value

1 query sequence(s) presenting < NO HITS > (100.00 %)


Thanks very much,
Sean.

From limericksean at gmail.com  Wed Jun  1 09:08:02 2005
From: limericksean at gmail.com (Sean O'Keeffe)
Date: Wed Jun  1 09:03:15 2005
Subject: [Bioperl-l] Bio::SearchIO::hmmer
Message-ID: <4627846405060106084c917610@mail.gmail.com>

Hi,
I was wondering how Bio::SearchIO::hmmer parses hmmpfam/hmmsearch
result files. I have a set of hmmpam result hits without alignments in
a file which I generated using hmmpfam locally (-A0 option on the
command line). Is this considered a valid result by
Bio::SearchIO::hmmer? If so, what might be wrong with the code below
(which gets as far as the first while loop and doesn't enter any
other):

use strict;
use Bio::SearchIO;

my $inhmmfile = "test-hmm.smart";
my $outputfilename = "HMM-test.hmmer.parsed";
my $fastafilename = "$outputfilename".".fasta";
my $inevalue =1;
my $inlength =20;
my ($myresult,$myhit,$myhsp,$mysignificance,$mylength,
$mynohit,$mylasthit,$mylastresult,$mypercent) = 0;

unless (open(PARSEDFILE, ">$outputfilename")) {
               print "Could not open file $outputfilename !\n";
               exit;
       }

unless (open(FASTAFILE, ">$fastafilename")) {
               print "Could not open file $fastafilename !\n";
               exit;
       }

my $in = new Bio::SearchIO(-format => 'hmmer', -file => $inhmmfile);

while(my $result = $in->next_result ) {
       $myresult++;
       while (my $hit = $result->next_hit ) {
               $myhit++;
               while (my $hsp = $hit->next_hsp ) {
                       $myhsp++;
                       if( $hsp->length('total') >= $inlength ) {
                               $mylength++;
                               if ( $hit->significance <= $inevalue ) {
                                       $mysignificance++;

                                       print PARSEDFILE
$result->query_name,"\t",
                                       $result->query_description,"\t",
                                       $result->query_length, "\t",
                                       $hit->description, "\t",
                                       $hit->accession, "\t",
                                       $hit->bits, "\t",
                                       $hit->significance, "\t",
                                       $hsp->num_identical, "\t",
                                       $hsp->num_conserved,"\t",
                                       $hsp->start('query'),"\t",
                                       $hsp->end('query'),"\t",
                                       $hsp->start('hit'),"\t",
                                       $hsp->end('hit'),"\n";

                                       print FASTAFILE  "> ",
$hit->description,"\n",
                                       $hsp->hit_string,"\n";
                               }
                       }
               }
       }

       if ($myhit == 0) {
              $mynohit++;
       }

       $myhit = 0;
}

$mypercent = $mynohit*100 / $myresult;

print "\n\n", $myresult, " query sequence(s)\n";
print "\n", $myhsp, " HSP sequence(s) \n";
print "\n", $mylength, " hit(s) presenting the minimum requested length\n";
print "\n", $mysignificance, " hit(s) presenting the minimum requested
E-value\n";
print "\n", $mynohit, " query sequence(s) presenting < NO HITS > ";
close (PARSEDFILE);
close (FASTAFILE);
exit;


Output is:
Use of uninitialized value in numeric eq (==) at ../hmm-test-parse.pl
line 58, <GEN1> line 40126.


1 query sequence(s)

Use of uninitialized value in print at ../hmm-test-parse.pl line 68,
<GEN1> line 40126.
 HSP sequence(s)

Use of uninitialized value in print at ../hmm-test-parse.pl line 69,
<GEN1> line 40126.
 hit(s) presenting the minimum requested length

Use of uninitialized value in print at ../hmm-test-parse.pl line 70,
<GEN1> line 40126.
 hit(s) presenting the minimum requested E-value

1 query sequence(s) presenting < NO HITS > (100.00 %)


Thanks very much,
Sean.

From Sean.Maceachern at dpi.vic.gov.au  Thu Jun  2 03:51:15 2005
From: Sean.Maceachern at dpi.vic.gov.au (Sean.Maceachern@dpi.vic.gov.au)
Date: Thu Jun  2 03:44:04 2005
Subject: [Bioperl-l] bioperl-ext1.4 installation problem (Sean MacEachern)
Message-ID: <OFAE3885C7.E6AA2E45-ONCA257014.00254FF9-CA257014.002B2519@nre.vic.gov.au>

Hello,

I am trying to install bioperl on a machine running fedora core 3 and I
have run across a few problems installing bioperl-ext-1.4. I have installed
all of the appropriate Inline and io_lib files however whenever I try to
execute the perl Makefile.PL command I get the following error:

[root@fred bioperl-ext-1.4] # perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for Bio::Ext::Align
Found Staden io_lib "libread" in /usr/local/lib ...
Automatically using the Read.h found in /usr/local/include/io_lib ...
Writing Makefile for Bio::SeqIO::staden::read
Writing Makefile for Bio
One or more DATA sections were not processed by Inline.


I then attempted to make the staden::read file independently, however I
came across another error which I believe may have something to do with a
line out of place in one of the io_lib *.h files but was unable to
determine which file it was (Read.h os.h etc...). I have attached some of
the error mesage below, hopefully someone will be able to help me identify
the problem.


[root@fred read] # perl Makefile.PL
Writing Makefile for Bio::SeqIO::staden::read
[root@fred read] # make
gcc -c  -I/usr/local/genomics/bioperl-ext-1.4/Bio/SeqIO/staden
-I/usr/local/include/io_lib -D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS
-DDEBUGGING -fno-strict-aliasing -pipe -I/usr/local/include
-D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -I/usr/include/gdbm -O2 -g -pipe
-m32 -march=i386 -mtune=pentium4   -DVERSION=\"0.01\" -DXS_VERSION=\"0.01\"
-fPIC "-I/usr/lib/perl5/5.8.5/i386-linux-thread-multi/CORE"   read.c
In file included from /usr/local/include/io_lib/Read.h:43,
                 from read.xs:5:
/usr/local/include/io_lib/os.h:9:1: warning: "INT_MAX" redefined
In file included from /usr/include/sys/param.h:22,
                 from
/usr/lib/perl5/5.8.5/i386-linux-thread-multi/CORE/perl.h:446,
                 from read.xs:2:
/usr/lib/gcc/i386-redhat-linux/3.4.3/include/limits.h:74:1: warning: this
is the location of the previous definition
In file included from /usr/local/include/io_lib/Read.h:43,
                 from read.xs:5:
/usr/local/include/io_lib/os.h:10:1: warning: "SHRT_MAX" redefined
In file included from /usr/include/sys/param.h:22,
                 from
/usr/lib/perl5/5.8.5/i386-linux-thread-multi/CORE/perl.h:446,
                 from read.xs:2:
/usr/lib/gcc/i386-redhat-linux/3.4.3/include/limits.h:60:1: warning: this
is the location of the previous definition
In file included from /usr/local/include/io_lib/Read.h:43,
                 from read.xs:5:
/usr/local/include/io_lib/os.h:24:4: #error No 2-byte integer type found.
/usr/local/include/io_lib/os.h:34:4: #error No 4-byte integer type found.
In file included from /usr/local/include/io_lib/Read.h:43,
                 from read.xs:5:
/usr/local/include/io_lib/os.h:40: error: syntax error before "int_2"
/usr/local/include/io_lib/os.h:40: warning: data definition has no type or
storage class
/usr/local/include/io_lib/os.h:41: error: syntax error before "uint_2"
/usr/local/include/io_lib/os.h:41: warning: data definition has no type or
storage class
/usr/local/include/io_lib/os.h:42: error: syntax error before "int_4"
/usr/local/include/io_lib/os.h:42: warning: data definition has no type or
storage class
/usr/local/include/io_lib/os.h:43: error: syntax error before "uint_4"
/usr/local/include/io_lib/os.h:43: warning: data definition has no type or
storage class



Regards,


Sean




From Richard.Adams at ed.ac.uk  Thu Jun  2 05:20:12 2005
From: Richard.Adams at ed.ac.uk (Richard Adams)
Date: Thu Jun  2 05:15:29 2005
Subject: [Bioperl-l] please help me to check why this perl script does	notwork!
Message-ID: <429ECF4C.4080909@ed.ac.uk>

Hi Fei Li,
I've written a BioPerl module for submitting sequences to NetPhos at the 
same site,
Bio/Tools/Analysis/Protein/NetPhos.
You can use that as a template for your code - you just have to alter 
the form fields and the result parser.
See
http://bioperl.org/HOWTOs/SimpleWebAnalysis/index.html

Or if you would be willing to contribute your ChloroP specific code I 
could wrap it up into a new BioPerl module ,

Regards

Richard

-- 
Dr Richard Adams
Psychiatric Genetics Group,
Medical Genetics,
Molecular Medicine Centre,
Western General Hospital,
Crewe Rd West,
Edinburgh UK
EH4 2XU

Tel: 44 131 651 1084
richard.adams@ed.ac.uk


From michael.watson at bbsrc.ac.uk  Thu Jun  2 08:53:45 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Thu Jun  2 08:48:06 2005
Subject: [Bioperl-l] Removing SeqFeatures
Message-ID: <8975119BCD0AC5419D61A9CF1A923E950172D5AE@iahce2knas1.iah.bbsrc.reserved>

Hi

I want to take an EMBL sequence and remove some of the features, but
keep all of the other information (accession, id, sequence, comments
etc).

So I have got some code which gives me the features that I want and the
ones I don't want, but I can't figure out how to "remove" a feature.
The only way I can think of doing this is to create a new sequence and
transfer the data across from the old sequence bit by bit - surely
there's a better way?

Many thanks

Mick

From Marc.Logghe at devgen.com  Thu Jun  2 09:23:34 2005
From: Marc.Logghe at devgen.com (Marc Logghe)
Date: Thu Jun  2 09:18:14 2005
Subject: [Bioperl-l] Removing SeqFeatures
Message-ID: <0C528E3670D8CE4B8E013F6749231AA606E7F8@ANTARESIA.be.devgen.com>

Hi Mick,
I think the only way is to run the remove_SeqFeatures() and catch the
removed features in an array.
Filter the array keeping the features you want to keep and add them to
your sequence object using 
add_SeqFeature(@features_to_keep)

HTH,
Marc

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org 
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of 
> michael watson (IAH-C)
> Sent: Thursday, June 02, 2005 2:54 PM
> To: Bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] Removing SeqFeatures
> 
> Hi
> 
> I want to take an EMBL sequence and remove some of the 
> features, but keep all of the other information (accession, 
> id, sequence, comments etc).
> 
> So I have got some code which gives me the features that I 
> want and the ones I don't want, but I can't figure out how to 
> "remove" a feature.
> The only way I can think of doing this is to create a new 
> sequence and transfer the data across from the old sequence 
> bit by bit - surely there's a better way?
> 
> Many thanks
> 
> Mick
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

From MEC at Stowers-Institute.org  Thu Jun  2 10:45:19 2005
From: MEC at Stowers-Institute.org (Cook, Malcolm)
Date: Thu Jun  2 10:38:02 2005
Subject: [Bioperl-l] Removing SeqFeatures
Message-ID: <200506021437.j52EbJfY024658@portal.open-bio.org>

FWIW: In day's past I had the following exchange with
Ewan/Hilmar/Matthew on exactly this topic in which I proposed a patch to
Bio::Seq to define 'delete_SeqFeature' and was subsequenty converted
against the approach:

http://bioperl.org/pipermail/bioperl-l/2001-May/005624.html

Cheers,

malcolm


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Marc Logghe
Sent: Thursday, June 02, 2005 8:24 AM
To: michael watson (IAH-C); Bioperl-l@portal.open-bio.org
Subject: RE: [Bioperl-l] Removing SeqFeatures


Hi Mick,
I think the only way is to run the remove_SeqFeatures() and catch the
removed features in an array.
Filter the array keeping the features you want to keep and add them to
your sequence object using 
add_SeqFeature(@features_to_keep)

HTH,
Marc

> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org 
> [mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of 
> michael watson (IAH-C)
> Sent: Thursday, June 02, 2005 2:54 PM
> To: Bioperl-l@portal.open-bio.org
> Subject: [Bioperl-l] Removing SeqFeatures
> 
> Hi
> 
> I want to take an EMBL sequence and remove some of the 
> features, but keep all of the other information (accession, 
> id, sequence, comments etc).
> 
> So I have got some code which gives me the features that I 
> want and the ones I don't want, but I can't figure out how to 
> "remove" a feature.
> The only way I can think of doing this is to create a new 
> sequence and transfer the data across from the old sequence 
> bit by bit - surely there's a better way?
> 
> Many thanks
> 
> Mick
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l

From Annie.Law at nrc-cnrc.gc.ca  Thu Jun  2 11:59:22 2005
From: Annie.Law at nrc-cnrc.gc.ca (Law, Annie)
Date: Thu Jun  2 11:51:24 2005
Subject: [Bioperl-l] Entrez Gene parser questions
Message-ID: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>

Hi,

I would appreciate help with the following.  First of all, I would like to say it's great that a Entrez gene parser was written. I just have some questions to get me started.  

A) I already have bioperl 1.4 installed.  I would like to know if I can install the Entrez gene parser and 
Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.

I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
               (which util.pm shold I use??  I searched CPAN and got many results for util.pm
               is it Biblio::Util, Boulder::Util, or something else??)

B) For each Entrez gene id how do I access the associated Unigene id, accession numbers, gene symbol, gene name,
And GO IDs.  

Also, I have been looking at the code and the POD within it.  Are there some other places that I can look for documentation?

Thanks so much!!
Annie.


From mingyi.liu at gpc-biotech.com  Thu Jun  2 12:59:28 2005
From: mingyi.liu at gpc-biotech.com (Mingyi Liu)
Date: Thu Jun  2 12:53:30 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <429F3AF0.4000207@gpc-biotech.com>

Hi, Annie,

Stefan's more familiar with the requirements of entrezgene.pm.  Based on 
my experience installing entrezgene.pm for bioperl 1.5 (I don't have 
1.4) there's no need for a util.pm.  I suspect the reason why you 
mentioned a util.pm was that previously my Bio::ASN1::EntrezGene needed 
a util.pm, but that was eliminated since V1.02 or so and before 
Bio::ASN1 space was created on CPAN.  Maybe Stefan had not updated the 
documentation to reflect this change?

You do need to install Bio::ASN1::EntrezGene first, then copy both the 
entrezgene.pm and the latest Bio::Annotation::DBLink from bioperl CVS 
since entrezgene.pm uses the url() in DBLink, which is not present in 
even bioperl 1.5.  For me, I also had to do a force install 
Grapha::Directed, but that might not be a problem for you if your system 
already has it (my bioperl installation was old and incomplete before).

Best,

Mingyi

Law, Annie wrote:

>Hi,
>
>I would appreciate help with the following.  First of all, I would like to say it's great that a Entrez gene parser was written. I just have some questions to get me started.  
>
>A) I already have bioperl 1.4 installed.  I would like to know if I can install the Entrez gene parser and 
>Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.
>
>I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
>		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
>               (which util.pm shold I use??  I searched CPAN and got many results for util.pm
>               is it Biblio::Util, Boulder::Util, or something else??)
>
>B) For each Entrez gene id how do I access the associated Unigene id, accession numbers, gene symbol, gene name,
>And GO IDs.  
>
>Also, I have been looking at the code and the POD within it.  Are there some other places that I can look for documentation?
>
>Thanks so much!!
>Annie.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>


From skirov at utk.edu  Thu Jun  2 13:39:21 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun  2 13:31:28 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <429F4449.8000801@utk.edu>

Annie,
I am sorry to say there is no good documentation yet, since I am still 
evaluating and debugging the code and I have buch of other stuff to deal 
with ir tight now, so appolozie but there will not be a comprehensive 
docs for at least another 2 weeks.
First install:
I think you need to install Bio::SeqIO::entrezgene.pm and 
Bio::ASN1::EnztrezGene. You will have to update Bio::Annotation::DBLink. 
Make sure you also have Bio::Cluster::SequenceFamily and all modules in 
Bio::SeqFeature::Gene. These also may need updating.
When you do
  my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
                               -file => $file,
                               -debug => 'on');
   my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
$gene->accession_number will give you the Entrezgene id
and $gene->id will give you the gene symbol. If you go through the 
annotations:
my $ann=$gene->annotation; (where most of the data is)

my @dblinks= $ann->get_Annotations('DBLink')
foreach my $dblink (@dblinks) {
	print 'Unigene id for this gene is '.$dblink->id if (lc($dblink->database) eq 'unigene');
}

my @nameann=$ann->get_Annotations('Official Full Name')
print 'Gene name is ',$nameann[0]->as_text,"\n";

my @go=$ann->get_Annotations('OntologyTerm');
foreach my $go (@go) {
next if ($go->authority eq 'STS marker'); #Unless you want STS markers...
my @refs=$go->term->references;#you should get just one
print join(',',$gid,$go->ontology->name,$go->identifier,$go->name,'GO:'.$go->identifier,$refs[0]->medline);
}
my @associated_seq=$struct->get_members();

foreach my $seq (@associated_seq) {
    if ($contig->namespace eq 'refseq') {#Only refseq, there is also mrna, product and genomic as options...
        my @prod=$contig->annotation->get_Annotations('product');
        my @transvar=$contig->annotation->get_Annotations('simple');
        my $transvar='';
        foreach my $sv (@transvar) {
            $transvar=$sv->value if ($sv->tagname eq 'Transcriptional Variant');
        }
        my $assembly;
        foreach my $ann ($contig->annotation->get_Annotations('dblink')) {
            $assembly.=$ann->primary_id . '-' if ($ann->optional_id eq 'Source Sequence');
        }
        chop $assembly;
	my $prod;
	foreach my $p (@prod) {
		if ($p) {
			$prod=$p->value;
			last;
		}
	}
}

Hope this helps and will get you started at least. Let me know if you 
have more question.
Stefan

Law, Annie wrote:

>Hi,
>
>I would appreciate help with the following.  First of all, I would like to say it's great that a Entrez gene parser was written. I just have some questions to get me started.  
>
>A) I already have bioperl 1.4 installed.  I would like to know if I can install the Entrez gene parser and 
>Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.
>
>I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
>		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
>               (which util.pm shold I use??  I searched CPAN and got many results for util.pm
>               is it Biblio::Util, Boulder::Util, or something else??)
>
>B) For each Entrez gene id how do I access the associated Unigene id, accession numbers, gene symbol, gene name,
>And GO IDs.  
>
>Also, I have been looking at the code and the POD within it.  Are there some other places that I can look for documentation?
>
>Thanks so much!!
>Annie.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>

From skirov at utk.edu  Thu Jun  2 13:44:47 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun  2 13:36:47 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF48@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <429F458F.1020201@utk.edu>

Ani,
Also pleas let me know if you find anything weird. I think GIs might 
have a tab at the end. Also note that (at least as of April 25th) 
EntrezGene ASN file does not have Gene ontology for Drosophila. So far I 
have not heard from NCBI help desk on that.
Stefan

Law, Annie wrote:

>Hi,
>
>I would appreciate help with the following.  First of all, I would like to say it's great that a Entrez gene parser was written. I just have some questions to get me started.  
>
>A) I already have bioperl 1.4 installed.  I would like to know if I can install the Entrez gene parser and 
>Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.
>
>I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
>		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
>               (which util.pm shold I use??  I searched CPAN and got many results for util.pm
>               is it Biblio::Util, Boulder::Util, or something else??)
>
>B) For each Entrez gene id how do I access the associated Unigene id, accession numbers, gene symbol, gene name,
>And GO IDs.  
>
>Also, I have been looking at the code and the POD within it.  Are there some other places that I can look for documentation?
>
>Thanks so much!!
>Annie.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>

From golharam at umdnj.edu  Thu Jun  2 15:39:06 2005
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu Jun  2 15:31:22 2005
Subject: [Bioperl-l] AlignIO and bl2seq
Message-ID: <000501c567aa$bd414600$e6028a0a@GOLHARMOBILE1>

Hi all,

I'm trying to parse some alignments performed using bl2seq.  My code is
as follows:

my $output = `bl2seq -p blastn -i seq1 -j seq2`;
my $in = Bio::AlignIO->new(-fh => new IO::String($output), -format =>
'bl2seq');
my $aln = $in->next_aln();

if (defined($aln)) {
  print "Score: ", $aln->score, "\n";
} else {
  print "n/a";
}

When it comes to printing the score, nothing gets printed out, which
makes sense because blast gives a list of HSPs or none if there aren't
any.  So, how do I get the first HSP from the output using AlignIO?  

I know I should be using SearchIO to get the HSPs, but I thought I would
try it with AlignIO as its documented, but I can't get it working.  Any
ideas???

Ryan

From micheleen at mail.utexas.edu  Fri Jun  3 02:03:19 2005
From: micheleen at mail.utexas.edu (Micheleen Harris)
Date: Fri Jun  3 02:01:22 2005
Subject: [Bioperl-l] getting t_coffee to run with bioperl in linux first time
Message-ID: <6.2.1.2.2.20050603004311.01e902f0@mail.utexas.edu>

I just installed t_coffee into my home directory on a linux machine and it 
is working fine.  Bioperl is also functioning as I tried querying genbank 
for sequence data successfully.

I then followed the following instructions to make a wrapper for t_coffee:

1. Make sure the t_coffee executable is in your path so that
     which t_coffee
     returns a t_cofee executable on your system.

  2. Define an environmental variable TCOFFEEDIR which is a dir
     which contains the 't_coffee' app:
     In bash
     export 
TCOFFEEDIR=/home/username/progs/T-COFFEE_distribution_Version_1.37/bin
     In csh/tcsh
     setenv TCOFFEEDIR 
/home/username/progs/T-COFFEE_distribution_Version_1.37/bin

  3. Include a definition of an environmental variable TCOFFEEDIR in
     every script that will use this TCoffee wrapper module.
     BEGIN { $ENV{TCOFFEDIR} = 
'/home/username/progs/T-COFFEE_distribution_Version_1.37/bin' }
     use Bio::Tools::Run::Alignment::TCoffee;

I placed the path to t_coffee and defined TCOFFEEDIR in my .bash_profile 
file as follows:

# .bash_profile

# Get the aliases and functions
if [ -f ~/.bashrc ]; then
         . ~/.bashrc
fi

# User specific environment and startup programs

PATH=$PATH:$HOME/bin
PATH=$PATH:/home/micheleen/progs/T-COFFEE_distribution_Version_1.37/bin/

export PATH
export TCOFFEEDIR = 
/home/micheleen/progs/T-COFFEE_distribution_Version_1.37/bin
unset USERNAME

I ran the following script:

#!/bin/perl -w

BEGIN { $ENV{TCOFFEDIR} = 
'/home/micheleen/progs/T-COFFEE_distribution_Version_1
.37/bin' };
use Bio::Tools::Run::Alignment::TCoffee;
use Bio::Seq;
use Bio::DB::GenBank;

$coffeefound = Bio::Tools::Run::Alignment::TCoffee->exists_tcoffee();


And get the error:

Can't locate Bio/Tools/Run/Alignment/TCoffee.pm in @INC (@INC contains: 
/etc/perl /usr/lib/perl5/site_perl/5.8.5/i686-linux 
/usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.2 
/usr/lib/perl5/site_perl/5.8.2/i686-linux /usr/lib/perl5/site_perl/5.8.4 
/usr/lib/perl5/site_perl /usr/lib/perl5/vendor_perl/5.8.5/i686-linux 
/usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4 
/usr/lib/perl5/vendor_perl /usr/lib/perl5/5.8.5/i686-linux 
/usr/lib/perl5/5.8.5 /usr/local/lib/site_perl 
/usr/lib/perl5/site_perl/5.8.2 /usr/lib/perl5/site_perl/5.8.2/i686-linux 
/usr/lib/perl5/site_perl/5.8.4 .) at my_scripts/find_pol.pl line 4.
BEGIN failed--compilation aborted at my_scripts/find_pol.pl line 4.

Please advise!  I'm certain I have the paths correct.  Is this a simple 
fix, did I miss something obvious?

Thanks,
Micheleen


From taerwin at tpg.com.au  Fri Jun  3 03:39:58 2005
From: taerwin at tpg.com.au (Tim Erwin)
Date: Fri Jun  3 03:35:11 2005
Subject: [Bioperl-l] getting t_coffee to run with bioperl in linux
	first time
In-Reply-To: <6.2.1.2.2.20050603004311.01e902f0@mail.utexas.edu>
References: <6.2.1.2.2.20050603004311.01e902f0@mail.utexas.edu>
Message-ID: <1117784398.9865.13.camel@bacp4>

Hi Micheleen,

This error is to do with the BioPerl package and not the program
t_coffee. You will need to set the environment variable PERL5LIB to use
your bioperl libraries (I am also assuming you have installed the
bioperl-run package)

i.e export PERL5LIB=/somedir/bioperl-run-1.4/

To test that you have set the PERL5LIB variable correctly you should be
able to type perldoc Bio::Tools::Run::Alignment::TCoffee, and if you get
the documentation you should be good to go.

You can also set the location of the modules inside you script with:

BEGIN {
   unshift @INC,"/somedir/bioperl-run-1.4";
};

or use lib "somedir";

Regards,

Tim

> I ran the following script:
> 
> #!/bin/perl -w
> 
> BEGIN { $ENV{TCOFFEDIR} = 
> '/home/micheleen/progs/T-COFFEE_distribution_Version_1
> .37/bin' };
> use Bio::Tools::Run::Alignment::TCoffee;
> use Bio::Seq;
> use Bio::DB::GenBank;
> 
> $coffeefound = Bio::Tools::Run::Alignment::TCoffee->exists_tcoffee();
> 
> 
> And get the error:
> 
> Can't locate Bio/Tools/Run/Alignment/TCoffee.pm in @INC (@INC
contains: 
> /etc/perl /usr/lib/perl5/site_perl/5.8.5/i686-linux 
> /usr/lib/perl5/site_perl/5.8.5 /usr/lib/perl5/site_perl/5.8.2 
> /usr/lib/perl5/site_perl/5.8.2/i686-
linux /usr/lib/perl5/site_perl/5.8.4 
> /usr/lib/perl5/site_perl /usr/lib/perl5/vendor_perl/5.8.5/i686-linux 
> /usr/lib/perl5/vendor_perl/5.8.5 /usr/lib/perl5/vendor_perl/5.8.4 
> /usr/lib/perl5/vendor_perl /usr/lib/perl5/5.8.5/i686-linux 
> /usr/lib/perl5/5.8.5 /usr/local/lib/site_perl 
> /usr/lib/perl5/site_perl/5.8.2 /usr/lib/perl5/site_perl/5.8.2/i686-
linux 
> /usr/lib/perl5/site_perl/5.8.4 .) at my_scripts/find_pol.pl line 4.
> BEGIN failed--compilation aborted at my_scripts/find_pol.pl line 4.
> 



> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

From michael.watson at bbsrc.ac.uk  Fri Jun  3 08:53:10 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Fri Jun  3 08:45:33 2005
Subject: [Bioperl-l] Bio::Graphics quickie!
Message-ID: <8975119BCD0AC5419D61A9CF1A923E950172D5D9@iahce2knas1.iah.bbsrc.reserved>

Hi

How do I change the font size of a feature label in tracks of a
Bio::Graphics::Panel object?  

Thanks

Mick

From nit_822001 at yahoo.com  Fri Jun  3 07:50:09 2005
From: nit_822001 at yahoo.com (NITIN kumar)
Date: Fri Jun  3 09:56:07 2005
Subject: [Bioperl-l] How to Install
Message-ID: <20050603115009.51952.qmail@web52607.mail.yahoo.com>

Hai,
    I am a student of bioinformatics and i have pc
with linux enterprise edition os having perl 5.8.Plese
help me 
in installation of bioperl in my pc. 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From brian_osborne at cognia.com  Fri Jun  3 10:28:01 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Jun  3 10:23:29 2005
Subject: [Bioperl-l] How to Install
In-Reply-To: <20050603115009.51952.qmail@web52607.mail.yahoo.com>
Message-ID: <BEC5E131.1552%brian_osborne@cognia.com>

Nitin,

Have you been using the INSTALL instructions?

http://bioperl.org/Core/Latest/INSTALL


Brian O.


On 6/3/05 7:50 AM, "NITIN kumar" <nit_822001@yahoo.com> wrote:

> Hai,
>     I am a student of bioinformatics and i have pc
> with linux enterprise edition os having perl 5.8.Plese
> help me 
> in installation of bioperl in my pc.
> 
> 
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From jason.stajich at duke.edu  Fri Jun  3 10:31:57 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Fri Jun  3 10:25:27 2005
Subject: [Bioperl-l] Reroot Tree ?
In-Reply-To: <cbd7473abe7b0875dbbc47b6f2ea2615@gmail.com>
References: <cbd7473abe7b0875dbbc47b6f2ea2615@gmail.com>
Message-ID: <B69C7A80-4997-41BC-8C6E-41203F8B3331@duke.edu>

Of course it looks at leaves - those can be the only labeled nodes in  
the tree sometimes.

So your problem is getting a node by name not in the re-root itself?

See the test in t/Tree.t as to how it is often used but basically

my ($node) = $tree->find_node(-id => 'node1');

You can also do it this way:
my @nodes = grep { $_->id eq 'node1' } $tree->get_nodes;


I did update the re-root code since bioperl 1.4 so you may also want  
to grab all the latest modules in Bio/Tree and Bio/TreeIO directory  
out of CVS.


--jason


On May 30, 2005, at 7:36 AM, Ferdinand Marl?taz wrote:

> Hi,
>
> Well, I'm trying to reroot a population of Tree and I don't manage  
> to do it !  In fact, the function reroot asks $node and I'd like to  
> reroot with a specific taxa of my tree, so I ignore the node name  
> on which I must reroot ? I've tried find_node but it doesn't seem  
> to work (I don't thing it looks leaves).
>  So, what should I do ?
>
>
> Thanks
>
> Ferdi
>
> _____________________________
> Ferdinand Marl?taz
> Evolution et phylog?nie des m?tazoaires
> UMR 6540 DIMAR
> Rue Batterie des Lions
> 13007 MARSEILLE
> Tel. 33 (0)4 91 04 16 54
> Port. 33 (0)6 30 35 58 49
> Mail. Ferdinand.Marletaz@ens- 
> lyon.fr_______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/



From akarger at CGR.Harvard.edu  Fri Jun  3 12:43:22 2005
From: akarger at CGR.Harvard.edu (Amir Karger)
Date: Fri Jun  3 12:51:15 2005
Subject: [Bioperl-l] New GO file format
Message-ID: <339D68B133EAD311971E009027DC47970301D00E@montecarlo.cgr.harvard.edu>

Hi.

Do the bioperl GO tools handle the new OBO file format? All I want to do is
find every GO term's parent. (I found go-perl, which I believe can do it:
I'm just wondering if I can do it within Bioperl.)

Thanks,

-Amir Karger
From lstein at cshl.edu  Fri Jun  3 13:21:51 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Fri Jun  3 13:15:37 2005
Subject: [Bioperl-l] Bio::Graphics quickie!
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E950172D5D9@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E950172D5D9@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <200506031321.52193.lstein@cshl.edu>

You can control the font size of each track by supplying -font to the track 
definition.  Values are gdSmallFont, gdMediumFont, gdMediumBoldFont and 
gdLargeFont.  You can also pass a GD::Font object created from your favorite 
font file, as described in the GD documentation.

Sadly, TrueType fonts are not supported at this time.

Lincoln

On Friday 03 June 2005 08:53 am, michael watson (IAH-C) wrote:
> Hi
>
> How do I change the font size of a feature label in tracks of a
> Bio::Graphics::Panel object?
>
> Thanks
>
> Mick
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From zhoujie at fudan.edu.cn  Sat Jun  4 20:48:53 2005
From: zhoujie at fudan.edu.cn (Jie Zhou)
Date: Sat Jun  4 08:44:00 2005
Subject: [Bioperl-l] A problem when converting Genbank->GFF->png using script
Message-ID: <1117932533.13493.13.camel@debian.ibsfu>

Hi all,

I wanted to convert a genbank file into a png file, trying to show the
features presented in the genbank file in a graph. I used the following
two scripts in bioperl: "feature_draw.PLS", "genbank2gff3.PLS". And I
got some error message as follows:

-----------------------------------------------------------------
jzhou@debian:~/results/GFF$ perl genbank2gff3.PLS test
Processing file test...
Use of uninitialized value in concatenation (.) or string at
genbank2gff3.PLS line 172.
working on contig NM_005476... GFF3 saved to ./.gff
jzhou@debian:~/results/GFF$ mv .gff test.gff
jzhou@debian:~/results/GFF$ perl feature_draw.PLS test.gff >test.png
Can't use string ("Bio::DB::GFF") as a HASH ref while "strict refs" in
use at /usr/local/share/perl/5.8.4/Bio/DB/GFF.pm line 2198, <> line 4.
-----------------------------------------------------------------

I checked the gff file, it looks like this:
-----------------------------------------------------------------
##gff-version 3
##sequence-region NM_005476 1 3760
##source bp_genbank2gff3.pl
NM_005476       GenBank region  1       3760    .       .       .
ID=NM_005476
NM_005476       GenBank databank_entry  1       3760    .
+       .
ID=GenBank:databank_entry:NM_005476:1:3760;mol_type=mRNA;db_xref=taxon:9606;map=9p13.2;chromosome=9;organism=Homo+sapiens
NM_005476       GenBank gene    1       3760    .       +       .
ID=gene:GNE;db_xref=GeneID:10020,HPRD:HPRD_04825,MIM:603824;gene=GNE;note=synonyms:+NM%2C+DMRV%2C+IBM2%2C+Uae1%2C+GLCNE
NM_005476       GenBank mRNA    127     2295    .       +       .
ID=mRNA:GNE.t01;Parent=gene:GNE;gene=GNE
NM_005476       GenBank CDS     127     2295    .       +       .
Parent=mRNA:GNE.t01;protein_id=NP_005467.1;gene=GNE;note=N-acylmannosamine
.
.(omitted)
.
NM_005476       GenBank exon    127     2295    .       +       .
Parent=mRNA:GNE.t01;gene=GNE
NM_005476       GenBank polyA_signal    3722    3727    .
+       .       Parent=gene:GNE;gene=GNE
NM_005476       GenBank polyA_site      3745    3745    .
+       .       Parent=gene:GNE;gene=GNE
>NM_005476
GCTCTGCCTGCTTCGTGGCGCTTGGTTCGTCCCTCGCCCGAGGAGCGCGGTGGCGGCGTG
...(ommited)
------------------------------------------------------------------

I also checked the genbank file I input, it's a correct one. I wonder,
is the procedure right? Why does the error happen? 

Thanks very much for any help.

Regards,
Jie

From amackey at pcbi.upenn.edu  Sat Jun  4 14:03:14 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Sat Jun  4 13:55:31 2005
Subject: [Bioperl-l] bioperl-ext1.4 installation problem (Sean MacEachern)
In-Reply-To: <OFAE3885C7.E6AA2E45-ONCA257014.00254FF9-CA257014.002B2519@nre.vic.gov.au>
References: <OFAE3885C7.E6AA2E45-ONCA257014.00254FF9-CA257014.002B2519@nre.vic.gov.au>
Message-ID: <6BC45CE1-CB14-4414-9CBE-52C3D09BD190@pcbi.upenn.edu>

You need to copy the config.h and os.h files into the io_lib include  
installation directory.

-Aaron

On Jun 2, 2005, at 3:51 AM, Sean.Maceachern@dpi.vic.gov.au wrote:

> however I
> came across another error which I believe may have something to do  
> with a
> line out of place in one of the io_lib *.h files but was unable to
> determine which file it was (Read.h os.h etc...).

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205
fax:    215-746-6697
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017

From hlapp at gmx.net  Sun Jun  5 20:29:53 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sun Jun  5 20:22:02 2005
Subject: [Bioperl-l] New GO file format
In-Reply-To: <339D68B133EAD311971E009027DC47970301D00E@montecarlo.cgr.harvard.edu>
References: <339D68B133EAD311971E009027DC47970301D00E@montecarlo.cgr.harvard.edu>
Message-ID: <42eeee65cc9731cf2b7be11713eef7a0@gmx.net>

I've been writing an adaptor layer in bioperl that will transparently 
adapt go-perl into the bioperl object model. I'm 90% there, what's left 
is mostly adding tests (and then probably debugging why it doesn't work 
;).

	-hilmar
	
On Jun 3, 2005, at 9:43 AM, Amir Karger wrote:

> Hi.
>
> Do the bioperl GO tools handle the new OBO file format? All I want to 
> do is
> find every GO term's parent. (I found go-perl, which I believe can do 
> it:
> I'm just wondering if I can do it within Bioperl.)
>
> Thanks,
>
> -Amir Karger
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From xuying at sibs.ac.cn  Mon Jun  6 03:45:31 2005
From: xuying at sibs.ac.cn (xuying)
Date: Mon Jun  6 03:39:22 2005
Subject: [Bioperl-l] staden package building problem
Message-ID: <20050606074648.EE71610DFD5@smtp.sibsnet.org>

Hi all:
	When I was compiling the staden package, it aborted with the follow messages.
............
Makefile:73: warning: overriding commands for target `clean'
mk/global.mk:256: warning: ignoring old commands for target `clean'
Makefile:88: warning: overriding commands for target `depend'
mk/global.mk:515: warning: ignoring old commands for target `depend'
Makefile:128: warning: overriding commands for target `distsrc'
mk/global.mk:494: warning: ignoring old commands for target `distsrc'
cd Misc && make   all
make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/Misc'
make[1]: Nothing to be done for `all'.
make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/Misc'
cd io_lib && make   all
make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/io_lib'
Makefile:129: dependencies: No such file or directory
Makefile:161: warning: overriding commands for target `distsrc'
../mk/global.mk:494: warning: ignoring old commands for target `distsrc'
cc -L../lib/linux-binaries  -shared -o ../lib/linux-binaries/libread.so  read/linux-binaries/Read.o read/linux-binaries/translate.o read/linux-binaries/scf_extras.o utils/linux-binaries/find.o utils/linux-binaries/mach-io.o utils/linux-binaries/traceType.o utils/linux-binaries/read_alloc.o utils/linux-binaries/compress.o utils/linux-binaries/open_trace_file.o scf/linux-binaries/read_scf.o scf/linux-binaries/write_scf.o scf/linux-binaries/misc_scf.o exp_file/linux-binaries/expFileIO.o plain/linux-binaries/seqIOPlain.o abi/linux-binaries/fpoint.o abi/linux-binaries/seqIOABI.o alf/linux-binaries/seqIOALF.o ctf/linux-binaries/ctfCompress.o ctf/linux-binaries/seqIOCTF.o ztr/linux-binaries/compression.o ztr/linux-binaries/ztr_translate.o ztr/linux-binaries/ztr.o  -lz   -lmisc 
cd progs && make
make[2]: Entering directory `/home/xuying/staden-src-1-5-3/src/io_lib/progs'
Makefile:84: dependencies: No such file or directory
make[2]: Nothing to be done for `all'.
make[2]: Leaving directory `/home/xuying/staden-src-1-5-3/src/io_lib/progs'
make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/io_lib'
cd tk_utils && make   all
make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/tk_utils'
Makefile:123: warning: overriding commands for target `distsrc'
../mk/global.mk:494: warning: ignoring old commands for target `distsrc'
ln -s ../licence/boxes.h .
ln: `./boxes.h': File exists
make[1]: *** [.links] Error 1
make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/tk_utils'
make: *** [tk_utils] Error 2


What's the problem? I just installed the exact external package required manually. Please help!!!
	

Best Regards!
 				

　　　　　　　　xuying
　　　　　　　　xuying@sibs.ac.cn
　　　　　　　　　　2005-06-06

From amackey at pcbi.upenn.edu  Mon Jun  6 10:38:26 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Mon Jun  6 10:35:12 2005
Subject: [Bioperl-l] staden package building problem
In-Reply-To: <20050606074648.EE71610DFD5@smtp.sibsnet.org>
References: <20050606074648.EE71610DFD5@smtp.sibsnet.org>
Message-ID: <C305FDB0-D2D2-41AD-9174-19548484909A@pcbi.upenn.edu>

Unfortunately, I think you need to ask the staden package developers,  
as the source of your errors doesn't have anything to do with BioPerl.

But, it looks like a symlink is trying to be made over an existing  
file; I'd suggest investigating this, and possibly starting over with  
a clean slate.

-Aaron

On Jun 6, 2005, at 3:45 AM, xuying wrote:

> Hi all:
>     When I was compiling the staden package, it aborted with the  
> follow messages.
> ............
> Makefile:73: warning: overriding commands for target `clean'
> mk/global.mk:256: warning: ignoring old commands for target `clean'
> Makefile:88: warning: overriding commands for target `depend'
> mk/global.mk:515: warning: ignoring old commands for target `depend'
> Makefile:128: warning: overriding commands for target `distsrc'
> mk/global.mk:494: warning: ignoring old commands for target `distsrc'
> cd Misc && make   all
> make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/Misc'
> make[1]: Nothing to be done for `all'.
> make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/Misc'
> cd io_lib && make   all
> make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/io_lib'
> Makefile:129: dependencies: No such file or directory
> Makefile:161: warning: overriding commands for target `distsrc'
> ../mk/global.mk:494: warning: ignoring old commands for target  
> `distsrc'
> cc -L../lib/linux-binaries  -shared -o ../lib/linux-binaries/ 
> libread.so  read/linux-binaries/Read.o read/linux-binaries/ 
> translate.o read/linux-binaries/scf_extras.o utils/linux-binaries/ 
> find.o utils/linux-binaries/mach-io.o utils/linux-binaries/ 
> traceType.o utils/linux-binaries/read_alloc.o utils/linux-binaries/ 
> compress.o utils/linux-binaries/open_trace_file.o scf/linux- 
> binaries/read_scf.o scf/linux-binaries/write_scf.o scf/linux- 
> binaries/misc_scf.o exp_file/linux-binaries/expFileIO.o plain/linux- 
> binaries/seqIOPlain.o abi/linux-binaries/fpoint.o abi/linux- 
> binaries/seqIOABI.o alf/linux-binaries/seqIOALF.o ctf/linux- 
> binaries/ctfCompress.o ctf/linux-binaries/seqIOCTF.o ztr/linux- 
> binaries/compression.o ztr/linux-binaries/ztr_translate.o ztr/linux- 
> binaries/ztr.o  -lz   -lmisc
> cd progs && make
> make[2]: Entering directory `/home/xuying/staden-src-1-5-3/src/ 
> io_lib/progs'
> Makefile:84: dependencies: No such file or directory
> make[2]: Nothing to be done for `all'.
> make[2]: Leaving directory `/home/xuying/staden-src-1-5-3/src/ 
> io_lib/progs'
> make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/io_lib'
> cd tk_utils && make   all
> make[1]: Entering directory `/home/xuying/staden-src-1-5-3/src/ 
> tk_utils'
> Makefile:123: warning: overriding commands for target `distsrc'
> ../mk/global.mk:494: warning: ignoring old commands for target  
> `distsrc'
> ln -s ../licence/boxes.h .
> ln: `./boxes.h': File exists
> make[1]: *** [.links] Error 1
> make[1]: Leaving directory `/home/xuying/staden-src-1-5-3/src/ 
> tk_utils'
> make: *** [tk_utils] Error 2
>
>
> What's the problem? I just installed the exact external package  
> required manually. Please help!!!
>
>
> Best Regards!
>
>
> ????????xuying
> ????????xuying@sibs.ac.cn
> ??????????2005-06-06
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205
fax:    215-746-6697
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017


From Jonathan_Epstein at nih.gov  Mon Jun  6 10:35:41 2005
From: Jonathan_Epstein at nih.gov (Jonathan Epstein)
Date: Mon Jun  6 10:39:31 2005
Subject: [Bioperl-l] 1-year fellowship opportunity at NIH for youngish
	BioPerl-er
Message-ID: <6.2.1.2.2.20050606102705.02d05970@nihexchange4.nih.gov>

Hi,

We have an opportunity for a good Perl programmer with some BioPerl experience for a one-year appointment.

This is suitable, e.g. for someone just out of college or who as just obtained a master's degree.  See:
  http://www.training.nih.gov/student/Pre-IRTA/irtamanualpostbac.asp

It doesn't pay particularly well and there is a requirement of US citizenship or US permanent residency ("green card"), but is a great opportunity IMO.  It's located in suburban Washington DC (Maryland suburbs).

Contact me directly if you're interested.

[ apologies if this post was inappropriate; I didn't see anything that prohibited it, but clarification would be helpful ]

Jonathan



Jonathan Epstein                                Jonathan_Epstein@nih.gov
Head, Unit on Biologic Computation              (301)402-4563
Office of the Scientific Director               Bldg 31, Room 2A47
Nat. Inst. of Child Health & Human Development  31 Center Drive
National Institutes of Health                   Bethesda, MD 20892  
From jason.stajich at duke.edu  Mon Jun  6 15:58:22 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon Jun  6 15:50:36 2005
Subject: [Bioperl-l] AlignIO and bl2seq
In-Reply-To: <000501c567aa$bd414600$e6028a0a@GOLHARMOBILE1>
References: <000501c567aa$bd414600$e6028a0a@GOLHARMOBILE1>
Message-ID: <989FD4FC-753D-45F3-8895-6ADE7C76309F@duke.edu>

> I know I should be using SearchIO to get the HSPs

Not to be trite, so why don't you? The AlignIO bl2seq parsing is just  
a hack to delegate to the SearchIO objects for the parsing.  I only  
updated it to use SearchIO when we stopped supporting BPbl2seq  
parsing.  Look at the code and you'll see what it is  doing I hope.   
I would be more in favor of removing AlignIO::bl2seq anyways but I am  
a big believer in keeping the API as stable as possible - at least  
not removing functionality without good reason.


To answer you question - probably because when the aln object is made  
from the HSP object we don't initialize the score field.  The  
question would be which score would you want - bit score or some  
people might expect e-value (even if it isn't a score).  The Search  
objects are just going to be richer wrt the pairwise aln data so I  
would start with SearchIO - you can always get Bio::SimpleAlign  
objects back out with the $hsp->get_aln method.

HTH,
-jason
On Jun 2, 2005, at 3:39 PM, Ryan Golhar wrote:

> Hi all,
>
> I'm trying to parse some alignments performed using bl2seq.  My  
> code is
> as follows:
>
> my $output = `bl2seq -p blastn -i seq1 -j seq2`;
> my $in = Bio::AlignIO->new(-fh => new IO::String($output), -format =>
> 'bl2seq');
> my $aln = $in->next_aln();
>
> if (defined($aln)) {
>   print "Score: ", $aln->score, "\n";
> } else {
>   print "n/a";
> }
>
> When it comes to printing the score, nothing gets printed out, which
> makes sense because blast gives a list of HSPs or none if there aren't
> any.  So, how do I get the first HSP from the output using AlignIO?
>
> I know I should be using SearchIO to get the HSPs, but I thought I  
> would
> try it with AlignIO as its documented, but I can't get it working.   
> Any
> ideas???
>
> Ryan
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


From golharam at umdnj.edu  Mon Jun  6 16:15:42 2005
From: golharam at umdnj.edu (Ryan Golhar)
Date: Mon Jun  6 16:08:10 2005
Subject: [Bioperl-l] AlignIO and bl2seq
In-Reply-To: <989FD4FC-753D-45F3-8895-6ADE7C76309F@duke.edu>
Message-ID: <002301c56ad4$842119e0$3500a8c0@GOLHARMOBILE1>

I went for AlignIO because I came across it first and it looked like the
most simply way of doing it.  

I think what you just wrote in your message should either be in the docs
or tutorial as a recommendation indicating we should use SearchIO
instead.  

Ryan

-----Original Message-----
From: Jason Stajich [mailto:jason.stajich@duke.edu] 
Sent: Monday, June 06, 2005 3:58 PM
To: golharam@umdnj.edu
Cc: 'Bioperl List'
Subject: Re: [Bioperl-l] AlignIO and bl2seq


I know I should be using SearchIO to get the HSPs


Not to be trite, so why don't you? The AlignIO bl2seq parsing is just a
hack to delegate to the SearchIO objects for the parsing.  I only
updated it to use SearchIO when we stopped supporting BPbl2seq parsing.
Look at the code and you'll see what it is  doing I hope.  I would be
more in favor of removing AlignIO::bl2seq anyways but I am a big
believer in keeping the API as stable as possible - at least not
removing functionality without good reason.


 
To answer you question - probably because when the aln object is made
from the HSP object we don't initialize the score field.  The question
would be which score would you want - bit score or some people might
expect e-value (even if it isn't a score).  The Search objects are just
going to be richer wrt the pairwise aln data so I would start with
SearchIO - you can always get Bio::SimpleAlign objects back out with the
$hsp->get_aln method.


HTH,
-jason 

On Jun 2, 2005, at 3:39 PM, Ryan Golhar wrote:


Hi all,


I'm trying to parse some alignments performed using bl2seq.  My code is
as follows:


my $output = `bl2seq -p blastn -i seq1 -j seq2`;
my $in = Bio::AlignIO->new(-fh => new IO::String($output), -format =>
'bl2seq');
my $aln = $in->next_aln();


if (defined($aln)) {
  print "Score: ", $aln->score, "\n";
} else {
  print "n/a";
}


When it comes to printing the score, nothing gets printed out, which
makes sense because blast gives a list of HSPs or none if there aren't
any.  So, how do I get the first HSP from the output using AlignIO?  


I know I should be using SearchIO to get the HSPs, but I thought I would
try it with AlignIO as its documented, but I can't get it working.  Any
ideas???


Ryan


_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/

From lifei03 at gmail.com  Mon Jun  6 20:43:59 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Mon Jun  6 20:36:51 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
Message-ID: <1e3d81a105060617437e25966a@mail.gmail.com>

Can anybody give me some ideas about how to use bioperl module to do
Z-scores test (Say, Wilcoxon).?

Thanks very much

-- 
Do not guess who  I am.  I am not Bush in BlackHouse

From sdavis2 at mail.nih.gov  Mon Jun  6 21:16:00 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon Jun  6 21:09:08 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
References: <1e3d81a105060617437e25966a@mail.gmail.com>
Message-ID: <008001c56afe$77a3fb40$5179f345@WATSON>

Frank,

I don't think there is a bioperl module to do a t-test, but I could be 
wrong.  But you might want to look here:

http://search.cpan.org/~yunfang/Statistics-TTest-1.1.0/TTest.pm

Also, the open-source statistical package R (http://www.r-project.org) is 
quite good for such things and can be scripted or used from perl.  What are 
you trying to do?

Sean

----- Original Message ----- 
From: "Frank Lee" <lifei03@gmail.com>
To: <Bioperl-l@portal.open-bio.org>
Sent: Monday, June 06, 2005 8:43 PM
Subject: [Bioperl-l] how to use bioperl to do Z-scores test


> Can anybody give me some ideas about how to use bioperl module to do
> Z-scores test (Say, Wilcoxon).?
>
> Thanks very much
>
> -- 
> Do not guess who  I am.  I am not Bush in BlackHouse
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


From lifei03 at gmail.com  Tue Jun  7 00:25:54 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Tue Jun  7 00:19:10 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
In-Reply-To: <008001c56afe$77a3fb40$5179f345@WATSON>
References: <1e3d81a105060617437e25966a@mail.gmail.com>
	<008001c56afe$77a3fb40$5179f345@WATSON>
Message-ID: <1e3d81a10506062125441e4171@mail.gmail.com>

Hi, Sean

What I am doing now is like this:

I got a number from my data.  Say 122.     Then I generate one
thansand numbers randomly according to similar criteria, Say, (7, 19,
45,199,......................).    I wish to tell whether the result
122  is random distributed in the random dataset or it is small or
large.    And I wish to caculate the p-vlaue as a cutoff since I have
thousands of such data(set).

Can you give me some suggestions?  Thanks!

Frank

On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> Frank,
> 
> I don't think there is a bioperl module to do a t-test, but I could be
> wrong.  But you might want to look here:
> 
> http://search.cpan.org/~yunfang/Statistics-TTest-1.1.0/TTest.pm
> 
> Also, the open-source statistical package R (http://www.r-project.org) is
> quite good for such things and can be scripted or used from perl.  What are
> you trying to do?
> 
> Sean
> 
> ----- Original Message -----
> From: "Frank Lee" <lifei03@gmail.com>
> To: <Bioperl-l@portal.open-bio.org>
> Sent: Monday, June 06, 2005 8:43 PM
> Subject: [Bioperl-l] how to use bioperl to do Z-scores test
> 
> 
> > Can anybody give me some ideas about how to use bioperl module to do
> > Z-scores test (Say, Wilcoxon).?
> >
> > Thanks very much
> >
> > --
> > Do not guess who  I am.  I am not Bush in BlackHouse
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 


-- 
Do not guess who  I am.  I am not Bush in BlackHouse

From sdavis2 at mail.nih.gov  Tue Jun  7 06:29:56 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Tue Jun  7 06:26:29 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
In-Reply-To: <1e3d81a10506062125441e4171@mail.gmail.com>
References: <1e3d81a105060617437e25966a@mail.gmail.com>
	<008001c56afe$77a3fb40$5179f345@WATSON>
	<1e3d81a10506062125441e4171@mail.gmail.com>
Message-ID: <3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>


On Jun 7, 2005, at 12:25 AM, Frank Lee wrote:

> Hi, Sean
>
> What I am doing now is like this:
>
> I got a number from my data.  Say 122.     Then I generate one
> thansand numbers randomly according to similar criteria, Say, (7, 19,
> 45,199,......................).    I wish to tell whether the result
> 122  is random distributed in the random dataset or it is small or
> large.    And I wish to caculate the p-vlaue as a cutoff since I have
> thousands of such data(set).
>
> Can you give me some suggestions?  Thanks!
>

You could try using code like:

#!/usr/bin/perl
use strict;
use warnings;

# Observed data
my $datapoint=90;
# generate 1000 random numbers (from 1 to 100)
my @j;
for my $i ((1..1000)) {
   $j[$i-1] = int(rand(100));
}

# these lines return the number of permutation values > (<=) the 
observed
# value.
my $count_greater = grep {$_>$datapoint} @j;
my $count_less = grep {$_<=$datapoint} @j;

# output the result
# You're mileage may vary depending on if you want a one-sided test or 
two-sided
print "Original Data Point:  $datapoint\n";
print "Permutation values greater than Data Point:  $count_greater 
(p=".($count_greater/1000).") \n";
print "Permutation values less than Data Point:  $count_less 
(p=".($count_less/1000).") \n";


If you are working with a large dataset, you may really want to 
consider moving over to a statistical package like R, which has many 
facilities for doing all kinds of testing like this (and more).

Sean




> On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
>> Frank,
>>
>> I don't think there is a bioperl module to do a t-test, but I could be
>> wrong.  But you might want to look here:
>>
>> http://search.cpan.org/~yunfang/Statistics-TTest-1.1.0/TTest.pm
>>
>> Also, the open-source statistical package R 
>> (http://www.r-project.org) is
>> quite good for such things and can be scripted or used from perl.  
>> What are
>> you trying to do?
>>
>> Sean
>>
>> ----- Original Message -----
>> From: "Frank Lee" <lifei03@gmail.com>
>> To: <Bioperl-l@portal.open-bio.org>
>> Sent: Monday, June 06, 2005 8:43 PM
>> Subject: [Bioperl-l] how to use bioperl to do Z-scores test
>>
>>
>>> Can anybody give me some ideas about how to use bioperl module to do
>>> Z-scores test (Say, Wilcoxon).?
>>>
>>> Thanks very much
>>>
>>> --
>>> Do not guess who  I am.  I am not Bush in BlackHouse
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>>
>>
>
>
> -- 
> Do not guess who  I am.  I am not Bush in BlackHouse

From sdavis2 at mail.nih.gov  Tue Jun  7 07:08:41 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Tue Jun  7 07:02:16 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
In-Reply-To: <3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
References: <1e3d81a105060617437e25966a@mail.gmail.com>
	<008001c56afe$77a3fb40$5179f345@WATSON>
	<1e3d81a10506062125441e4171@mail.gmail.com>
	<3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
Message-ID: <73f27eab5fa23176e65f1bdcd6d2c6d7@mail.nih.gov>


On Jun 7, 2005, at 6:29 AM, Sean Davis wrote:

>
> On Jun 7, 2005, at 12:25 AM, Frank Lee wrote:
>
>> Hi, Sean
>>
>> What I am doing now is like this:
>>
>> I got a number from my data.  Say 122.     Then I generate one
>> thansand numbers randomly according to similar criteria, Say, (7, 19,
>> 45,199,......................).    I wish to tell whether the result
>> 122  is random distributed in the random dataset or it is small or
>> large.    And I wish to caculate the p-vlaue as a cutoff since I have
>> thousands of such data(set).
>>
>> Can you give me some suggestions?  Thanks!
>>
>
> You could try using code like:
>
> #!/usr/bin/perl
> use strict;
> use warnings;
>
> # Observed data
> my $datapoint=90;
> # generate 1000 random numbers (from 1 to 100)
> my @j;
> for my $i ((1..1000)) {
>   $j[$i-1] = int(rand(100));
> }
>
> # these lines return the number of permutation values > (<=) the 
> observed
> # value.
> my $count_greater = grep {$_>$datapoint} @j;
> my $count_less = grep {$_<=$datapoint} @j;
>
> # output the result
> # You're mileage may vary depending on if you want a one-sided test or 
> two-sided
> print "Original Data Point:  $datapoint\n";
> print "Permutation values greater than Data Point:  $count_greater 
> (p=".($count_greater/1000).") \n";
> print "Permutation values less than Data Point:  $count_less 
> (p=".($count_less/1000).") \n";
>
>
> If you are working with a large dataset, you may really want to 
> consider moving over to a statistical package like R, which has many 
> facilities for doing all kinds of testing like this (and more).
>

And I didn't mention--the perl rand function generates numbers from a 
uniform distribution, which may or may not be what you want.

Sean

From Shilpa.Dixit at s1.com  Tue Jun  7 06:49:13 2005
From: Shilpa.Dixit at s1.com (Shilpa Dixit)
Date: Tue Jun  7 07:56:55 2005
Subject: [Bioperl-l] About suggestions and volunteer
Message-ID: <FBD977905F9C394E8E9FC9480F5A997325BCA6@PUNW2KEXG02.pun.s1.com>

Hello,

 

I am interested to be a volunteer for perl community. What can I do Human
Genome Project? I have bit worked on 

Perl, C, C++, Oracle(Database). Also Can you tell where can I put
suggestions / ask queries related to DNA/Human Genome Project?

 

Thanks & Regards,

Shilpa

 

From lifei03 at gmail.com  Tue Jun  7 08:46:49 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Tue Jun  7 08:46:11 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
In-Reply-To: <3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
References: <1e3d81a105060617437e25966a@mail.gmail.com>
	<008001c56afe$77a3fb40$5179f345@WATSON>
	<1e3d81a10506062125441e4171@mail.gmail.com>
	<3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
Message-ID: <1e3d81a1050607054611eb3514@mail.gmail.com>

Thanks very much.  I will try the R-project.


On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> 
> On Jun 7, 2005, at 12:25 AM, Frank Lee wrote:
> 
> > Hi, Sean
> >
> > What I am doing now is like this:
> >
> > I got a number from my data.  Say 122.     Then I generate one
> > thansand numbers randomly according to similar criteria, Say, (7, 19,
> > 45,199,......................).    I wish to tell whether the result
> > 122  is random distributed in the random dataset or it is small or
> > large.    And I wish to caculate the p-vlaue as a cutoff since I have
> > thousands of such data(set).
> >
> > Can you give me some suggestions?  Thanks!
> >
> 
> You could try using code like:
> 
> #!/usr/bin/perl
> use strict;
> use warnings;
> 
> # Observed data
> my $datapoint=90;
> # generate 1000 random numbers (from 1 to 100)
> my @j;
> for my $i ((1..1000)) {
>    $j[$i-1] = int(rand(100));
> }
> 
> # these lines return the number of permutation values > (<=) the
> observed
> # value.
> my $count_greater = grep {$_>$datapoint} @j;
> my $count_less = grep {$_<=$datapoint} @j;
> 
> # output the result
> # You're mileage may vary depending on if you want a one-sided test or
> two-sided
> print "Original Data Point:  $datapoint\n";
> print "Permutation values greater than Data Point:  $count_greater
> (p=".($count_greater/1000).") \n";
> print "Permutation values less than Data Point:  $count_less
> (p=".($count_less/1000).") \n";
> 
> 
> If you are working with a large dataset, you may really want to
> consider moving over to a statistical package like R, which has many
> facilities for doing all kinds of testing like this (and more).
> 
> Sean
> 
> 
> 
> 
> > On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> >> Frank,
> >>
> >> I don't think there is a bioperl module to do a t-test, but I could be
> >> wrong.  But you might want to look here:
> >>
> >> http://search.cpan.org/~yunfang/Statistics-TTest-1.1.0/TTest.pm
> >>
> >> Also, the open-source statistical package R
> >> (http://www.r-project.org) is
> >> quite good for such things and can be scripted or used from perl.
> >> What are
> >> you trying to do?
> >>
> >> Sean
> >>
> >> ----- Original Message -----
> >> From: "Frank Lee" <lifei03@gmail.com>
> >> To: <Bioperl-l@portal.open-bio.org>
> >> Sent: Monday, June 06, 2005 8:43 PM
> >> Subject: [Bioperl-l] how to use bioperl to do Z-scores test
> >>
> >>
> >>> Can anybody give me some ideas about how to use bioperl module to do
> >>> Z-scores test (Say, Wilcoxon).?
> >>>
> >>> Thanks very much
> >>>
> >>> --
> >>> Do not guess who  I am.  I am not Bush in BlackHouse
> >>>
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >>
> >
> >
> > --
> > Do not guess who  I am.  I am not Bush in BlackHouse
> 
> 


-- 
Do not guess who  I am.  I am not Bush in BlackHouse

From lifei03 at gmail.com  Tue Jun  7 08:46:49 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Tue Jun  7 08:47:19 2005
Subject: [Bioperl-l] how to use bioperl to do Z-scores test
In-Reply-To: <3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
References: <1e3d81a105060617437e25966a@mail.gmail.com>
	<008001c56afe$77a3fb40$5179f345@WATSON>
	<1e3d81a10506062125441e4171@mail.gmail.com>
	<3fa0f3811320a583cdfe4111d6983817@mail.nih.gov>
Message-ID: <1e3d81a1050607054611eb3514@mail.gmail.com>

Thanks very much.  I will try the R-project.


On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> 
> On Jun 7, 2005, at 12:25 AM, Frank Lee wrote:
> 
> > Hi, Sean
> >
> > What I am doing now is like this:
> >
> > I got a number from my data.  Say 122.     Then I generate one
> > thansand numbers randomly according to similar criteria, Say, (7, 19,
> > 45,199,......................).    I wish to tell whether the result
> > 122  is random distributed in the random dataset or it is small or
> > large.    And I wish to caculate the p-vlaue as a cutoff since I have
> > thousands of such data(set).
> >
> > Can you give me some suggestions?  Thanks!
> >
> 
> You could try using code like:
> 
> #!/usr/bin/perl
> use strict;
> use warnings;
> 
> # Observed data
> my $datapoint=90;
> # generate 1000 random numbers (from 1 to 100)
> my @j;
> for my $i ((1..1000)) {
>    $j[$i-1] = int(rand(100));
> }
> 
> # these lines return the number of permutation values > (<=) the
> observed
> # value.
> my $count_greater = grep {$_>$datapoint} @j;
> my $count_less = grep {$_<=$datapoint} @j;
> 
> # output the result
> # You're mileage may vary depending on if you want a one-sided test or
> two-sided
> print "Original Data Point:  $datapoint\n";
> print "Permutation values greater than Data Point:  $count_greater
> (p=".($count_greater/1000).") \n";
> print "Permutation values less than Data Point:  $count_less
> (p=".($count_less/1000).") \n";
> 
> 
> If you are working with a large dataset, you may really want to
> consider moving over to a statistical package like R, which has many
> facilities for doing all kinds of testing like this (and more).
> 
> Sean
> 
> 
> 
> 
> > On 6/7/05, Sean Davis <sdavis2@mail.nih.gov> wrote:
> >> Frank,
> >>
> >> I don't think there is a bioperl module to do a t-test, but I could be
> >> wrong.  But you might want to look here:
> >>
> >> http://search.cpan.org/~yunfang/Statistics-TTest-1.1.0/TTest.pm
> >>
> >> Also, the open-source statistical package R
> >> (http://www.r-project.org) is
> >> quite good for such things and can be scripted or used from perl.
> >> What are
> >> you trying to do?
> >>
> >> Sean
> >>
> >> ----- Original Message -----
> >> From: "Frank Lee" <lifei03@gmail.com>
> >> To: <Bioperl-l@portal.open-bio.org>
> >> Sent: Monday, June 06, 2005 8:43 PM
> >> Subject: [Bioperl-l] how to use bioperl to do Z-scores test
> >>
> >>
> >>> Can anybody give me some ideas about how to use bioperl module to do
> >>> Z-scores test (Say, Wilcoxon).?
> >>>
> >>> Thanks very much
> >>>
> >>> --
> >>> Do not guess who  I am.  I am not Bush in BlackHouse
> >>>
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>
> >>
> >>
> >
> >
> > --
> > Do not guess who  I am.  I am not Bush in BlackHouse
> 
> 


-- 
Do not guess who  I am.  I am not Bush in BlackHouse

From Annie.Law at nrc-cnrc.gc.ca  Tue Jun  7 16:25:56 2005
From: Annie.Law at nrc-cnrc.gc.ca (Law, Annie)
Date: Tue Jun  7 16:21:21 2005
Subject: [Bioperl-l] Entrez Gene parser questions
Message-ID: <10C94843061E094A98C02EB77CFC328722FF4A@nrcmrdex1d.imsb.nrc.ca>

Hi,

Thanks for all of the replies.
I am using bioperl 1.4 and I have done the following:
1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, make test, make install)
2. got a copy of the entrezgene.pm from bioperl-live and put it in the Bio/SeqIO directory
3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in the corresponding directory
4. the Bio::Cluster::SequenceFamily file was already up to date
5. also have all the most recent bioperl-live Bio::SeqFeature::Gene modules

I grabbed the ASN file from ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/

I then wrote a simple perl script which includes:

#!/usr/bin/perl -w

use strict;
use Bio::ASN1::EntrezGene;
use Bio::SeqIO;
use Bio::Annotation::DBLink;
use Bio::Cluster::SequenceFamily;
 
my $file = '/var/lib/mysql/Homo_sapiens';

my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
                               -file => $file,
                               -debug => 'on');

my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;

After I run this script I get the following errors:

Useless use of hash element in void context at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.

Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.

Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.

Use of uninitialized value in string ne at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.

Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.

Can't locate object method "add_tag_value" via package "Bio::SeqFeature::Generic" at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.

I'm not sure what I am missing?

Thanks so much,
Annie.




-----Original Message-----
From: Stefan Kirov [mailto:skirov@utk.edu] 
Sent: Thursday, June 02, 2005 1:39 PM
To: Law, Annie
Cc: 'bioperl-l@bioperl.org'
Subject: Re: [Bioperl-l] Entrez Gene parser questions


Annie,
I am sorry to say there is no good documentation yet, since I am still 
evaluating and debugging the code and I have buch of other stuff to deal 
with ir tight now, so appolozie but there will not be a comprehensive 
docs for at least another 2 weeks.
First install:
I think you need to install Bio::SeqIO::entrezgene.pm and 
Bio::ASN1::EnztrezGene. You will have to update Bio::Annotation::DBLink. 
Make sure you also have Bio::Cluster::SequenceFamily and all modules in 
Bio::SeqFeature::Gene. These also may need updating.
When you do
  my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
                               -file => $file,
                               -debug => 'on');
   my ($gene,$genestructure,$uncaptured) = $seqio->next_seq; $gene->accession_number will give you the Entrezgene id and $gene->id will give you the gene symbol. If you go through the 
annotations:
my $ann=$gene->annotation; (where most of the data is)

my @dblinks= $ann->get_Annotations('DBLink')
foreach my $dblink (@dblinks) {
	print 'Unigene id for this gene is '.$dblink->id if (lc($dblink->database) eq 'unigene'); }

my @nameann=$ann->get_Annotations('Official Full Name')
print 'Gene name is ',$nameann[0]->as_text,"\n";

my @go=$ann->get_Annotations('OntologyTerm');
foreach my $go (@go) {
next if ($go->authority eq 'STS marker'); #Unless you want STS markers... my @refs=$go->term->references;#you should get just one print join(',',$gid,$go->ontology->name,$go->identifier,$go->name,'GO:'.$go->identifier,$refs[0]->medline);
}
my @associated_seq=$struct->get_members();

foreach my $seq (@associated_seq) {
    if ($contig->namespace eq 'refseq') {#Only refseq, there is also mrna, product and genomic as options...
        my @prod=$contig->annotation->get_Annotations('product');
        my @transvar=$contig->annotation->get_Annotations('simple');
        my $transvar='';
        foreach my $sv (@transvar) {
            $transvar=$sv->value if ($sv->tagname eq 'Transcriptional Variant');
        }
        my $assembly;
        foreach my $ann ($contig->annotation->get_Annotations('dblink')) {
            $assembly.=$ann->primary_id . '-' if ($ann->optional_id eq 'Source Sequence');
        }
        chop $assembly;
	my $prod;
	foreach my $p (@prod) {
		if ($p) {
			$prod=$p->value;
			last;
		}
	}
}

Hope this helps and will get you started at least. Let me know if you 
have more question.
Stefan

Law, Annie wrote:

>Hi,
>
>I would appreciate help with the following.  First of all, I would like 
>to say it's great that a Entrez gene parser was written. I just have some questions to get me started.
>
>A) I already have bioperl 1.4 installed.  I would like to know if I can 
>install the Entrez gene parser and
>Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.
>
>I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
>		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
>               (which util.pm shold I use??  I searched CPAN and got many results for util.pm
>               is it Biblio::Util, Boulder::Util, or something else??)
>
>B) For each Entrez gene id how do I access the associated Unigene id, 
>accession numbers, gene symbol, gene name, And GO IDs.
>
>Also, I have been looking at the code and the POD within it.  Are there 
>some other places that I can look for documentation?
>
>Thanks so much!!
>Annie.
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org 
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>
From skirov at utk.edu  Tue Jun  7 16:47:11 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Tue Jun  7 16:39:11 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4A@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4A@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A607CF.8040601@utk.edu>

Hi Annie,
Few more things to update:
Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason 
your script does not work. Update also Bio::SeqIO::entrezegene- I added 
some fixed so you will not see those nasty warning when using strict 
(nothing critical though).
I am not sure we have the same versions for Bio::ASN1::EntrezGene. I 
have 1.0.7. Where did you get it from (maybe mine is older)?
Stefan

Law, Annie wrote:

>Hi,
>
>Thanks for all of the replies.
>I am using bioperl 1.4 and I have done the following:
>1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, make test, make install)
>2. got a copy of the entrezgene.pm from bioperl-live and put it in the Bio/SeqIO directory
>3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in the corresponding directory
>4. the Bio::Cluster::SequenceFamily file was already up to date
>5. also have all the most recent bioperl-live Bio::SeqFeature::Gene modules
>
>I grabbed the ASN file from ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>
>I then wrote a simple perl script which includes:
>
>#!/usr/bin/perl -w
>
>use strict;
>use Bio::ASN1::EntrezGene;
>use Bio::SeqIO;
>use Bio::Annotation::DBLink;
>use Bio::Cluster::SequenceFamily;
> 
>my $file = '/var/lib/mysql/Homo_sapiens';
>
>my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>                               -file => $file,
>                               -debug => 'on');
>
>my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>
>After I run this script I get the following errors:
>
>Useless use of hash element in void context at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>
>Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>
>Use of uninitialized value in string ne at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>
>Can't locate object method "add_tag_value" via package "Bio::SeqFeature::Generic" at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>
>I'm not sure what I am missing?
>
>Thanks so much,
>Annie.
>
>
>
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov@utk.edu] 
>Sent: Thursday, June 02, 2005 1:39 PM
>To: Law, Annie
>Cc: 'bioperl-l@bioperl.org'
>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
>Annie,
>I am sorry to say there is no good documentation yet, since I am still 
>evaluating and debugging the code and I have buch of other stuff to deal 
>with ir tight now, so appolozie but there will not be a comprehensive 
>docs for at least another 2 weeks.
>First install:
>I think you need to install Bio::SeqIO::entrezgene.pm and 
>Bio::ASN1::EnztrezGene. You will have to update Bio::Annotation::DBLink. 
>Make sure you also have Bio::Cluster::SequenceFamily and all modules in 
>Bio::SeqFeature::Gene. These also may need updating.
>When you do
>  my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>                               -file => $file,
>                               -debug => 'on');
>   my ($gene,$genestructure,$uncaptured) = $seqio->next_seq; $gene->accession_number will give you the Entrezgene id and $gene->id will give you the gene symbol. If you go through the 
>annotations:
>my $ann=$gene->annotation; (where most of the data is)
>
>my @dblinks= $ann->get_Annotations('DBLink')
>foreach my $dblink (@dblinks) {
>	print 'Unigene id for this gene is '.$dblink->id if (lc($dblink->database) eq 'unigene'); }
>
>my @nameann=$ann->get_Annotations('Official Full Name')
>print 'Gene name is ',$nameann[0]->as_text,"\n";
>
>my @go=$ann->get_Annotations('OntologyTerm');
>foreach my $go (@go) {
>next if ($go->authority eq 'STS marker'); #Unless you want STS markers... my @refs=$go->term->references;#you should get just one print join(',',$gid,$go->ontology->name,$go->identifier,$go->name,'GO:'.$go->identifier,$refs[0]->medline);
>}
>my @associated_seq=$struct->get_members();
>
>foreach my $seq (@associated_seq) {
>    if ($contig->namespace eq 'refseq') {#Only refseq, there is also mrna, product and genomic as options...
>        my @prod=$contig->annotation->get_Annotations('product');
>        my @transvar=$contig->annotation->get_Annotations('simple');
>        my $transvar='';
>        foreach my $sv (@transvar) {
>            $transvar=$sv->value if ($sv->tagname eq 'Transcriptional Variant');
>        }
>        my $assembly;
>        foreach my $ann ($contig->annotation->get_Annotations('dblink')) {
>            $assembly.=$ann->primary_id . '-' if ($ann->optional_id eq 'Source Sequence');
>        }
>        chop $assembly;
>	my $prod;
>	foreach my $p (@prod) {
>		if ($p) {
>			$prod=$p->value;
>			last;
>		}
>	}
>}
>
>Hope this helps and will get you started at least. Let me know if you 
>have more question.
>Stefan
>
>Law, Annie wrote:
>
>  
>
>>Hi,
>>
>>I would appreciate help with the following.  First of all, I would like 
>>to say it's great that a Entrez gene parser was written. I just have some questions to get me started.
>>
>>A) I already have bioperl 1.4 installed.  I would like to know if I can 
>>install the Entrez gene parser and
>>Stefan Kirov's entrezgene.pm with out reinstalling bioperl.  If this is not advised then I would reinstall bioperl.
>>
>>I was going to 1. install the Bio::ASN1::EntrezGene module (perl Makefile.PL, make, make test, make install, etc...)
>>		   2. just take only the entrezgene.pm and util.pm file and put it in the appropriate directory
>>              (which util.pm shold I use??  I searched CPAN and got many results for util.pm
>>              is it Biblio::Util, Boulder::Util, or something else??)
>>
>>B) For each Entrez gene id how do I access the associated Unigene id, 
>>accession numbers, gene symbol, gene name, And GO IDs.
>>
>>Also, I have been looking at the code and the POD within it.  Are there 
>>some other places that I can look for documentation?
>>
>>Thanks so much!!
>>Annie.
>>
>>
>>_______________________________________________
>>Bioperl-l mailing list
>>Bioperl-l@portal.open-bio.org 
>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> 
>>
>>    
>>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From mingyi.liu at gpc-biotech.com  Tue Jun  7 19:06:28 2005
From: mingyi.liu at gpc-biotech.com (Mingyi Liu)
Date: Tue Jun  7 18:58:41 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A607CF.8040601@utk.edu>
References: <10C94843061E094A98C02EB77CFC328722FF4A@nrcmrdex1d.imsb.nrc.ca>
	<42A607CF.8040601@utk.edu>
Message-ID: <42A62874.6060408@gpc-biotech.com>

Hi, Annie

Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked 
fine with your entrezgene.pm in bioperl-live at least a couple days ago, 
when I replied to Annie.  V1.09 also did not have any significant 
changes in parser code vs. 1.07.

I guess it has something to do with V1.4 since the sample script you 
used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
procedure you used was also correct (there's no need to 'use 
Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
(although I don't quite understand why Bio::ASN1::EntrezGene complained 
about non numerica operon, which can only result from incorrect calling 
of the function.  But Stefan's entrezgene was using correct calling and 
it runs perfectly for me.  I was using entrezgene.pm CVS version 1.9.

Keep us posted on your progress.

BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file' 
(bioperl style) or 'file' (I allowed both when I implemented this switch 
I think. I usually just use file, which might explain your note in the 
comment in your script.  I just noticed the comment.

Mingyi

Stefan Kirov wrote:

> Hi Annie,
> Few more things to update:
> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason 
> your script does not work. Update also Bio::SeqIO::entrezegene- I 
> added some fixed so you will not see those nasty warning when using 
> strict (nothing critical though).
> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I 
> have 1.0.7. Where did you get it from (maybe mine is older)?
> Stefan
>
> Law, Annie wrote:
>
>> Hi,
>>
>> Thanks for all of the replies.
>> I am using bioperl 1.4 and I have done the following:
>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, 
>> make test, make install)
>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in 
>> the Bio/SeqIO directory
>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>> the corresponding directory
>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>> modules
>>
>> I grabbed the ASN file from 
>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>
>> I then wrote a simple perl script which includes:
>>
>> #!/usr/bin/perl -w
>>
>> use strict;
>> use Bio::ASN1::EntrezGene;
>> use Bio::SeqIO;
>> use Bio::Annotation::DBLink;
>> use Bio::Cluster::SequenceFamily;
>>
>> my $file = '/var/lib/mysql/Homo_sapiens';
>>
>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>                               -file => $file,
>>                               -debug => 'on');
>>
>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>
>> After I run this script I get the following errors:
>>
>> Useless use of hash element in void context at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>
>> Argument "-trimopt" isn't numeric in numeric eq (==) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>
>> Use of uninitialized value in string ne at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>
>> Can't locate object method "add_tag_value" via package 
>> "Bio::SeqFeature::Generic" at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>
>> I'm not sure what I am missing?
>>
>> Thanks so much,
>> Annie.
>


From skirov at utk.edu  Tue Jun  7 20:38:53 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Tue Jun  7 20:30:46 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A62874.6060408@gpc-biotech.com>
References: <10C94843061E094A98C02EB77CFC328722FF4A@nrcmrdex1d.imsb.nrc.ca>
	<42A607CF.8040601@utk.edu> <42A62874.6060408@gpc-biotech.com>
Message-ID: <42A63E1D.3090307@utk.edu>

I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the 
code (actually the underlying modules I mentioned...).
Thanks for the -file option... There are also some leftover commenst :-) 
. I need to clean the code a bit...
Stefan

Mingyi Liu wrote:

> Hi, Annie
>
> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked 
> fine with your entrezgene.pm in bioperl-live at least a couple days 
> ago, when I replied to Annie.  V1.09 also did not have any significant 
> changes in parser code vs. 1.07.
>
> I guess it has something to do with V1.4 since the sample script you 
> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
> procedure you used was also correct (there's no need to 'use 
> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
> (although I don't quite understand why Bio::ASN1::EntrezGene 
> complained about non numerica operon, which can only result from 
> incorrect calling of the function.  But Stefan's entrezgene was using 
> correct calling and it runs perfectly for me.  I was using 
> entrezgene.pm CVS version 1.9.
>
> Keep us posted on your progress.
>
> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file' 
> (bioperl style) or 'file' (I allowed both when I implemented this 
> switch I think. I usually just use file, which might explain your note 
> in the comment in your script.  I just noticed the comment.
>
> Mingyi
>
> Stefan Kirov wrote:
>
>> Hi Annie,
>> Few more things to update:
>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason 
>> your script does not work. Update also Bio::SeqIO::entrezegene- I 
>> added some fixed so you will not see those nasty warning when using 
>> strict (nothing critical though).
>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I 
>> have 1.0.7. Where did you get it from (maybe mine is older)?
>> Stefan
>>
>> Law, Annie wrote:
>>
>>> Hi,
>>>
>>> Thanks for all of the replies.
>>> I am using bioperl 1.4 and I have done the following:
>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, 
>>> make test, make install)
>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in 
>>> the Bio/SeqIO directory
>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>>> the corresponding directory
>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>>> modules
>>>
>>> I grabbed the ASN file from 
>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>
>>> I then wrote a simple perl script which includes:
>>>
>>> #!/usr/bin/perl -w
>>>
>>> use strict;
>>> use Bio::ASN1::EntrezGene;
>>> use Bio::SeqIO;
>>> use Bio::Annotation::DBLink;
>>> use Bio::Cluster::SequenceFamily;
>>>
>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>
>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>                               -file => $file,
>>>                               -debug => 'on');
>>>
>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>
>>> After I run this script I get the following errors:
>>>
>>> Useless use of hash element in void context at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>
>>> Argument "-trimopt" isn't numeric in numeric eq (==) at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>
>>> Pseudo-hashes are deprecated at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>
>>> Use of uninitialized value in string ne at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>
>>> Pseudo-hashes are deprecated at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>
>>> Can't locate object method "add_tag_value" via package 
>>> "Bio::SeqFeature::Generic" at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>
>>> I'm not sure what I am missing?
>>>
>>> Thanks so much,
>>> Annie.
>>
>>
>
>

From amackey at virginia.edu  Tue Jun  7 11:30:15 2005
From: amackey at virginia.edu (Aaron J. Mackey)
Date: Wed Jun  8 07:47:30 2005
Subject: [Bioperl-l] Fwd: BioPerl Blast Tools
References: <20050607154259.owcoogs4kgwgw0cs@webmail1.manchester.ac.uk>
Message-ID: <4D57A819-E562-4CC6-8756-BA4A72271016@virginia.edu>



Begin forwarded message:

> From: Paul Fisher <Paul.Fisher@postgrad.manchester.ac.uk>
> Date: June 7, 2005 10:42:59 AM EDT
> Subject: RE: BioPerl Blast Tools

> I am currently working through my final research project for my MSc
> Bioinformatics degree, which is to develop a comparison tool for  
> comparing
> two blast files.
>
> What i require now is a means of filtering the results held in a  
> blast file
> depending on species and/or chromosome, i.e the hits that are  
> present in
> Homo sapiens and/or chromosome 3, then showing on the new hits from  
> the
> blast file (when compared to the original file) to the user.
>
> Is there any such implementation at present within the Bioperl  
> modules or
> any assistance given by the NCBI staff and their API's.
>
>
> Any help is much appreciated.
> Thanks,
> Paul Fisher.

From dbastar at yahoo.com  Wed Jun  8 07:43:41 2005
From: dbastar at yahoo.com (Duangdaow Kanhasiri)
Date: Wed Jun  8 07:47:44 2005
Subject: [Bioperl-l] Error loading sequence with load_seqdatabase.pl
Message-ID: <20050608114341.29861.qmail@web40728.mail.yahoo.com>

Hi,

I've used the bioperl script load_seqdatabase.pl (came
with the biosql' scripts) to load the bacterial
sequence in genbank format(*.gbk) into PostgreSQL 8.0
database on Linux machine as:

$perl load_seqdatabase.pl /export/Bacteria/*/*.gbk &

Where  under the /export/Bacteria/ path are the
Bacteria's name path e.g. Acinetobacter_sp_ADP1 and
the file name are like NC_006824.gbk.  

Previously it used to load some sequences in to some
tables in biosql database (count from table bioentry) 

bioseq=# select count(*) from bioentry;
 count
-------
   33
(1 row)


However, after a while it then stopped with the the
error:

[1]+  Segmentation fault      perl load_seqdatabase.pl
/export/Bacteria/*/*.gbk &

I then checked and removed the *.gbk file that have
already been loaded in to the table, leaving only the
unloaded ones and ran the scripted again.  It
continued to work for some times and stopped again.  I
repeated the process several times until 173 sequences
were loaded into the table:

bioseq=# select count(*) from bioentry;
 count
-------
   173
(1 row)

The program then stopped again and this time it
wouldn't run anymore even I tried with only on file.
The error is still the same like: 

$ perl load_seqdatabase.pl
/export/Bacteria/Lactobacillus_johnsonii_NCC_533/NC_005362.gbk
Segmentation fault
$

Now I couldn't load the rest of my sequences into the
database anymore.  I would be very apprecialed if any
one knows how to solve the "Segmentation fault"
problem?

Regards,

Davina


		
__________________________________ 
Discover Yahoo! 
Have fun online with music videos, cool games, IM and more. Check it out! 
http://discover.yahoo.com/online.html
-------------- next part --------------
A non-text attachment was scrubbed...
Name: load_seqdatabase.pl
Type: application/octet-stream
Size: 22486 bytes
Desc: 3434098052-load_seqdatabase.pl
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20050608/1c6b46ab/load_seqdatabase-0001.obj
From sdavis2 at mail.nih.gov  Wed Jun  8 09:43:03 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Wed Jun  8 09:35:58 2005
Subject: [Bioperl-l] Bio::SeqIO::entrezgene refseq question
Message-ID: <6c528f4e127499b0431bfc524aaaa88f@mail.nih.gov>

Stefan and Mingyi,

I don't think I have officially thanked you both for a nice 
contribution for those of use using annotation heavily.  I am just 
picking up with using the new parsers.  Just a quick question:  How 
would I get something like the gene2refseq file out of the parser?  In 
particular, I would like to get all rna/protein pairs (as pairs) where 
they exist, as well as rna and protein that do not have pairs.  I guess 
I haven't waded into the object structure far enough, yet.

Thanks,
Sean

From skirov at utk.edu  Wed Jun  8 10:12:32 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Jun  8 10:06:00 2005
Subject: [Bioperl-l] Bio::SeqIO::entrezgene refseq question
In-Reply-To: <6c528f4e127499b0431bfc524aaaa88f@mail.nih.gov>
References: <6c528f4e127499b0431bfc524aaaa88f@mail.nih.gov>
Message-ID: <42A6FCD0.1010207@utk.edu>

Sean,
Here it is:
my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
                               -file => $file,
                               -debug => 'on');
   my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;

The object you need is $genestructure- it has all sequence related data- 
genomic contigs,  Refseq, GenBank.
Then to get the data you ask for:
my @seobj=$struct->get_members();
foreach my $seq(@seqobj) {
    next unless (($contig->namespace eq 
'refseq')&&($contig->authority=~/mrna/i)); #skip unless refseq 
transcript, alternatively you can read the protein as well and put it in 
a hash/array
     my @prod=$contig->annotation->get_Annotations('product');
    my $protid=$prod[0]->value if ($prod[0]);#I would expect only one 
product....
}
Then if you wish you can get the whole record for the protein out of @seqobj
It is not your fault, just the docs are not there yet (any moment now  
:-) )...
Let me know if this helps and if you need anything else.
Stefan      

Sean Davis wrote:

> Stefan and Mingyi,
>
> I don't think I have officially thanked you both for a nice 
> contribution for those of use using annotation heavily.  I am just 
> picking up with using the new parsers.  Just a quick question:  How 
> would I get something like the gene2refseq file out of the parser?  In 
> particular, I would like to get all rna/protein pairs (as pairs) where 
> they exist, as well as rna and protein that do not have pairs.  I 
> guess I haven't waded into the object structure far enough, yet.
>
> Thanks,
> Sean
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l



From Annie.Law at nrc-cnrc.gc.ca  Wed Jun  8 11:40:24 2005
From: Annie.Law at nrc-cnrc.gc.ca (Law, Annie)
Date: Wed Jun  8 11:32:20 2005
Subject: [Bioperl-l] Entrez Gene parser questions
Message-ID: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>

Hi, 

I went to bioperl-live and copied the newest entrezgene.pm and Bio::AnnotatableI, Bio::SeqFeatureI modules and
I got the following output (same output with entrezgene.pm saved on May 11 as well).  The complaint about the module 
Generic.pm is gone now.
I am using EntrezGene V 1.09 picked up from CPAN.

I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 directory and install EntrezGene V.1.07 but that is not supposed to make a difference?
Here's a wild stab but are the additional messages related to a statement I read somewhere about the first record being empty?

Is my next alternative to install Bioperl 1.5 and try again? If so, am I correct in thinking that to 'uninstall' there is no such
Uninstall command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
Use CPAN to install bioperl 1.5

Thanks so much,
Annie.


Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.


-----Original Message-----
From: Stefan Kirov [mailto:skirov@utk.edu] 
Sent: Tuesday, June 07, 2005 8:39 PM
To: Mingyi Liu
Cc: Law, Annie; Bioperl list
Subject: Re: [Bioperl-l] Entrez Gene parser questions


I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the 
code (actually the underlying modules I mentioned...).
Thanks for the -file option... There are also some leftover commenst :-) 
. I need to clean the code a bit...
Stefan

Mingyi Liu wrote:

> Hi, Annie
>
> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
> fine with your entrezgene.pm in bioperl-live at least a couple days 
> ago, when I replied to Annie.  V1.09 also did not have any significant 
> changes in parser code vs. 1.07.
>
> I guess it has something to do with V1.4 since the sample script you
> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
> procedure you used was also correct (there's no need to 'use 
> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
> (although I don't quite understand why Bio::ASN1::EntrezGene 
> complained about non numerica operon, which can only result from 
> incorrect calling of the function.  But Stefan's entrezgene was using 
> correct calling and it runs perfectly for me.  I was using 
> entrezgene.pm CVS version 1.9.
>
> Keep us posted on your progress.
>
> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
> (bioperl style) or 'file' (I allowed both when I implemented this 
> switch I think. I usually just use file, which might explain your note 
> in the comment in your script.  I just noticed the comment.
>
> Mingyi
>
> Stefan Kirov wrote:
>
>> Hi Annie,
>> Few more things to update:
>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>> your script does not work. Update also Bio::SeqIO::entrezegene- I 
>> added some fixed so you will not see those nasty warning when using 
>> strict (nothing critical though).
>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I 
>> have 1.0.7. Where did you get it from (maybe mine is older)?
>> Stefan
>>
>> Law, Annie wrote:
>>
>>> Hi,
>>>
>>> Thanks for all of the replies.
>>> I am using bioperl 1.4 and I have done the following:
>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>> make test, make install)
>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in 
>>> the Bio/SeqIO directory
>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>>> the corresponding directory
>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>>> modules
>>>
>>> I grabbed the ASN file from
>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>
>>> I then wrote a simple perl script which includes:
>>>
>>> #!/usr/bin/perl -w
>>>
>>> use strict;
>>> use Bio::ASN1::EntrezGene;
>>> use Bio::SeqIO;
>>> use Bio::Annotation::DBLink;
>>> use Bio::Cluster::SequenceFamily;
>>>
>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>
>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>                               -file => $file,
>>>                               -debug => 'on');
>>>
>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>
>>> After I run this script I get the following errors:
>>>
>>> Useless use of hash element in void context at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>
>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>
>>> Pseudo-hashes are deprecated at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>
>>> Use of uninitialized value in string ne at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>
>>> Pseudo-hashes are deprecated at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>
>>> Can't locate object method "add_tag_value" via package
>>> "Bio::SeqFeature::Generic" at 
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>
>>> I'm not sure what I am missing?
>>>
>>> Thanks so much,
>>> Annie.
>>
>>
>
>
From skirov at utk.edu  Wed Jun  8 11:52:37 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Jun  8 11:44:30 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A71445.9010308@utk.edu>

Annie,
Can you just disable use strict for now and tell me again what you see?
Stefan

Law, Annie wrote:

>Hi, 
>
>I went to bioperl-live and copied the newest entrezgene.pm and Bio::AnnotatableI, Bio::SeqFeatureI modules and
>I got the following output (same output with entrezgene.pm saved on May 11 as well).  The complaint about the module 
>Generic.pm is gone now.
>I am using EntrezGene V 1.09 picked up from CPAN.
>
>I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 directory and install EntrezGene V.1.07 but that is not supposed to make a difference?
>Here's a wild stab but are the additional messages related to a statement I read somewhere about the first record being empty?
>
>Is my next alternative to install Bioperl 1.5 and try again? If so, am I correct in thinking that to 'uninstall' there is no such
>Uninstall command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>Use CPAN to install bioperl 1.5
>
>Thanks so much,
>Annie.
>
>
>Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov@utk.edu] 
>Sent: Tuesday, June 07, 2005 8:39 PM
>To: Mingyi Liu
>Cc: Law, Annie; Bioperl list
>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
>I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the 
>code (actually the underlying modules I mentioned...).
>Thanks for the -file option... There are also some leftover commenst :-) 
>. I need to clean the code a bit...
>Stefan
>
>Mingyi Liu wrote:
>
>  
>
>>Hi, Annie
>>
>>Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>>fine with your entrezgene.pm in bioperl-live at least a couple days 
>>ago, when I replied to Annie.  V1.09 also did not have any significant 
>>changes in parser code vs. 1.07.
>>
>>I guess it has something to do with V1.4 since the sample script you
>>used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
>>procedure you used was also correct (there's no need to 'use 
>>Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
>>(although I don't quite understand why Bio::ASN1::EntrezGene 
>>complained about non numerica operon, which can only result from 
>>incorrect calling of the function.  But Stefan's entrezgene was using 
>>correct calling and it runs perfectly for me.  I was using 
>>entrezgene.pm CVS version 1.9.
>>
>>Keep us posted on your progress.
>>
>>BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>>(bioperl style) or 'file' (I allowed both when I implemented this 
>>switch I think. I usually just use file, which might explain your note 
>>in the comment in your script.  I just noticed the comment.
>>
>>Mingyi
>>
>>Stefan Kirov wrote:
>>
>>    
>>
>>>Hi Annie,
>>>Few more things to update:
>>>Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>>your script does not work. Update also Bio::SeqIO::entrezegene- I 
>>>added some fixed so you will not see those nasty warning when using 
>>>strict (nothing critical though).
>>>I am not sure we have the same versions for Bio::ASN1::EntrezGene. I 
>>>have 1.0.7. Where did you get it from (maybe mine is older)?
>>>Stefan
>>>
>>>Law, Annie wrote:
>>>
>>>      
>>>
>>>>Hi,
>>>>
>>>>Thanks for all of the replies.
>>>>I am using bioperl 1.4 and I have done the following:
>>>>1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>>make test, make install)
>>>>2. got a copy of the entrezgene.pm from bioperl-live and put it in 
>>>>the Bio/SeqIO directory
>>>>3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>>>>the corresponding directory
>>>>4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>>>>modules
>>>>
>>>>I grabbed the ASN file from
>>>>ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>
>>>>I then wrote a simple perl script which includes:
>>>>
>>>>#!/usr/bin/perl -w
>>>>
>>>>use strict;
>>>>use Bio::ASN1::EntrezGene;
>>>>use Bio::SeqIO;
>>>>use Bio::Annotation::DBLink;
>>>>use Bio::Cluster::SequenceFamily;
>>>>
>>>>my $file = '/var/lib/mysql/Homo_sapiens';
>>>>
>>>>my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>                              -file => $file,
>>>>                              -debug => 'on');
>>>>
>>>>my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>
>>>>After I run this script I get the following errors:
>>>>
>>>>Useless use of hash element in void context at
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>
>>>>Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>
>>>>Pseudo-hashes are deprecated at
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>
>>>>Use of uninitialized value in string ne at
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>
>>>>Pseudo-hashes are deprecated at
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>
>>>>Can't locate object method "add_tag_value" via package
>>>>"Bio::SeqFeature::Generic" at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>
>>>>I'm not sure what I am missing?
>>>>
>>>>Thanks so much,
>>>>Annie.
>>>>        
>>>>
>>>      
>>>
>>    
>>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From Annie.Law at nrc-cnrc.gc.ca  Wed Jun  8 12:01:52 2005
From: Annie.Law at nrc-cnrc.gc.ca (Law, Annie)
Date: Wed Jun  8 11:53:48 2005
Subject: [Bioperl-l] Entrez Gene parser questions
Message-ID: <10C94843061E094A98C02EB77CFC328722FF4C@nrcmrdex1d.imsb.nrc.ca>

Hi Stefan,

I commented out the use strict and I think I got the same output.
Here's what I got.

Thanks,
Annie.

Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.

-----Original Message-----
From: Stefan Kirov [mailto:skirov@utk.edu] 
Sent: Wednesday, June 08, 2005 11:53 AM
To: Law, Annie
Cc: Mingyi Liu; Bioperl list
Subject: Re: [Bioperl-l] Entrez Gene parser questions


Annie,
Can you just disable use strict for now and tell me again what you see? Stefan

Law, Annie wrote:

>Hi,
>
>I went to bioperl-live and copied the newest entrezgene.pm and 
>Bio::AnnotatableI, Bio::SeqFeatureI modules and I got the following 
>output (same output with entrezgene.pm saved on May 11 as well).  The 
>complaint about the module Generic.pm is gone now. I am using 
>EntrezGene V 1.09 picked up from CPAN.
>
>I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 
>directory and install EntrezGene V.1.07 but that is not supposed to 
>make a difference? Here's a wild stab but are the additional messages 
>related to a statement I read somewhere about the first record being 
>empty?
>
>Is my next alternative to install Bioperl 1.5 and try again? If so, am 
>I correct in thinking that to 'uninstall' there is no such Uninstall 
>command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  
>ie. The Bio directory and then Use CPAN to install bioperl 1.5
>
>Thanks so much,
>Annie.
>
>
>Argument "-trimopt" isn't numeric in numeric eq (==) at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450. 
>Pseudo-hashes are deprecated at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554. Use of 
>uninitialized value in substitution (s///) at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554. Use of 
>uninitialized value in substitution (s///) at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555. 
>Pseudo-hashes are deprecated at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295. Use of 
>uninitialized value in string eq at 
>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov@utk.edu]
>Sent: Tuesday, June 07, 2005 8:39 PM
>To: Mingyi Liu
>Cc: Law, Annie; Bioperl list
>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
>I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>code (actually the underlying modules I mentioned...).
>Thanks for the -file option... There are also some leftover commenst :-) 
>. I need to clean the code a bit...
>Stefan
>
>Mingyi Liu wrote:
>
>  
>
>>Hi, Annie
>>
>>Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked 
>>fine with your entrezgene.pm in bioperl-live at least a couple days 
>>ago, when I replied to Annie.  V1.09 also did not have any significant 
>>changes in parser code vs. 1.07.
>>
>>I guess it has something to do with V1.4 since the sample script you 
>>used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
>>procedure you used was also correct (there's no need to 'use 
>>Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
>>(although I don't quite understand why Bio::ASN1::EntrezGene 
>>complained about non numerica operon, which can only result from 
>>incorrect calling of the function.  But Stefan's entrezgene was using 
>>correct calling and it runs perfectly for me.  I was using 
>>entrezgene.pm CVS version 1.9.
>>
>>Keep us posted on your progress.
>>
>>BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file' 
>>(bioperl style) or 'file' (I allowed both when I implemented this 
>>switch I think. I usually just use file, which might explain your note 
>>in the comment in your script.  I just noticed the comment.
>>
>>Mingyi
>>
>>Stefan Kirov wrote:
>>
>>    
>>
>>>Hi Annie,
>>>Few more things to update:
>>>Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason 
>>>your script does not work. Update also Bio::SeqIO::entrezegene- I 
>>>added some fixed so you will not see those nasty warning when using 
>>>strict (nothing critical though). I am not sure we have the same 
>>>versions for Bio::ASN1::EntrezGene. I have 1.0.7. Where did you get 
>>>it from (maybe mine is older)? Stefan
>>>
>>>Law, Annie wrote:
>>>
>>>      
>>>
>>>>Hi,
>>>>
>>>>Thanks for all of the replies.
>>>>I am using bioperl 1.4 and I have done the following:
>>>>1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, 
>>>>make test, make install) 2. got a copy of the entrezgene.pm from 
>>>>bioperl-live and put it in the Bio/SeqIO directory
>>>>3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>>>>the corresponding directory
>>>>4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>>>>modules
>>>>
>>>>I grabbed the ASN file from 
>>>>ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>
>>>>I then wrote a simple perl script which includes:
>>>>
>>>>#!/usr/bin/perl -w
>>>>
>>>>use strict;
>>>>use Bio::ASN1::EntrezGene;
>>>>use Bio::SeqIO;
>>>>use Bio::Annotation::DBLink;
>>>>use Bio::Cluster::SequenceFamily;
>>>>
>>>>my $file = '/var/lib/mysql/Homo_sapiens';
>>>>
>>>>my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>                              -file => $file,
>>>>                              -debug => 'on');
>>>>
>>>>my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>
>>>>After I run this script I get the following errors:
>>>>
>>>>Useless use of hash element in void context at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>
>>>>Argument "-trimopt" isn't numeric in numeric eq (==) at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>
>>>>Pseudo-hashes are deprecated at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>
>>>>Use of uninitialized value in string ne at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>
>>>>Pseudo-hashes are deprecated at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>
>>>>Can't locate object method "add_tag_value" via package 
>>>>"Bio::SeqFeature::Generic" at 
>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>
>>>>I'm not sure what I am missing?
>>>>
>>>>Thanks so much,
>>>>Annie.
>>>>        
>>>>
>>>      
>>>
>>    
>>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"
From sdavis2 at mail.nih.gov  Wed Jun  8 12:25:30 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Wed Jun  8 12:18:45 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A71445.9010308@utk.edu>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
	<42A71445.9010308@utk.edu>
Message-ID: <414778d6b5d2e32b9a0c20192a9afe3f@mail.nih.gov>

Just for reference, I am using CVS bioperl-live, Bio::ASN1::entrezgene 
1.09 without any difficulty.

Sean

On Jun 8, 2005, at 11:52 AM, Stefan Kirov wrote:

> Annie,
> Can you just disable use strict for now and tell me again what you see?
> Stefan
>
> Law, Annie wrote:
>
>> Hi,
>> I went to bioperl-live and copied the newest entrezgene.pm and 
>> Bio::AnnotatableI, Bio::SeqFeatureI modules and
>> I got the following output (same output with entrezgene.pm saved on 
>> May 11 as well).  The complaint about the module Generic.pm is gone 
>> now.
>> I am using EntrezGene V 1.09 picked up from CPAN.
>>
>> I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 
>> directory and install EntrezGene V.1.07 but that is not supposed to 
>> make a difference?
>> Here's a wild stab but are the additional messages related to a 
>> statement I read somewhere about the first record being empty?
>>
>> Is my next alternative to install Bioperl 1.5 and try again? If so, 
>> am I correct in thinking that to 'uninstall' there is no such
>> Uninstall command but I would just delete the 
>> /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>> Use CPAN to install bioperl 1.5
>>
>> Thanks so much,
>> Annie.
>>
>>
>> Argument "-trimopt" isn't numeric in numeric eq (==) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>>
>>
>> -----Original Message-----
>> From: Stefan Kirov [mailto:skirov@utk.edu] Sent: Tuesday, June 07, 
>> 2005 8:39 PM
>> To: Mingyi Liu
>> Cc: Law, Annie; Bioperl list
>> Subject: Re: [Bioperl-l] Entrez Gene parser questions
>>
>>
>> I am pretty sure it is the old Bio::SeqFeature::Generic that breaks 
>> the code (actually the underlying modules I mentioned...).
>> Thanks for the -file option... There are also some leftover commenst 
>> :-) . I need to clean the code a bit...
>> Stefan

From skirov at utk.edu  Wed Jun  8 12:10:36 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Jun  8 12:44:16 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4C@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4C@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A7187C.3090902@utk.edu>

Change

#!/usr/bin/perl -w
to
#!/usr/bin/perl 
 and let me know again...
Thanks!



Law, Annie wrote:

>Hi Stefan,
>
>I commented out the use strict and I think I got the same output.
>Here's what I got.
>
>Thanks,
>Annie.
>
>Argument "-trimopt" isn't numeric in numeric eq (==) at /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>Use of uninitialized value in substitution (s///) at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>Pseudo-hashes are deprecated at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>Use of uninitialized value in string eq at /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov@utk.edu] 
>Sent: Wednesday, June 08, 2005 11:53 AM
>To: Law, Annie
>Cc: Mingyi Liu; Bioperl list
>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
>Annie,
>Can you just disable use strict for now and tell me again what you see? Stefan
>
>Law, Annie wrote:
>
>  
>
>>Hi,
>>
>>I went to bioperl-live and copied the newest entrezgene.pm and 
>>Bio::AnnotatableI, Bio::SeqFeatureI modules and I got the following 
>>output (same output with entrezgene.pm saved on May 11 as well).  The 
>>complaint about the module Generic.pm is gone now. I am using 
>>EntrezGene V 1.09 picked up from CPAN.
>>
>>I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 
>>directory and install EntrezGene V.1.07 but that is not supposed to 
>>make a difference? Here's a wild stab but are the additional messages 
>>related to a statement I read somewhere about the first record being 
>>empty?
>>
>>Is my next alternative to install Bioperl 1.5 and try again? If so, am 
>>I correct in thinking that to 'uninstall' there is no such Uninstall 
>>command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  
>>ie. The Bio directory and then Use CPAN to install bioperl 1.5
>>
>>Thanks so much,
>>Annie.
>>
>>
>>Argument "-trimopt" isn't numeric in numeric eq (==) at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450. 
>>Pseudo-hashes are deprecated at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554. Use of 
>>uninitialized value in substitution (s///) at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554. Use of 
>>uninitialized value in substitution (s///) at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555. 
>>Pseudo-hashes are deprecated at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295. Use of 
>>uninitialized value in string eq at 
>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>>
>>
>>-----Original Message-----
>>From: Stefan Kirov [mailto:skirov@utk.edu]
>>Sent: Tuesday, June 07, 2005 8:39 PM
>>To: Mingyi Liu
>>Cc: Law, Annie; Bioperl list
>>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>>
>>
>>I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>>code (actually the underlying modules I mentioned...).
>>Thanks for the -file option... There are also some leftover commenst :-) 
>>. I need to clean the code a bit...
>>Stefan
>>
>>Mingyi Liu wrote:
>>
>> 
>>
>>    
>>
>>>Hi, Annie
>>>
>>>Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked 
>>>fine with your entrezgene.pm in bioperl-live at least a couple days 
>>>ago, when I replied to Annie.  V1.09 also did not have any significant 
>>>changes in parser code vs. 1.07.
>>>
>>>I guess it has something to do with V1.4 since the sample script you 
>>>used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The 
>>>procedure you used was also correct (there's no need to 'use 
>>>Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first 
>>>(although I don't quite understand why Bio::ASN1::EntrezGene 
>>>complained about non numerica operon, which can only result from 
>>>incorrect calling of the function.  But Stefan's entrezgene was using 
>>>correct calling and it runs perfectly for me.  I was using 
>>>entrezgene.pm CVS version 1.9.
>>>
>>>Keep us posted on your progress.
>>>
>>>BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file' 
>>>(bioperl style) or 'file' (I allowed both when I implemented this 
>>>switch I think. I usually just use file, which might explain your note 
>>>in the comment in your script.  I just noticed the comment.
>>>
>>>Mingyi
>>>
>>>Stefan Kirov wrote:
>>>
>>>   
>>>
>>>      
>>>
>>>>Hi Annie,
>>>>Few more things to update:
>>>>Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason 
>>>>your script does not work. Update also Bio::SeqIO::entrezegene- I 
>>>>added some fixed so you will not see those nasty warning when using 
>>>>strict (nothing critical though). I am not sure we have the same 
>>>>versions for Bio::ASN1::EntrezGene. I have 1.0.7. Where did you get 
>>>>it from (maybe mine is older)? Stefan
>>>>
>>>>Law, Annie wrote:
>>>>
>>>>     
>>>>
>>>>        
>>>>
>>>>>Hi,
>>>>>
>>>>>Thanks for all of the replies.
>>>>>I am using bioperl 1.4 and I have done the following:
>>>>>1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make, 
>>>>>make test, make install) 2. got a copy of the entrezgene.pm from 
>>>>>bioperl-live and put it in the Bio/SeqIO directory
>>>>>3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in 
>>>>>the corresponding directory
>>>>>4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>>5. also have all the most recent bioperl-live Bio::SeqFeature::Gene 
>>>>>modules
>>>>>
>>>>>I grabbed the ASN file from 
>>>>>ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>>
>>>>>I then wrote a simple perl script which includes:
>>>>>
>>>>>#!/usr/bin/perl -w
>>>>>
>>>>>use strict;
>>>>>use Bio::ASN1::EntrezGene;
>>>>>use Bio::SeqIO;
>>>>>use Bio::Annotation::DBLink;
>>>>>use Bio::Cluster::SequenceFamily;
>>>>>
>>>>>my $file = '/var/lib/mysql/Homo_sapiens';
>>>>>
>>>>>my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>>                             -file => $file,
>>>>>                             -debug => 'on');
>>>>>
>>>>>my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>>
>>>>>After I run this script I get the following errors:
>>>>>
>>>>>Useless use of hash element in void context at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>>
>>>>>Argument "-trimopt" isn't numeric in numeric eq (==) at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>>
>>>>>Pseudo-hashes are deprecated at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>>
>>>>>Use of uninitialized value in string ne at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>>
>>>>>Pseudo-hashes are deprecated at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>>
>>>>>Can't locate object method "add_tag_value" via package 
>>>>>"Bio::SeqFeature::Generic" at 
>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>>
>>>>>I'm not sure what I am missing?
>>>>>
>>>>>Thanks so much,
>>>>>Annie.
>>>>>       
>>>>>
>>>>>          
>>>>>
>>>>     
>>>>
>>>>        
>>>>
>>>   
>>>
>>>      
>>>
>
>  
>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From mingyi.liu at gpc-biotech.com  Wed Jun  8 16:44:30 2005
From: mingyi.liu at gpc-biotech.com (Mingyi Liu)
Date: Wed Jun  8 16:36:28 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A758AE.70304@gpc-biotech.com>

Hi,

Stefan's right in suggesting you turn off -w, which would make your 
script work.  But thanks for finding this bug.  I just noticed that 
entrezgene.pm was actually calling the Bio::ASN1::EntrezGene->next_seq 
incorrectly (probably my documentation was a bit confusing & my module 
did not follow standard hash-based parameter passing of subroutines).  
It should be called like ->next_seq(1), but entrezgene.pm called using 
->next_seq(-trimopt => 1).  This worked for all of us who do not use -w, 
as it would fall back to option '1' in my next_seq function (exactly as 
Stefan's calling function wanted).  Therefore this bug went unnoticed 
until you turned on -w (I guess we were all spoiled by the easy (and 
sometimes messy) life of weak datatyping in Perl).

Stefan would you please change the calling of next_seq to next_seq(1)?  
This would fix the error messages Annie was seeing.

Thanks,

Mingyi

From skirov at utk.edu  Wed Jun  8 16:50:05 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Jun  8 16:41:54 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A758AE.70304@gpc-biotech.com>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
	<42A758AE.70304@gpc-biotech.com>
Message-ID: <42A759FD.7000504@utk.edu>

Sure. Thanks for letting me know.
Annie, does it work for you now?
Stefan

Mingyi Liu wrote:

> Hi,
>
> Stefan's right in suggesting you turn off -w, which would make your 
> script work.  But thanks for finding this bug.  I just noticed that 
> entrezgene.pm was actually calling the Bio::ASN1::EntrezGene->next_seq 
> incorrectly (probably my documentation was a bit confusing & my module 
> did not follow standard hash-based parameter passing of subroutines).  
> It should be called like ->next_seq(1), but entrezgene.pm called using 
> ->next_seq(-trimopt => 1).  This worked for all of us who do not use 
> -w, as it would fall back to option '1' in my next_seq function 
> (exactly as Stefan's calling function wanted).  Therefore this bug 
> went unnoticed until you turned on -w (I guess we were all spoiled by 
> the easy (and sometimes messy) life of weak datatyping in Perl).
>
> Stefan would you please change the calling of next_seq to 
> next_seq(1)?  This would fix the error messages Annie was seeing.
>
> Thanks,
>
> Mingyi
>

From hlapp at gmx.net  Wed Jun  8 22:28:47 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed Jun  8 22:21:43 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <7f77f6e5803451c7236755c5550e1023@gmx.net>

Quite frankly, mixing versions in bioperl has never worked really well 
and nobody really has time to support this, so I don't think it's good 
advice to people to suggest plugging in single modules from a recent 
version into an older one. Just update to current cvs and you should be 
at a state where at least you're not totally on your own.

As for the output, these are obviously warnings, and instead of asking 
you to turn off -w (L.Wall: Known bugs: -w is not on by default.) 
Stefan and Mingyi should fix whatever is needed to silence those 
warnings. (No offense please)

	-hilmar

On Jun 8, 2005, at 11:40 PM, Law, Annie wrote:

> Hi,
>
> I went to bioperl-live and copied the newest entrezgene.pm and 
> Bio::AnnotatableI, Bio::SeqFeatureI modules and
> I got the following output (same output with entrezgene.pm saved on 
> May 11 as well).  The complaint about the module
> Generic.pm is gone now.
> I am using EntrezGene V 1.09 picked up from CPAN.
>
> I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 
> directory and install EntrezGene V.1.07 but that is not supposed to 
> make a difference?
> Here's a wild stab but are the additional messages related to a 
> statement I read somewhere about the first record being empty?
>
> Is my next alternative to install Bioperl 1.5 and try again? If so, am 
> I correct in thinking that to 'uninstall' there is no such
> Uninstall command but I would just delete the 
> /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
> Use CPAN to install bioperl 1.5
>
> Thanks so much,
> Annie.
>
>
> Argument "-trimopt" isn't numeric in numeric eq (==) at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
> Pseudo-hashes are deprecated at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
> Use of uninitialized value in substitution (s///) at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
> Use of uninitialized value in substitution (s///) at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
> Pseudo-hashes are deprecated at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
> Use of uninitialized value in string eq at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>
>
> -----Original Message-----
> From: Stefan Kirov [mailto:skirov@utk.edu]
> Sent: Tuesday, June 07, 2005 8:39 PM
> To: Mingyi Liu
> Cc: Law, Annie; Bioperl list
> Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
> I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
> code (actually the underlying modules I mentioned...).
> Thanks for the -file option... There are also some leftover commenst 
> :-)
> . I need to clean the code a bit...
> Stefan
>
> Mingyi Liu wrote:
>
>> Hi, Annie
>>
>> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>> fine with your entrezgene.pm in bioperl-live at least a couple days
>> ago, when I replied to Annie.  V1.09 also did not have any significant
>> changes in parser code vs. 1.07.
>>
>> I guess it has something to do with V1.4 since the sample script you
>> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The
>> procedure you used was also correct (there's no need to 'use
>> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first
>> (although I don't quite understand why Bio::ASN1::EntrezGene
>> complained about non numerica operon, which can only result from
>> incorrect calling of the function.  But Stefan's entrezgene was using
>> correct calling and it runs perfectly for me.  I was using
>> entrezgene.pm CVS version 1.9.
>>
>> Keep us posted on your progress.
>>
>> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>> (bioperl style) or 'file' (I allowed both when I implemented this
>> switch I think. I usually just use file, which might explain your note
>> in the comment in your script.  I just noticed the comment.
>>
>> Mingyi
>>
>> Stefan Kirov wrote:
>>
>>> Hi Annie,
>>> Few more things to update:
>>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>> your script does not work. Update also Bio::SeqIO::entrezegene- I
>>> added some fixed so you will not see those nasty warning when using
>>> strict (nothing critical though).
>>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I
>>> have 1.0.7. Where did you get it from (maybe mine is older)?
>>> Stefan
>>>
>>> Law, Annie wrote:
>>>
>>>> Hi,
>>>>
>>>> Thanks for all of the replies.
>>>> I am using bioperl 1.4 and I have done the following:
>>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>> make test, make install)
>>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in
>>>> the Bio/SeqIO directory
>>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in
>>>> the corresponding directory
>>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene
>>>> modules
>>>>
>>>> I grabbed the ASN file from
>>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>
>>>> I then wrote a simple perl script which includes:
>>>>
>>>> #!/usr/bin/perl -w
>>>>
>>>> use strict;
>>>> use Bio::ASN1::EntrezGene;
>>>> use Bio::SeqIO;
>>>> use Bio::Annotation::DBLink;
>>>> use Bio::Cluster::SequenceFamily;
>>>>
>>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>>
>>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>                               -file => $file,
>>>>                               -debug => 'on');
>>>>
>>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>
>>>> After I run this script I get the following errors:
>>>>
>>>> Useless use of hash element in void context at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>
>>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>
>>>> Pseudo-hashes are deprecated at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>
>>>> Use of uninitialized value in string ne at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>
>>>> Pseudo-hashes are deprecated at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>
>>>> Can't locate object method "add_tag_value" via package
>>>> "Bio::SeqFeature::Generic" at
>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>
>>>> I'm not sure what I am missing?
>>>>
>>>> Thanks so much,
>>>> Annie.
>>>
>>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From skirov at utk.edu  Wed Jun  8 23:01:11 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Wed Jun  8 22:53:17 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <7f77f6e5803451c7236755c5550e1023@gmx.net>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
	<7f77f6e5803451c7236755c5550e1023@gmx.net>
Message-ID: <42A7B0F7.6020107@utk.edu>

Hilmar Lapp wrote:

> Quite frankly, mixing versions in bioperl has never worked really well 
> and nobody really has time to support this, so I don't think it's good 
> advice to people to suggest plugging in single modules from a recent 
> version into an older one. Just update to current cvs and you should 
> be at a state where at least you're not totally on your own.

Agree, but there may be a need for a transitional period. Annie, why do 
you need bioperl 1.4? Is there something that lacks backcompatibility? I 
think in general most modules try to provide such...

>
> As for the output, these are obviously warnings, and instead of asking 
> you to turn off -w (L.Wall: Known bugs: -w is not on by default.) 
> Stefan and Mingyi should fix whatever is needed to silence those 
> warnings. (No offense please)

None taken. But this is not even a developer's release and I believe 
such bugs are usual and normal (as long as they are not there for ever). 
I am creating tests and I will fix the warnings when I commit these, but 
I believe there are no deadlines I am missing. Please correct me if I am 
wrong and I can probably spend some more time fixing the warnings 
produced by entrezgene parser.
Overall I don't believe it is a bad idea for people to explore 
particular code without strict (provided this does not go into 
production). That's why the term 'unstable'  exists, does it not?
Stefan

>
>     -hilmar
>
> On Jun 8, 2005, at 11:40 PM, Law, Annie wrote:
>
>> Hi,
>>
>> I went to bioperl-live and copied the newest entrezgene.pm and 
>> Bio::AnnotatableI, Bio::SeqFeatureI modules and
>> I got the following output (same output with entrezgene.pm saved on 
>> May 11 as well).  The complaint about the module
>> Generic.pm is gone now.
>> I am using EntrezGene V 1.09 picked up from CPAN.
>>
>> I'm not sure what is wrong.  I guess I could delete the Bio/ASN1 
>> directory and install EntrezGene V.1.07 but that is not supposed to 
>> make a difference?
>> Here's a wild stab but are the additional messages related to a 
>> statement I read somewhere about the first record being empty?
>>
>> Is my next alternative to install Bioperl 1.5 and try again? If so, 
>> am I correct in thinking that to 'uninstall' there is no such
>> Uninstall command but I would just delete the 
>> /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>> Use CPAN to install bioperl 1.5
>>
>> Thanks so much,
>> Annie.
>>
>>
>> Argument "-trimopt" isn't numeric in numeric eq (==) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Pseudo-hashes are deprecated at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>> Use of uninitialized value in string eq at 
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>>
>>
>> -----Original Message-----
>> From: Stefan Kirov [mailto:skirov@utk.edu]
>> Sent: Tuesday, June 07, 2005 8:39 PM
>> To: Mingyi Liu
>> Cc: Law, Annie; Bioperl list
>> Subject: Re: [Bioperl-l] Entrez Gene parser questions
>>
>>
>> I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>> code (actually the underlying modules I mentioned...).
>> Thanks for the -file option... There are also some leftover commenst :-)
>> . I need to clean the code a bit...
>> Stefan
>>
>> Mingyi Liu wrote:
>>
>>> Hi, Annie
>>>
>>> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>>> fine with your entrezgene.pm in bioperl-live at least a couple days
>>> ago, when I replied to Annie.  V1.09 also did not have any significant
>>> changes in parser code vs. 1.07.
>>>
>>> I guess it has something to do with V1.4 since the sample script you
>>> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The
>>> procedure you used was also correct (there's no need to 'use
>>> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first
>>> (although I don't quite understand why Bio::ASN1::EntrezGene
>>> complained about non numerica operon, which can only result from
>>> incorrect calling of the function.  But Stefan's entrezgene was using
>>> correct calling and it runs perfectly for me.  I was using
>>> entrezgene.pm CVS version 1.9.
>>>
>>> Keep us posted on your progress.
>>>
>>> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>>> (bioperl style) or 'file' (I allowed both when I implemented this
>>> switch I think. I usually just use file, which might explain your note
>>> in the comment in your script.  I just noticed the comment.
>>>
>>> Mingyi
>>>
>>> Stefan Kirov wrote:
>>>
>>>> Hi Annie,
>>>> Few more things to update:
>>>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>>> your script does not work. Update also Bio::SeqIO::entrezegene- I
>>>> added some fixed so you will not see those nasty warning when using
>>>> strict (nothing critical though).
>>>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I
>>>> have 1.0.7. Where did you get it from (maybe mine is older)?
>>>> Stefan
>>>>
>>>> Law, Annie wrote:
>>>>
>>>>> Hi,
>>>>>
>>>>> Thanks for all of the replies.
>>>>> I am using bioperl 1.4 and I have done the following:
>>>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>>> make test, make install)
>>>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in
>>>>> the Bio/SeqIO directory
>>>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in
>>>>> the corresponding directory
>>>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene
>>>>> modules
>>>>>
>>>>> I grabbed the ASN file from
>>>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>>
>>>>> I then wrote a simple perl script which includes:
>>>>>
>>>>> #!/usr/bin/perl -w
>>>>>
>>>>> use strict;
>>>>> use Bio::ASN1::EntrezGene;
>>>>> use Bio::SeqIO;
>>>>> use Bio::Annotation::DBLink;
>>>>> use Bio::Cluster::SequenceFamily;
>>>>>
>>>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>>>
>>>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>>                               -file => $file,
>>>>>                               -debug => 'on');
>>>>>
>>>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>>
>>>>> After I run this script I get the following errors:
>>>>>
>>>>> Useless use of hash element in void context at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>>
>>>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>>
>>>>> Pseudo-hashes are deprecated at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>>
>>>>> Use of uninitialized value in string ne at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>>
>>>>> Pseudo-hashes are deprecated at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>>
>>>>> Can't locate object method "add_tag_value" via package
>>>>> "Bio::SeqFeature::Generic" at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>>
>>>>> I'm not sure what I am missing?
>>>>>
>>>>> Thanks so much,
>>>>> Annie.
>>>>
>>>>
>>>>
>>>
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>

From hlapp at gmx.net  Wed Jun  8 23:28:25 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed Jun  8 23:20:51 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A7B0F7.6020107@utk.edu>
References: <10C94843061E094A98C02EB77CFC328722FF4B@nrcmrdex1d.imsb.nrc.ca>
	<7f77f6e5803451c7236755c5550e1023@gmx.net>
	<42A7B0F7.6020107@utk.edu>
Message-ID: <2c1d295d825d53b71de8eec964defea2@gmx.net>


On Jun 9, 2005, at 11:01 AM, Stefan Kirov wrote:

>> As for the output, these are obviously warnings, and instead of 
>> asking you to turn off -w (L.Wall: Known bugs: -w is not on by 
>> default.) Stefan and Mingyi should fix whatever is needed to silence 
>> those warnings. (No offense please)
>
> None taken. But this is not even a developer's release and I believe 
> such bugs are usual and normal (as long as they are not there for 
> ever). I am creating tests and I will fix the warnings when I commit 
> these, but I believe there are no deadlines I am missing. Please 
> correct me if I am wrong and I can probably spend some more time 
> fixing the warnings produced by entrezgene parser.
> Overall I don't believe it is a bad idea for people to explore 
> particular code without strict (provided this does not go into 
> production). That's why the term 'unstable'  exists, does it not?
>

Sure - I haven't said you should fix it ASAP or should have fixed it 
already, have I? Developers who are annoyed can BTW fix it themselves 
:-) the thing is just not everybody is a  developer in this regard.

	-hilmar
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Wed Jun  8 23:46:10 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Wed Jun  8 23:38:05 2005
Subject: [Bioperl-l] Error loading sequence with load_seqdatabase.pl
In-Reply-To: <20050609033924.11682.qmail@web40708.mail.yahoo.com>
References: <20050609033924.11682.qmail@web40708.mail.yahoo.com>
Message-ID: <7c10e9211ba9b2d13026002a5e1f4390@gmx.net>

I've never heard about Rocks Cluster as an OS ... 2GB seem plenty; even 
if you db is on the same machine it shouldn't be a problem (unless 
you've most of the memory to Pg's shared pool). You need to use a 
monitoring tool like 'top' to see where your resources go and whether 
something exhausts the memory.

If you write a simple script that creates a simple dummy table and 
inserts 1 million random rows, does that raise any problem? (Like, 
accumulates memory or even crashes too?)

	-hilmar

On Jun 9, 2005, at 11:39 AM, Duangdaow Kanhasiri wrote:

> The
>
> OS: Rocks Cluster v 3.3
> Total Memory: 2 GB
> DBD::Pg version: 1.42
> DBI version: 1.48
>
>
> --- Hilmar Lapp <hlapp@gmx.net> wrote:
>
>> What OS are you running this on? How much memory
>> have you got on the
>> machine on which you run the script, and on the
>> machine on which you
>> run the database? Are these the same or not? Which
>> version of DBI and
>> DBD::Pg?
>>
>> This hasn't been reported by anyone else really so I
>> suspect it's
>> either due to too limited memory, or a problem in
>> the DBD driver or in
>> the DBI compiled code. Can you watch the process
>> (using, e.g., top) and
>> see how fast it increases in memory consumption?
>> Since you can continue
>> when you restart it's not something specific to one
>> sequence that would
>> trigger the problem; rather it appears whenever you
>> have run through a
>> certain number of entries the process dies.
>>
>> 	-hilmar
>>
>> On Jun 8, 2005, at 7:43 PM, Duangdaow Kanhasiri
>> wrote:
>>
>>> Hi,
>>>
>>> I've used the bioperl script load_seqdatabase.pl
>> (came
>>> with the biosql' scripts) to load the bacterial
>>> sequence in genbank format(*.gbk) into PostgreSQL
>> 8.0
>>> database on Linux machine as:
>>>
>>> $perl load_seqdatabase.pl /export/Bacteria/*/*.gbk
>> &
>>>
>>> Where  under the /export/Bacteria/ path are the
>>> Bacteria's name path e.g. Acinetobacter_sp_ADP1
>> and
>>> the file name are like NC_006824.gbk.
>>>
>>> Previously it used to load some sequences in to
>> some
>>> tables in biosql database (count from table
>> bioentry)
>>>
>>> bioseq=# select count(*) from bioentry;
>>>  count
>>> -------
>>>    33
>>> (1 row)
>>>
>>>
>>> However, after a while it then stopped with the
>> the
>>> error:
>>>
>>> [1]+  Segmentation fault      perl
>> load_seqdatabase.pl
>>> /export/Bacteria/*/*.gbk &
>>>
>>> I then checked and removed the *.gbk file that
>> have
>>> already been loaded in to the table, leaving only
>> the
>>> unloaded ones and ran the scripted again.  It
>>> continued to work for some times and stopped
>> again.  I
>>> repeated the process several times until 173
>> sequences
>>> were loaded into the table:
>>>
>>> bioseq=# select count(*) from bioentry;
>>>  count
>>> -------
>>>    173
>>> (1 row)
>>>
>>> The program then stopped again and this time it
>>> wouldn't run anymore even I tried with only on
>> file.
>>> The error is still the same like:
>>>
>>> $ perl load_seqdatabase.pl
>>>
>>
> /export/Bacteria/Lactobacillus_johnsonii_NCC_533/NC_005362.gbk
>>> Segmentation fault
>>> $
>>>
>>> Now I couldn't load the rest of my sequences into
>> the
>>> database anymore.  I would be very apprecialed if
>> any
>>> one knows how to solve the "Segmentation fault"
>>> problem?
>>>
>>> Regards,
>>>
>>> Davina
>>>
>>>
>>> 		
>>> __________________________________
>>> Discover Yahoo!
>>> Have fun online with music videos, cool games, IM
>> and more. Check it
>>> out!
>>> http://discover.yahoo.com/
>>>
>>
> online.html<load_seqdatabase.pl>_______________________________________
>>
>>> ________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>>
>>
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> -- 
>>
> -------------------------------------------------------------
>> Hilmar Lapp                            email: lapp
>> at gnf.org
>> GNF, San Diego, Ca. 92121              phone:
>> +1-858-812-1757
>>
> -------------------------------------------------------------
>>
>>
>>
>
>
>
> 		
> __________________________________
> Discover Yahoo!
> Get on-the-go sports scores, stock quotes, news and more. Check it out!
> http://discover.yahoo.com/mobile.html
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Thu Jun  9 02:15:14 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun  9 02:12:02 2005
Subject: [Bioperl-l] Error loading sequence with load_seqdatabase.pl
In-Reply-To: <20050609035557.45275.qmail@web40727.mail.yahoo.com>
References: <20050609035557.45275.qmail@web40727.mail.yahoo.com>
Message-ID: <a2067db83d80b980748e1931869b1ed1@gmx.net>

First off, I wouldn't continue this thread on biosql-l, it's for schema 
questions and this clearly isn't one. The script is a perl/bioperl 
script and some people on the bioperl-l list may happen to be on a 
platform similar to yours.

Second, you're saying now the script wouldn't run at all anymore? With 
what error message? You might try to supply --debug as an option if the 
script does at least something before it dies. The output will be 
potentially extensive so be sure to capture in a file, then send it me.

If the script dies immediately I'm afraid I can't do anything. My gut 
feeling is that there is something with your compiler, C runtime 
library, or DBI/DBD compiled code that doesn't play well with your 
perl. Did you do a binary install of perl or did you compile it from 
source?

Really your best bet is to find someone who's on the same or a similar 
platform and see whether he/she has had similar problems or none of 
these.

	-hilmar

On Jun 9, 2005, at 11:55 AM, Duangdaow Kanhasiri wrote:

> The system I use hase following configs:
>
> CPU:               2 @ AthlonXP2000
> OS:                Rocks Cluster v 3.3
> Total Memory:      2 GB
> DBD::Pg version:   1.42
> DBI version:       1.48
>
> I've attached the out put of the top command (top.txt)
> with this mail.  Unfortunately that the script
> load_seqdatabase.pl wouldn't run anymore, no matter
> how many time I tried running it, therefore, I
> couldn't measure how much it consumes the resource
> (cpu, memory) on the machine.
>
> Regards,
>
> Davina
>
>
> --- Hilmar Lapp <hlapp@gmx.net> wrote:
>
>> What OS are you running this on? How much memory
>> have you got on the
>> machine on which you run the script, and on the
>> machine on which you
>> run the database? Are these the same or not? Which
>> version of DBI and
>> DBD::Pg?
>>
>> This hasn't been reported by anyone else really so I
>> suspect it's
>> either due to too limited memory, or a problem in
>> the DBD driver or in
>> the DBI compiled code. Can you watch the process
>> (using, e.g., top) and
>> see how fast it increases in memory consumption?
>> Since you can continue
>> when you restart it's not something specific to one
>> sequence that would
>> trigger the problem; rather it appears whenever you
>> have run through a
>> certain number of entries the process dies.
>>
>> 	-hilmar
>>
>> On Jun 8, 2005, at 7:43 PM, Duangdaow Kanhasiri
>> wrote:
>>
>>> Hi,
>>>
>>> I've used the bioperl script load_seqdatabase.pl
>> (came
>>> with the biosql' scripts) to load the bacterial
>>> sequence in genbank format(*.gbk) into PostgreSQL
>> 8.0
>>> database on Linux machine as:
>>>
>>> $perl load_seqdatabase.pl /export/Bacteria/*/*.gbk
>> &
>>>
>>> Where  under the /export/Bacteria/ path are the
>>> Bacteria's name path e.g. Acinetobacter_sp_ADP1
>> and
>>> the file name are like NC_006824.gbk.
>>>
>>> Previously it used to load some sequences in to
>> some
>>> tables in biosql database (count from table
>> bioentry)
>>>
>>> bioseq=# select count(*) from bioentry;
>>>  count
>>> -------
>>>    33
>>> (1 row)
>>>
>>>
>>> However, after a while it then stopped with the
>> the
>>> error:
>>>
>>> [1]+  Segmentation fault      perl
>> load_seqdatabase.pl
>>> /export/Bacteria/*/*.gbk &
>>>
>>> I then checked and removed the *.gbk file that
>> have
>>> already been loaded in to the table, leaving only
>> the
>>> unloaded ones and ran the scripted again.  It
>>> continued to work for some times and stopped
>> again.  I
>>> repeated the process several times until 173
>> sequences
>>> were loaded into the table:
>>>
>>> bioseq=# select count(*) from bioentry;
>>>  count
>>> -------
>>>    173
>>> (1 row)
>>>
>>> The program then stopped again and this time it
>>> wouldn't run anymore even I tried with only on
>> file.
>>> The error is still the same like:
>>>
>>> $ perl load_seqdatabase.pl
>>>
>>
> /export/Bacteria/Lactobacillus_johnsonii_NCC_533/NC_005362.gbk
>>> Segmentation fault
>>> $
>>>
>>> Now I couldn't load the rest of my sequences into
>> the
>>> database anymore.  I would be very apprecialed if
>> any
>>> one knows how to solve the "Segmentation fault"
>>> problem?
>>>
>>> Regards,
>>>
>>> Davina
>>>
>>>
>>> 		
>>> __________________________________
>>> Discover Yahoo!
>>> Have fun online with music videos, cool games, IM
>> and more. Check it
>>> out!
>>> http://discover.yahoo.com/
>>>
>>
> online.html<load_seqdatabase.pl>_______________________________________
>>
>>> ________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>>
>>
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> -- 
>>
> -------------------------------------------------------------
>> Hilmar Lapp                            email: lapp
>> at gnf.org
>> GNF, San Diego, Ca. 92121              phone:
>> +1-858-812-1757
>>
> -------------------------------------------------------------
>>
>>
>>
>
>
> 		
> __________________________________
> Discover Yahoo!
> Get on-the-go sports scores, stock quotes, news and more. Check it out!
> http://discover.yahoo.com/mobile.html[root@biogenome root]# top
> 10:31:14  up 27 days, 21:20,  5 users,  load average: 0.00, 0.02, 0.03
> 193 processes: 192 sleeping, 1 running, 0 zombie, 0 stopped
> CPU states:  cpu    user    nice  system    irq  softirq  iowait    
> idle
>            total    1.8%    0.0%    0.0%   0.0%     0.0%    0.0%  
> 198.0%
>            cpu00    1.9%    0.0%    0.0%   0.0%     0.0%    0.0%   
> 98.0%
>            cpu01    0.0%    0.0%    0.0%   0.0%     0.0%    0.0%  
> 100.0%
> Mem:  2057220k av, 1556640k used,  500580k free,       0k shrd,  
> 167096k buff
>                    1101048k actv,  266692k in_d,   39936k in_c
> Swap: 4192956k av,   91620k used, 4101336k free                 
> 1196752k cached
>
>   PID USER     PRI  NI  SIZE  RSS SHARE STAT %CPU %MEM   TIME CPU 
> COMMAND
> 16683 root      23   0  1288 1288   844 R     1.9  0.0   0:00   0 top
>     1 root      15   0   520  516   456 S     0.0  0.0   0:29   0 init
>     2 root      RT   0     0    0     0 SW    0.0  0.0   0:00   0 
> migration/0
>     3 root      RT   0     0    0     0 SW    0.0  0.0   0:00   1 
> migration/1
>     4 root      15   0     0    0     0 SW    0.0  0.0   0:00   1 
> keventd
>     5 root      34  19     0    0     0 SWN   0.0  0.0   0:00   0 
> ksoftirqd/0
>     6 root      34  19     0    0     0 SWN   0.0  0.0   0:00   1 
> ksoftirqd/1
>     9 root      15   0     0    0     0 SW    0.0  0.0   0:00   0 
> bdflush
>     7 root      15   0     0    0     0 SW    0.0  0.0   0:37   0 
> kswapd
>     8 root      15   0     0    0     0 SW    0.0  0.0   0:24   0 
> kscand
>    10 root      15   0     0    0     0 SW    0.0  0.0   0:19   0 
> kupdated
>    11 root      25   0     0    0     0 SW    0.0  0.0   0:00   0 
> mdrecoveryd
>    17 root      25   0     0    0     0 SW    0.0  0.0   0:00   1 
> scsi_eh_0
>    18 root      25   0     0    0     0 SW    0.0  0.0   0:00   1 
> aacraid
>    20 root      25   0     0    0     0 SW    0.0  0.0   0:00   1 
> scsi_eh_0
>    23 root      15   0     0    0     0 SW    0.0  0.0   1:29   1 
> kjournald
>    70 root      25   0     0    0     0 SW    0.0  0.0   0:00   0 khubd
>  1165 root      15   0     0    0     0 SW    0.0  0.0   0:49   0 
> kjournald
>  1418 root      15   0     0    0     0 SW    0.0  0.0   0:00   1 eth0
>  1543 root      15   0   620  608   524 S     0.0  0.0   0:59   0 
> syslogd
>  1547 root      15   0   484  424   420 S     0.0  0.0   0:00   0 klogd
>  1557 root      15   0   456  448   392 S     0.0  0.0   2:04   0 
> irqbalance
>  1565 rpc       15   0   572  548   500 S     0.0  0.0   0:00   0 
> portmap
>  1584 rpcuser   25   0   716  632   628 S     0.0  0.0   0:00   1 
> rpc.statd
>  1595 root      15   0   404  388   344 S     0.0  0.0   0:06   0 mdadm
>  1619 root      RT   0   556  456   424 S     0.0  0.0   0:16   1 
> auditd
>  1629 nobody    15   0  1180 1016   724 S     0.0  0.0  24:57   1 
> gmetad
>  1658 root      15   0   472  424   400 S     0.0  0.0   0:01   0 pvfsd
>
>
> [root@biogenome DBD]# df -h
> Filesystem            Size  Used Avail Use% Mounted on
> /dev/sda1             5.8G  3.6G  1.9G  66% /
> /dev/sda3             125G   24G   95G  21% /export
> none                 1005M     0 1005M   0% /dev/shm
> tmpfs                 503M  3.5M  499M   1% /var/lib/ganglia/rrds
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From priesel at caesar.de  Thu Jun  9 03:19:31 2005
From: priesel at caesar.de (Saskia Priesel)
Date: Thu Jun  9 03:15:05 2005
Subject: [Bioperl-l] Parsing PDB Files
Message-ID: <42A7ED15.4010902@caesar.de>

Hello to all,

I want to parse the sequence from a PDB File. For this I found the
module Bio::Structure::Entry but I don't understand it. There only the
explanations of the methods but no synopsis.
I need help.
Who have an idea?

Regards, Saskia

From yuichiyoshi at gmail.com  Thu Jun  9 05:39:08 2005
From: yuichiyoshi at gmail.com (Yoshida Yuichi)
Date: Thu Jun  9 05:30:59 2005
Subject: [Bioperl-l] Problem in parsing GenBank flatfile
Message-ID: <f2507cb80506090239502f5d12@mail.gmail.com>

Dear all,

I am trying to parse GenBank flatfile (accession num is NT_015926) 
by calling Bio::SeqIO modules, but I can not.

- - - - - - - - - - - - - Perl program code - - - - - - - - - - - - -
#!/usr/bin/perl
use Bio::SeqIO;

$gbk_filename = shift @ARGV;
$seqin = Bio::SeqIO->new(-file=>$gbk_filename, -format=>'Genbank');

while ($seqobj = $seqin->next_seq) {
    $accession = $seqobj->accession_number,"\n";
    foreach my $feat ($seqobj->get_SeqFeatures()){
        if ($feat->primary_tag eq 'mRNA'){
            $db_gene_name = join(' ',$feat->get_tag_values('gene'));
            $db_transcript_id = join('
',$feat->get_tag_values('transcript_id'));
            $start = $feat->start; $end = $feat->end;
            print $db_transcript_id,"\t",$db_gene_name,"\t",$accession,"\t";
            print $start,"\t",$end,"\n";
        }
    }
}
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The following error message is shown.

- - - - - - - - - - - - - error message - - - - - - - - - - - - -
-------------------- WARNING ---------------------
MSG: cannot see new qualifier in feature CDS: aa:OTHER)
---------------------------------------------------

-------------------- WARNING ---------------------
MSG: cannot see new qualifier in feature CDS: aa:OTHER)
---------------------------------------------------

-------------------- WARNING ---------------------
MSG: cannot see new qualifier in feature CDS: aa:OTHER)
---------------------------------------------------
out of memory
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

The parts which cause the error (I guess) is shown as the followings.

- - - - - GenBank partial flatfile (NT_015926) - - - - -
     CDS             complement(join(4528741..4528932,4543408..4543490,
                     4581809..4582043,4616648..4616817,4632093..4632236,
                     4643148..4643301))
                     /gene="FLJ21820"
                     /note="go_function: catalytic activity [goid 0003824]
                     [evidence IEA];
                     go_process: lipid metabolism [goid 0006629] [evidence
                     IEA]"
                     /codon_start=1
                     /product="hypothetical protein FLJ21820"
                     /protein_id="NP_068744.1"
                     /db_xref="GI:11345458"
                     /db_xref="GeneID:60526"
                     /db_xref="LocusID:60526"
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

Would you please tell me the way to solve this problem?

--
Yuichi Yoshida <yuichiyoshi@gmail.com>

From priesel at caesar.de  Thu Jun  9 06:48:51 2005
From: priesel at caesar.de (Saskia Priesel)
Date: Thu Jun  9 06:45:11 2005
Subject: [Bioperl-l] Bioperl Module
Message-ID: <42A81E29.1030005@caesar.de>

Hi,

who can explain me explicitly the bioperl Module Bio::Structure::Entry.
I need it for parsing the sequence from 30000 PDB Files.
I want to analyse the sequence after length, metal ions and cysteine.

best regards, Saskia

From brian_osborne at cognia.com  Thu Jun  9 07:51:09 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Jun  9 07:43:29 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <7f77f6e5803451c7236755c5550e1023@gmx.net>
Message-ID: <BECDA56D.18EC%brian_osborne@cognia.com>

Bioperl,

> Stefan and Mingyi should fix whatever is needed to silence those
> warnings. (No offense please)

Yes, I should support Hilmar here. When we are working through the full test
suite before a formal release our goal has always been to eliminate all
errors *and* warnings, not just  errors.

Brian O.


On 6/8/05 10:28 PM, "Hilmar Lapp" <hlapp@gmx.net> wrote:

> Quite frankly, mixing versions in bioperl has never worked really well
> and nobody really has time to support this, so I don't think it's good
> advice to people to suggest plugging in single modules from a recent
> version into an older one. Just update to current cvs and you should be
> at a state where at least you're not totally on your own.
> 
> As for the output, these are obviously warnings, and instead of asking
> you to turn off -w (L.Wall: Known bugs: -w is not on by default.)
> Stefan and Mingyi should fix whatever is needed to silence those
> warnings. (No offense please)
> 
> -hilmar
> 
> On Jun 8, 2005, at 11:40 PM, Law, Annie wrote:
> 
>> Hi,
>> 
>> I went to bioperl-live and copied the newest entrezgene.pm and
>> Bio::AnnotatableI, Bio::SeqFeatureI modules and
>> I got the following output (same output with entrezgene.pm saved on
>> May 11 as well).  The complaint about the module
>> Generic.pm is gone now.
>> I am using EntrezGene V 1.09 picked up from CPAN.
>> 
>> I'm not sure what is wrong.  I guess I could delete the Bio/ASN1
>> directory and install EntrezGene V.1.07 but that is not supposed to
>> make a difference?
>> Here's a wild stab but are the additional messages related to a
>> statement I read somewhere about the first record being empty?
>> 
>> Is my next alternative to install Bioperl 1.5 and try again? If so, am
>> I correct in thinking that to 'uninstall' there is no such
>> Uninstall command but I would just delete the
>> /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>> Use CPAN to install bioperl 1.5
>> 
>> Thanks so much,
>> Annie.
>> 
>> 
>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>> Pseudo-hashes are deprecated at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>> Use of uninitialized value in substitution (s///) at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>> Pseudo-hashes are deprecated at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>> Use of uninitialized value in string eq at
>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>> 
>> 
>> -----Original Message-----
>> From: Stefan Kirov [mailto:skirov@utk.edu]
>> Sent: Tuesday, June 07, 2005 8:39 PM
>> To: Mingyi Liu
>> Cc: Law, Annie; Bioperl list
>> Subject: Re: [Bioperl-l] Entrez Gene parser questions
>> 
>> 
>> I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>> code (actually the underlying modules I mentioned...).
>> Thanks for the -file option... There are also some leftover commenst
>> :-)
>> . I need to clean the code a bit...
>> Stefan
>> 
>> Mingyi Liu wrote:
>> 
>>> Hi, Annie
>>> 
>>> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>>> fine with your entrezgene.pm in bioperl-live at least a couple days
>>> ago, when I replied to Annie.  V1.09 also did not have any significant
>>> changes in parser code vs. 1.07.
>>> 
>>> I guess it has something to do with V1.4 since the sample script you
>>> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The
>>> procedure you used was also correct (there's no need to 'use
>>> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first
>>> (although I don't quite understand why Bio::ASN1::EntrezGene
>>> complained about non numerica operon, which can only result from
>>> incorrect calling of the function.  But Stefan's entrezgene was using
>>> correct calling and it runs perfectly for me.  I was using
>>> entrezgene.pm CVS version 1.9.
>>> 
>>> Keep us posted on your progress.
>>> 
>>> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>>> (bioperl style) or 'file' (I allowed both when I implemented this
>>> switch I think. I usually just use file, which might explain your note
>>> in the comment in your script.  I just noticed the comment.
>>> 
>>> Mingyi
>>> 
>>> Stefan Kirov wrote:
>>> 
>>>> Hi Annie,
>>>> Few more things to update:
>>>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>>> your script does not work. Update also Bio::SeqIO::entrezegene- I
>>>> added some fixed so you will not see those nasty warning when using
>>>> strict (nothing critical though).
>>>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I
>>>> have 1.0.7. Where did you get it from (maybe mine is older)?
>>>> Stefan
>>>> 
>>>> Law, Annie wrote:
>>>> 
>>>>> Hi,
>>>>> 
>>>>> Thanks for all of the replies.
>>>>> I am using bioperl 1.4 and I have done the following:
>>>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>>> make test, make install)
>>>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in
>>>>> the Bio/SeqIO directory
>>>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in
>>>>> the corresponding directory
>>>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene
>>>>> modules
>>>>> 
>>>>> I grabbed the ASN file from
>>>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>> 
>>>>> I then wrote a simple perl script which includes:
>>>>> 
>>>>> #!/usr/bin/perl -w
>>>>> 
>>>>> use strict;
>>>>> use Bio::ASN1::EntrezGene;
>>>>> use Bio::SeqIO;
>>>>> use Bio::Annotation::DBLink;
>>>>> use Bio::Cluster::SequenceFamily;
>>>>> 
>>>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>>> 
>>>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>>                               -file => $file,
>>>>>                               -debug => 'on');
>>>>> 
>>>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>> 
>>>>> After I run this script I get the following errors:
>>>>> 
>>>>> Useless use of hash element in void context at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>> 
>>>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>> 
>>>>> Pseudo-hashes are deprecated at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>> 
>>>>> Use of uninitialized value in string ne at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>> 
>>>>> Pseudo-hashes are deprecated at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>> 
>>>>> Can't locate object method "add_tag_value" via package
>>>>> "Bio::SeqFeature::Generic" at
>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>> 
>>>>> I'm not sure what I am missing?
>>>>> 
>>>>> Thanks so much,
>>>>> Annie.
>>>> 
>>>> 
>>> 
>>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 


From brian_osborne at cognia.com  Thu Jun  9 07:53:44 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Jun  9 07:46:19 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A7B0F7.6020107@utk.edu>
Message-ID: <BECDA608.18ED%brian_osborne@cognia.com>

Stefan,

Of course you're right. There are no deadlines and your efforts in this
regard are very much appreciated, by all.

Brian O.


On 6/8/05 11:01 PM, "Stefan Kirov" <skirov@utk.edu> wrote:

> Hilmar Lapp wrote:
> 
>> Quite frankly, mixing versions in bioperl has never worked really well
>> and nobody really has time to support this, so I don't think it's good
>> advice to people to suggest plugging in single modules from a recent
>> version into an older one. Just update to current cvs and you should
>> be at a state where at least you're not totally on your own.
> 
> Agree, but there may be a need for a transitional period. Annie, why do
> you need bioperl 1.4? Is there something that lacks backcompatibility? I
> think in general most modules try to provide such...
> 
>> 
>> As for the output, these are obviously warnings, and instead of asking
>> you to turn off -w (L.Wall: Known bugs: -w is not on by default.)
>> Stefan and Mingyi should fix whatever is needed to silence those
>> warnings. (No offense please)
> 
> None taken. But this is not even a developer's release and I believe
> such bugs are usual and normal (as long as they are not there for ever).
> I am creating tests and I will fix the warnings when I commit these, but
> I believe there are no deadlines I am missing. Please correct me if I am
> wrong and I can probably spend some more time fixing the warnings
> produced by entrezgene parser.
> Overall I don't believe it is a bad idea for people to explore
> particular code without strict (provided this does not go into
> production). That's why the term 'unstable'  exists, does it not?
> Stefan
> 
>> 
>>     -hilmar
>> 
>> On Jun 8, 2005, at 11:40 PM, Law, Annie wrote:
>> 
>>> Hi,
>>> 
>>> I went to bioperl-live and copied the newest entrezgene.pm and
>>> Bio::AnnotatableI, Bio::SeqFeatureI modules and
>>> I got the following output (same output with entrezgene.pm saved on
>>> May 11 as well).  The complaint about the module
>>> Generic.pm is gone now.
>>> I am using EntrezGene V 1.09 picked up from CPAN.
>>> 
>>> I'm not sure what is wrong.  I guess I could delete the Bio/ASN1
>>> directory and install EntrezGene V.1.07 but that is not supposed to
>>> make a difference?
>>> Here's a wild stab but are the additional messages related to a
>>> statement I read somewhere about the first record being empty?
>>> 
>>> Is my next alternative to install Bioperl 1.5 and try again? If so,
>>> am I correct in thinking that to 'uninstall' there is no such
>>> Uninstall command but I would just delete the
>>> /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>>> Use CPAN to install bioperl 1.5
>>> 
>>> Thanks so much,
>>> Annie.
>>> 
>>> 
>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>> Pseudo-hashes are deprecated at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>>> Use of uninitialized value in substitution (s///) at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>>> Use of uninitialized value in substitution (s///) at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>>> Pseudo-hashes are deprecated at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>>> Use of uninitialized value in string eq at
>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>>> 
>>> 
>>> -----Original Message-----
>>> From: Stefan Kirov [mailto:skirov@utk.edu]
>>> Sent: Tuesday, June 07, 2005 8:39 PM
>>> To: Mingyi Liu
>>> Cc: Law, Annie; Bioperl list
>>> Subject: Re: [Bioperl-l] Entrez Gene parser questions
>>> 
>>> 
>>> I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>>> code (actually the underlying modules I mentioned...).
>>> Thanks for the -file option... There are also some leftover commenst :-)
>>> . I need to clean the code a bit...
>>> Stefan
>>> 
>>> Mingyi Liu wrote:
>>> 
>>>> Hi, Annie
>>>> 
>>>> Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>>>> fine with your entrezgene.pm in bioperl-live at least a couple days
>>>> ago, when I replied to Annie.  V1.09 also did not have any significant
>>>> changes in parser code vs. 1.07.
>>>> 
>>>> I guess it has something to do with V1.4 since the sample script you
>>>> used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The
>>>> procedure you used was also correct (there's no need to 'use
>>>> Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first
>>>> (although I don't quite understand why Bio::ASN1::EntrezGene
>>>> complained about non numerica operon, which can only result from
>>>> incorrect calling of the function.  But Stefan's entrezgene was using
>>>> correct calling and it runs perfectly for me.  I was using
>>>> entrezgene.pm CVS version 1.9.
>>>> 
>>>> Keep us posted on your progress.
>>>> 
>>>> BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>>>> (bioperl style) or 'file' (I allowed both when I implemented this
>>>> switch I think. I usually just use file, which might explain your note
>>>> in the comment in your script.  I just noticed the comment.
>>>> 
>>>> Mingyi
>>>> 
>>>> Stefan Kirov wrote:
>>>> 
>>>>> Hi Annie,
>>>>> Few more things to update:
>>>>> Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>>>> your script does not work. Update also Bio::SeqIO::entrezegene- I
>>>>> added some fixed so you will not see those nasty warning when using
>>>>> strict (nothing critical though).
>>>>> I am not sure we have the same versions for Bio::ASN1::EntrezGene. I
>>>>> have 1.0.7. Where did you get it from (maybe mine is older)?
>>>>> Stefan
>>>>> 
>>>>> Law, Annie wrote:
>>>>> 
>>>>>> Hi,
>>>>>> 
>>>>>> Thanks for all of the replies.
>>>>>> I am using bioperl 1.4 and I have done the following:
>>>>>> 1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>>>> make test, make install)
>>>>>> 2. got a copy of the entrezgene.pm from bioperl-live and put it in
>>>>>> the Bio/SeqIO directory
>>>>>> 3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in
>>>>>> the corresponding directory
>>>>>> 4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>>> 5. also have all the most recent bioperl-live Bio::SeqFeature::Gene
>>>>>> modules
>>>>>> 
>>>>>> I grabbed the ASN file from
>>>>>> ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>>> 
>>>>>> I then wrote a simple perl script which includes:
>>>>>> 
>>>>>> #!/usr/bin/perl -w
>>>>>> 
>>>>>> use strict;
>>>>>> use Bio::ASN1::EntrezGene;
>>>>>> use Bio::SeqIO;
>>>>>> use Bio::Annotation::DBLink;
>>>>>> use Bio::Cluster::SequenceFamily;
>>>>>> 
>>>>>> my $file = '/var/lib/mysql/Homo_sapiens';
>>>>>> 
>>>>>> my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>>>                               -file => $file,
>>>>>>                               -debug => 'on');
>>>>>> 
>>>>>> my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>>> 
>>>>>> After I run this script I get the following errors:
>>>>>> 
>>>>>> Useless use of hash element in void context at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>>> 
>>>>>> Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>>> 
>>>>>> Pseudo-hashes are deprecated at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>>> 
>>>>>> Use of uninitialized value in string ne at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>>> 
>>>>>> Pseudo-hashes are deprecated at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>>> 
>>>>>> Can't locate object method "add_tag_value" via package
>>>>>> "Bio::SeqFeature::Generic" at
>>>>>> /usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>>> 
>>>>>> I'm not sure what I am missing?
>>>>>> 
>>>>>> Thanks so much,
>>>>>> Annie.
>>>>> 
>>>>> 
>>>>> 
>>>> 
>>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From skirov at utk.edu  Thu Jun  9 08:02:26 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun  9 07:54:28 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <BECDA56D.18EC%brian_osborne@cognia.com>
References: <BECDA56D.18EC%brian_osborne@cognia.com>
Message-ID: <42A82FD2.7030908@utk.edu>

Brian,
I also agree on that, but I don't think there is a formal release coming 
soon, is there? Really, when is the next relase due?
Stefan

Brian Osborne wrote:

>Bioperl,
>
>  
>
>>Stefan and Mingyi should fix whatever is needed to silence those
>>warnings. (No offense please)
>>    
>>
>
>Yes, I should support Hilmar here. When we are working through the full test
>suite before a formal release our goal has always been to eliminate all
>errors *and* warnings, not just  errors.
>
>Brian O.
>
>
>On 6/8/05 10:28 PM, "Hilmar Lapp" <hlapp@gmx.net> wrote:
>
>  
>
>>Quite frankly, mixing versions in bioperl has never worked really well
>>and nobody really has time to support this, so I don't think it's good
>>advice to people to suggest plugging in single modules from a recent
>>version into an older one. Just update to current cvs and you should be
>>at a state where at least you're not totally on your own.
>>
>>As for the output, these are obviously warnings, and instead of asking
>>you to turn off -w (L.Wall: Known bugs: -w is not on by default.)
>>Stefan and Mingyi should fix whatever is needed to silence those
>>warnings. (No offense please)
>>
>>-hilmar
>>
>>On Jun 8, 2005, at 11:40 PM, Law, Annie wrote:
>>
>>    
>>
>>>Hi,
>>>
>>>I went to bioperl-live and copied the newest entrezgene.pm and
>>>Bio::AnnotatableI, Bio::SeqFeatureI modules and
>>>I got the following output (same output with entrezgene.pm saved on
>>>May 11 as well).  The complaint about the module
>>>Generic.pm is gone now.
>>>I am using EntrezGene V 1.09 picked up from CPAN.
>>>
>>>I'm not sure what is wrong.  I guess I could delete the Bio/ASN1
>>>directory and install EntrezGene V.1.07 but that is not supposed to
>>>make a difference?
>>>Here's a wild stab but are the additional messages related to a
>>>statement I read somewhere about the first record being empty?
>>>
>>>Is my next alternative to install Bioperl 1.5 and try again? If so, am
>>>I correct in thinking that to 'uninstall' there is no such
>>>Uninstall command but I would just delete the
>>>/usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then
>>>Use CPAN to install bioperl 1.5
>>>
>>>Thanks so much,
>>>Annie.
>>>
>>>
>>>Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>Pseudo-hashes are deprecated at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 543.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>>>Use of uninitialized value in substitution (s///) at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 554.
>>>Use of uninitialized value in substitution (s///) at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 555.
>>>Pseudo-hashes are deprecated at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 604.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 295.
>>>Use of uninitialized value in string eq at
>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 323.
>>>
>>>
>>>-----Original Message-----
>>>From: Stefan Kirov [mailto:skirov@utk.edu]
>>>Sent: Tuesday, June 07, 2005 8:39 PM
>>>To: Mingyi Liu
>>>Cc: Law, Annie; Bioperl list
>>>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>>>
>>>
>>>I am pretty sure it is the old Bio::SeqFeature::Generic that breaks the
>>>code (actually the underlying modules I mentioned...).
>>>Thanks for the -file option... There are also some leftover commenst
>>>:-)
>>>. I need to clean the code a bit...
>>>Stefan
>>>
>>>Mingyi Liu wrote:
>>>
>>>      
>>>
>>>>Hi, Annie
>>>>
>>>>Annie must've been using the Bio::ASN1::EntrezGene V1.09, which worked
>>>>fine with your entrezgene.pm in bioperl-live at least a couple days
>>>>ago, when I replied to Annie.  V1.09 also did not have any significant
>>>>changes in parser code vs. 1.07.
>>>>
>>>>I guess it has something to do with V1.4 since the sample script you
>>>>used below runs perfectly fine on my Bioperl 1.5 + entrezgene.pm.  The
>>>>procedure you used was also correct (there's no need to 'use
>>>>Bio::ASN1::EntrezGene;' though).  Try follow Stefan's suggestion first
>>>>(although I don't quite understand why Bio::ASN1::EntrezGene
>>>>complained about non numerica operon, which can only result from
>>>>incorrect calling of the function.  But Stefan's entrezgene was using
>>>>correct calling and it runs perfectly for me.  I was using
>>>>entrezgene.pm CVS version 1.9.
>>>>
>>>>Keep us posted on your progress.
>>>>
>>>>BTW, Stefan, you could call Bio::ASN1::EntrezGene with either '-file'
>>>>(bioperl style) or 'file' (I allowed both when I implemented this
>>>>switch I think. I usually just use file, which might explain your note
>>>>in the comment in your script.  I just noticed the comment.
>>>>
>>>>Mingyi
>>>>
>>>>Stefan Kirov wrote:
>>>>
>>>>        
>>>>
>>>>>Hi Annie,
>>>>>Few more things to update:
>>>>>Bio::AnnotatableI and Bio::SeqFeatureI.  I believe this is the reason
>>>>>your script does not work. Update also Bio::SeqIO::entrezegene- I
>>>>>added some fixed so you will not see those nasty warning when using
>>>>>strict (nothing critical though).
>>>>>I am not sure we have the same versions for Bio::ASN1::EntrezGene. I
>>>>>have 1.0.7. Where did you get it from (maybe mine is older)?
>>>>>Stefan
>>>>>
>>>>>Law, Annie wrote:
>>>>>
>>>>>          
>>>>>
>>>>>>Hi,
>>>>>>
>>>>>>Thanks for all of the replies.
>>>>>>I am using bioperl 1.4 and I have done the following:
>>>>>>1. installed  Bio::ASN1::EnztrezGene (using perl Makefile.PL, make,
>>>>>>make test, make install)
>>>>>>2. got a copy of the entrezgene.pm from bioperl-live and put it in
>>>>>>the Bio/SeqIO directory
>>>>>>3. copied the Bio::Annotation::DBLink DBLink.pm file and put them in
>>>>>>the corresponding directory
>>>>>>4. the Bio::Cluster::SequenceFamily file was already up to date
>>>>>>5. also have all the most recent bioperl-live Bio::SeqFeature::Gene
>>>>>>modules
>>>>>>
>>>>>>I grabbed the ASN file from
>>>>>>ftp://ftp.ncbi.nlm.nih.gov/gene/DATA/ASN/Mammalia/
>>>>>>
>>>>>>I then wrote a simple perl script which includes:
>>>>>>
>>>>>>#!/usr/bin/perl -w
>>>>>>
>>>>>>use strict;
>>>>>>use Bio::ASN1::EntrezGene;
>>>>>>use Bio::SeqIO;
>>>>>>use Bio::Annotation::DBLink;
>>>>>>use Bio::Cluster::SequenceFamily;
>>>>>>
>>>>>>my $file = '/var/lib/mysql/Homo_sapiens';
>>>>>>
>>>>>>my $seqio = Bio::SeqIO->new(-format => 'entrezgene',
>>>>>>                              -file => $file,
>>>>>>                              -debug => 'on');
>>>>>>
>>>>>>my ($gene,$genestructure,$uncaptured) = $seqio->next_seq;
>>>>>>
>>>>>>After I run this script I get the following errors:
>>>>>>
>>>>>>Useless use of hash element in void context at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 317.
>>>>>>
>>>>>>Argument "-trimopt" isn't numeric in numeric eq (==) at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/ASN1/EntrezGene.pm line 450.
>>>>>>
>>>>>>Pseudo-hashes are deprecated at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 148.
>>>>>>
>>>>>>Use of uninitialized value in string ne at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 150.
>>>>>>
>>>>>>Pseudo-hashes are deprecated at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqIO/entrezgene.pm line 416.
>>>>>>
>>>>>>Can't locate object method "add_tag_value" via package
>>>>>>"Bio::SeqFeature::Generic" at
>>>>>>/usr/lib/perl5/site_perl/5.8.0/Bio/SeqFeature/Generic.pm line 234.
>>>>>>
>>>>>>I'm not sure what I am missing?
>>>>>>
>>>>>>Thanks so much,
>>>>>>Annie.
>>>>>>            
>>>>>>
>>>>>          
>>>>>
>>>>        
>>>>
>>>_______________________________________________
>>>Bioperl-l mailing list
>>>Bioperl-l@portal.open-bio.org
>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>      
>>>
>
>
>  
>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From mingyi.liu at gpc-biotech.com  Thu Jun  9 09:55:56 2005
From: mingyi.liu at gpc-biotech.com (Mingyi Liu)
Date: Thu Jun  9 09:47:52 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <BECDA56D.18EC%brian_osborne@cognia.com>
References: <BECDA56D.18EC%brian_osborne@cognia.com>
Message-ID: <42A84A6C.4000509@gpc-biotech.com>

Brian Osborne wrote:

>Bioperl,
>
>  
>
>>Stefan and Mingyi should fix whatever is needed to silence those
>>warnings. (No offense please)
>>    
>>
>
>Yes, I should support Hilmar here. When we are working through the full test
>suite before a formal release our goal has always been to eliminate all
>errors *and* warnings, not just  errors.
>
>Brian O.
>
>  
>
Hi, Brian & Hilmar,

I think both of you misunderstood (or missed part of) the previous email 
exchanges between Stefan and me and jumped to conclusion too soon.  In 
my previous email, it began with "Stefan's right in suggesting you turn 
off -w, which would make your script work.", which likely led to your 
worries.  But that's totally unnecessary - this is just a temporary 
solution suggested to end user.  It is not a suggestion that we will not 
fix it or end user should change their programming habit.

In fact, if you please read on, in the latter part of the same message, 
I suggested a fix that would fix the problem end user saw, which Stefan 
immediately responded that he'd incorporate it.  I'm sure Stefan would 
get rid of those annoying "use of unitialized value" warnings too.  
That's the long term solution we proposed and (to be) implemented to fix 
the issue raised by end user.  So truly there's no reason to worry or 
take sides here.  We don't really have a difference in our user support 
approaches, despite our apparent different attitudes towards the 
importance of '-w' switch. :)

Mingyi

From cjm at fruitfly.org  Thu Jun  9 14:45:48 2005
From: cjm at fruitfly.org (Chris Mungall)
Date: Thu Jun  9 14:38:00 2005
Subject: [Bioperl-l] Bio::RangeI::union
Message-ID: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>


The pod docs for union() state that this is is valid:

  my $newrange = Bio::RangeI->union(@ranges);

In the subroutine body, this gets called:

  my $self = shift;
  ...
  $self->new(...)

Since $self is equal to the string "Bio::RangeI", rather than an object
implementing this interface, this will result in a call to

  Bio::Root::RootI->new("Bio::RangeI",...)

This works fine in bp1.4, but in recent bioperl revisions this results in
a warning message that Bio::Root::RootI->new is deprecated, and a
delegation to Bio::Root::Root, **omitting the name of the class to be
created**, thus creating a Bio::Root::Root object, which is useless and
will inevitably break any code calling the union() method.

I think this delegation is completely wrong, and should be removed, and
the warning message switched to an error; OR it should be undeprecated and
the original behaviour behaviour restored

If we decide that RootI->new is truly deprecated, then Bio::RangeI should
have to do some $self examination, and use the correct object
instantiation method, rather than $self->new. I don't really know what the
correct object instantiation method is - perhaps just Bio::Range->new()?
Or should a factory be used?

Personally, I would prefer it if Bio::RootI->new were undeprecated and the
original behaviour restored. deprecating would make perfect sense if
bioperl interfaces really were interfaces, which they are not.

Cheers
Chris

From Annie.Law at nrc-cnrc.gc.ca  Thu Jun  9 14:57:40 2005
From: Annie.Law at nrc-cnrc.gc.ca (Law, Annie)
Date: Thu Jun  9 14:49:47 2005
Subject: [Bioperl-l] Entrez Gene parser questions
Message-ID: <10C94843061E094A98C02EB77CFC328722FF4E@nrcmrdex1d.imsb.nrc.ca>

Hi,

Thanks for everybody's responses.  Yes, if I turn off the warnings then the scripts works. I was sticking with bioperl 1.4 because I think I read somewhere that the even extensions are the stable ones and Also I was happy with how 1.4 was working for me (and it seems that 1.4 works okay with the Entrez gene parser now) but if it is unadvised to plug in new modules to an older version then I will look into installing Bioperl 1.5.  It seems to be fine for a lot of people :)

Just some questions about getting rid of bioperl 1.4.  Am I correct in thinking that to 'uninstall' there is no such Uninstall command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then Use CPAN to install bioperl 1.5

I am running my simple script and some print statements and it takes about 10 minutes to print 2000 Entrez gene Ids.  How long does it generally take the parser to finish for example the Homo sapiens file? My real goal is not just to print but I just wanted to do a test run.  Is this about the same performance others are getting or are there some other options to speed it up?

Thanks again for all of your efforts!
Annie.


-----Original Message-----
From: Stefan Kirov [mailto:skirov@utk.edu] 
Sent: Wednesday, June 08, 2005 4:50 PM
To: Mingyi Liu
Cc: Law, Annie; Bioperl list
Subject: Re: [Bioperl-l] Entrez Gene parser questions


Sure. Thanks for letting me know.
Annie, does it work for you now?
Stefan

Mingyi Liu wrote:

> Hi,
>
> Stefan's right in suggesting you turn off -w, which would make your 
> script work.  But thanks for finding this bug.  I just noticed that 
> entrezgene.pm was actually calling the Bio::ASN1::EntrezGene->next_seq 
> incorrectly (probably my documentation was a bit confusing & my module 
> did not follow standard hash-based parameter passing of subroutines).
> It should be called like ->next_seq(1), but entrezgene.pm called using 
> ->next_seq(-trimopt => 1).  This worked for all of us who do not use
> -w, as it would fall back to option '1' in my next_seq function 
> (exactly as Stefan's calling function wanted).  Therefore this bug 
> went unnoticed until you turned on -w (I guess we were all spoiled by 
> the easy (and sometimes messy) life of weak datatyping in Perl).
>
> Stefan would you please change the calling of next_seq to next_seq(1)?  
> This would fix the error messages Annie was seeing.
>
> Thanks,
>
> Mingyi
>
From skirov at utk.edu  Thu Jun  9 15:08:31 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun  9 15:00:19 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4E@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4E@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A893AF.7030508@utk.edu>

It is slow- there is a lot of data and it goes into many bioperl 
objects. Performance is not the idea of this parser. If you need really 
high performance you may want to stick to the flat files.
One suggestion is to get rid of the debug option (it won't make big 
difference, but still...). The whole human file takes about an hour on 
my machine, depends what you have to do the analysis. Also i
Oh, by the way you need bioperl-live, not 1.5. No need for uninstall- 
just install bioperl-live, it should overwrite the old stuff.
Stefan

Law, Annie wrote:

>Hi,
>
>Thanks for everybody's responses.  Yes, if I turn off the warnings then the scripts works. I was sticking with bioperl 1.4 because I think I read somewhere that the even extensions are the stable ones and Also I was happy with how 1.4 was working for me (and it seems that 1.4 works okay with the Entrez gene parser now) but if it is unadvised to plug in new modules to an older version then I will look into installing Bioperl 1.5.  It seems to be fine for a lot of people :)
>
>Just some questions about getting rid of bioperl 1.4.  Am I correct in thinking that to 'uninstall' there is no such Uninstall command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then Use CPAN to install bioperl 1.5
>
>I am running my simple script and some print statements and it takes about 10 minutes to print 2000 Entrez gene Ids.  How long does it generally take the parser to finish for example the Homo sapiens file? My real goal is not just to print but I just wanted to do a test run.  Is this about the same performance others are getting or are there some other options to speed it up?
>
>Thanks again for all of your efforts!
>Annie.
>
>
>-----Original Message-----
>From: Stefan Kirov [mailto:skirov@utk.edu] 
>Sent: Wednesday, June 08, 2005 4:50 PM
>To: Mingyi Liu
>Cc: Law, Annie; Bioperl list
>Subject: Re: [Bioperl-l] Entrez Gene parser questions
>
>
>Sure. Thanks for letting me know.
>Annie, does it work for you now?
>Stefan
>
>Mingyi Liu wrote:
>
>  
>
>>Hi,
>>
>>Stefan's right in suggesting you turn off -w, which would make your 
>>script work.  But thanks for finding this bug.  I just noticed that 
>>entrezgene.pm was actually calling the Bio::ASN1::EntrezGene->next_seq 
>>incorrectly (probably my documentation was a bit confusing & my module 
>>did not follow standard hash-based parameter passing of subroutines).
>>It should be called like ->next_seq(1), but entrezgene.pm called using 
>>->next_seq(-trimopt => 1).  This worked for all of us who do not use
>>-w, as it would fall back to option '1' in my next_seq function 
>>(exactly as Stefan's calling function wanted).  Therefore this bug 
>>went unnoticed until you turned on -w (I guess we were all spoiled by 
>>the easy (and sometimes messy) life of weak datatyping in Perl).
>>
>>Stefan would you please change the calling of next_seq to next_seq(1)?  
>>This would fix the error messages Annie was seeing.
>>
>>Thanks,
>>
>>Mingyi
>>
>>    
>>

From mingyi.liu at gpc-biotech.com  Thu Jun  9 15:11:19 2005
From: mingyi.liu at gpc-biotech.com (Mingyi Liu)
Date: Thu Jun  9 15:04:32 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <10C94843061E094A98C02EB77CFC328722FF4E@nrcmrdex1d.imsb.nrc.ca>
References: <10C94843061E094A98C02EB77CFC328722FF4E@nrcmrdex1d.imsb.nrc.ca>
Message-ID: <42A89457.1000102@gpc-biotech.com>

Law, Annie wrote:

>Just some questions about getting rid of bioperl 1.4.  Am I correct in thinking that to 'uninstall' there is no such Uninstall command but I would just delete the /usr/lib/perl5/site_perl/5.8.0/Bio  ie. The Bio directory and then Use CPAN to install bioperl 1.5
>
>  
>
AFAIK, bioperl installer does not support uninstall.  So just delete the 
directory containing the modules and install 1.5 should work for you.

>I am running my simple script and some print statements and it takes about 10 minutes to print 2000 Entrez gene Ids.  How long does it generally take the parser to finish for example the Homo sapiens file? My real goal is not just to print but I just wanted to do a test run.  Is this about the same performance others are getting or are there some other options to speed it up?
>  
>
That sounds exceedingly slow.  What type of machine are you using?  
Using Bio::ASN1::EntrezGene version 1.09 on my Intel Xeon 2.4 GHz 
machine it takes about 17 minutes to process all human records (~145000 
records).  Stefan had stated that Bio::SeqIO::entrezgene.pm is about 4 
fold slower after all the bioperl object initiations etc., so it should 
translate to 20,000+ records for 10 minutes.  If the genes you processed 
are all of 'live' status, then the speed would be slower since they have 
more content on average, but 2000 for 10 minutes still sounds slow.  
There might be some thing in your script that can be improved or scripts 
just run slowly on your machine?  Or the genes you selected on averge 
have much more content than other overall human records.

BTW, just got Stefan's mail which confirmed the speed stats above.

Mingyi

From amackey at pcbi.upenn.edu  Thu Jun  9 15:39:37 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Thu Jun  9 15:31:55 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
Message-ID: <2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>

Or, how about deprecating the Bio::RangeI->union() construct (since  
although we've supplied implementations in interface, we don't need  
to encourage people to use them)?  This is just a weird way to do  
$newrange = Bio::Range->union(@ranges), right? (which saves a whole  
capitalized keystroke!)

-Aaron

On Jun 9, 2005, at 2:45 PM, Chris Mungall wrote:

>
> The pod docs for union() state that this is is valid:
>
>   my $newrange = Bio::RangeI->union(@ranges);
>
> In the subroutine body, this gets called:
>
>   my $self = shift;
>   ...
>   $self->new(...)
>
> Since $self is equal to the string "Bio::RangeI", rather than an  
> object
> implementing this interface, this will result in a call to
>
>   Bio::Root::RootI->new("Bio::RangeI",...)
>
> This works fine in bp1.4, but in recent bioperl revisions this  
> results in
> a warning message that Bio::Root::RootI->new is deprecated, and a
> delegation to Bio::Root::Root, **omitting the name of the class to be
> created**, thus creating a Bio::Root::Root object, which is useless  
> and
> will inevitably break any code calling the union() method.
>
> I think this delegation is completely wrong, and should be removed,  
> and
> the warning message switched to an error; OR it should be  
> undeprecated and
> the original behaviour behaviour restored
>
> If we decide that RootI->new is truly deprecated, then Bio::RangeI  
> should
> have to do some $self examination, and use the correct object
> instantiation method, rather than $self->new. I don't really know  
> what the
> correct object instantiation method is - perhaps just Bio::Range- 
> >new()?
> Or should a factory be used?
>
> Personally, I would prefer it if Bio::RootI->new were undeprecated  
> and the
> original behaviour restored. deprecating would make perfect sense if
> bioperl interfaces really were interfaces, which they are not.
>
> Cheers
> Chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205
fax:    215-746-6697
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017

From jeremy_just at netcourrier.com  Thu Jun  9 08:58:59 2005
From: jeremy_just at netcourrier.com (=?ISO-8859-15?Q?J=E9r=E9my?= JUST)
Date: Thu Jun  9 18:06:45 2005
Subject: [Bioperl-l] Putative bug in Bio/SearchIO/blast.pm
Message-ID: <20050609145859.0000248d@pearson.infobiogen.fr>


    Hello,

  I think I've found a little bug in the Blast parser.
  On that Blast result (BLASTN 2.2.9 [May-01-2004]):

<<<<<<
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|42592260|ref|NC_003070.5| Arabidopsis thaliana chromosome 1, ...  75.8   8e-13

>gi|42592260|ref|NC_003070.5| Arabidopsis thaliana chromosome 1, complete
                sequence
          Length = 30432563

 Score = 75.8 bits (38), Expect = 8e-13
 Identities = 104/126 (82%)
 Strand = Plus / Minus
>>>>>>

the score is read as ? 8 ? instead of ? 75.8 ?.



  I attach a tiny patch against Bioperl-1.5.0.
($Id: blast.pm,v 1.84 2004/10/28 20:40:12 jason Exp $)


  Cheers.


-- 
J?r?my JUST  <jeremy_just@netcourrier.com>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: blast_score_format.diff
Type: application/octet-stream
Size: 663 bytes
Desc: not available
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20050609/9c1e4f60/blast_score_format.obj
From hlapp at gmx.net  Thu Jun  9 20:55:17 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun  9 20:47:12 2005
Subject: [Bioperl-l] Entrez Gene parser questions
In-Reply-To: <42A84A6C.4000509@gpc-biotech.com>
References: <BECDA56D.18EC%brian_osborne@cognia.com>
	<42A84A6C.4000509@gpc-biotech.com>
Message-ID: <43ab7b9c98ed5009ae49de43798dd1fb@gmx.net>

Guys, don't over-inflate this. I said no offense intended, Stefan said 
none taken, so why don't we discontinue this thread and you guys just 
fix it at some point. OK?

	-hilmar

On Jun 9, 2005, at 9:55 PM, Mingyi Liu wrote:

> Brian Osborne wrote:
>
>> Bioperl,
>>
>>
>>> Stefan and Mingyi should fix whatever is needed to silence those
>>> warnings. (No offense please)
>>>
>>
>> Yes, I should support Hilmar here. When we are working through the 
>> full test
>> suite before a formal release our goal has always been to eliminate 
>> all
>> errors *and* warnings, not just  errors.
>>
>> Brian O.
>>
>>
> Hi, Brian & Hilmar,
>
> I think both of you misunderstood (or missed part of) the previous 
> email exchanges between Stefan and me and jumped to conclusion too 
> soon.  In my previous email, it began with "Stefan's right in 
> suggesting you turn off -w, which would make your script work.", which 
> likely led to your worries.  But that's totally unnecessary - this is 
> just a temporary solution suggested to end user.  It is not a 
> suggestion that we will not fix it or end user should change their 
> programming habit.
>
> In fact, if you please read on, in the latter part of the same 
> message, I suggested a fix that would fix the problem end user saw, 
> which Stefan immediately responded that he'd incorporate it.  I'm sure 
> Stefan would get rid of those annoying "use of unitialized value" 
> warnings too.  That's the long term solution we proposed and (to be) 
> implemented to fix the issue raised by end user.  So truly there's no 
> reason to worry or take sides here.  We don't really have a difference 
> in our user support approaches, despite our apparent different 
> attitudes towards the importance of '-w' switch. :)
>
> Mingyi
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From skirov at utk.edu  Thu Jun  9 21:30:54 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun  9 21:24:01 2005
Subject: [Bioperl-l] Entrez Gene parser questions and next release??
In-Reply-To: <43ab7b9c98ed5009ae49de43798dd1fb@gmx.net>
References: <BECDA56D.18EC%brian_osborne@cognia.com>
	<42A84A6C.4000509@gpc-biotech.com>
	<43ab7b9c98ed5009ae49de43798dd1fb@gmx.net>
Message-ID: <42A8ED4E.4010300@utk.edu>



Hilmar Lapp wrote:

> Guys, don't over-inflate this. I said no offense intended, Stefan said 
> none taken, so why don't we discontinue this thread and you guys just 
> fix it at some point. OK?

Yup :-) . But I really want to know when the next release is going to 
happen. Some of my code is a mess right now, I have few additional 
parsers done I have not tested well yet... So if it is going to happen 
soon I am in trouble. I know there was some discussion about this in the 
recent past, but please help a lazy guy out here and let me know...
Stefan

>
>     -hilmar
>
> On Jun 9, 2005, at 9:55 PM, Mingyi Liu wrote:
>
>> Brian Osborne wrote:
>>
>>> Bioperl,
>>>
>>>
>>>> Stefan and Mingyi should fix whatever is needed to silence those
>>>> warnings. (No offense please)
>>>>
>>>
>>> Yes, I should support Hilmar here. When we are working through the 
>>> full test
>>> suite before a formal release our goal has always been to eliminate all
>>> errors *and* warnings, not just  errors.
>>>
>>> Brian O.
>>>
>>>
>> Hi, Brian & Hilmar,
>>
>> I think both of you misunderstood (or missed part of) the previous 
>> email exchanges between Stefan and me and jumped to conclusion too 
>> soon.  In my previous email, it began with "Stefan's right in 
>> suggesting you turn off -w, which would make your script work.", 
>> which likely led to your worries.  But that's totally unnecessary - 
>> this is just a temporary solution suggested to end user.  It is not a 
>> suggestion that we will not fix it or end user should change their 
>> programming habit.
>>
>> In fact, if you please read on, in the latter part of the same 
>> message, I suggested a fix that would fix the problem end user saw, 
>> which Stefan immediately responded that he'd incorporate it.  I'm 
>> sure Stefan would get rid of those annoying "use of unitialized 
>> value" warnings too.  That's the long term solution we proposed and 
>> (to be) implemented to fix the issue raised by end user.  So truly 
>> there's no reason to worry or take sides here.  We don't really have 
>> a difference in our user support approaches, despite our apparent 
>> different attitudes towards the importance of '-w' switch. :)
>>
>> Mingyi
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From hlapp at gmx.net  Thu Jun  9 21:14:49 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun  9 22:13:59 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
Message-ID: <65b843706f46188c71430f1969a4effb@gmx.net>

Sounds good to me.

Interfaces may have decorating methods but we wanted to deprecate that 
interfaces are instantiated. So if RangeI tries to instantiate itself 
then that's not good; no decorating method on an interface should ever 
attempt to instantiate the interface.

	-hilmar

On Jun 10, 2005, at 3:39 AM, Aaron J. Mackey wrote:

> Or, how about deprecating the Bio::RangeI->union() construct (since 
> although we've supplied implementations in interface, we don't need to 
> encourage people to use them)?  This is just a weird way to do 
> $newrange = Bio::Range->union(@ranges), right? (which saves a whole 
> capitalized keystroke!)
>
> -Aaron
>
> On Jun 9, 2005, at 2:45 PM, Chris Mungall wrote:
>
>>
>> The pod docs for union() state that this is is valid:
>>
>>   my $newrange = Bio::RangeI->union(@ranges);
>>
>> In the subroutine body, this gets called:
>>
>>   my $self = shift;
>>   ...
>>   $self->new(...)
>>
>> Since $self is equal to the string "Bio::RangeI", rather than an 
>> object
>> implementing this interface, this will result in a call to
>>
>>   Bio::Root::RootI->new("Bio::RangeI",...)
>>
>> This works fine in bp1.4, but in recent bioperl revisions this 
>> results in
>> a warning message that Bio::Root::RootI->new is deprecated, and a
>> delegation to Bio::Root::Root, **omitting the name of the class to be
>> created**, thus creating a Bio::Root::Root object, which is useless 
>> and
>> will inevitably break any code calling the union() method.
>>
>> I think this delegation is completely wrong, and should be removed, 
>> and
>> the warning message switched to an error; OR it should be 
>> undeprecated and
>> the original behaviour behaviour restored
>>
>> If we decide that RootI->new is truly deprecated, then Bio::RangeI 
>> should
>> have to do some $self examination, and use the correct object
>> instantiation method, rather than $self->new. I don't really know 
>> what the
>> correct object instantiation method is - perhaps just 
>> Bio::Range->new()?
>> Or should a factory be used?
>>
>> Personally, I would prefer it if Bio::RootI->new were undeprecated 
>> and the
>> original behaviour restored. deprecating would make perfect sense if
>> bioperl interfaces really were interfaces, which they are not.
>>
>> Cheers
>> Chris
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>
> --
> Aaron J. Mackey, Ph.D.
> Project Manager, ApiDB Bioinformatics Resource Center
> Penn Genomics Institute, University of Pennsylvania
> email:  amackey@pcbi.upenn.edu
> office: 215-898-1205
> fax:    215-746-6697
> postal: Penn Genomics Institute
>         Goddard Labs 212
>         415 S. University Avenue
>         Philadelphia, PA  19104-6017
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Thu Jun  9 22:17:48 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun  9 22:16:41 2005
Subject: [Bioperl-l] release date when?
In-Reply-To: <42A8ED4E.4010300@utk.edu>
References: <BECDA56D.18EC%brian_osborne@cognia.com>
	<42A84A6C.4000509@gpc-biotech.com>
	<43ab7b9c98ed5009ae49de43798dd1fb@gmx.net>
	<42A8ED4E.4010300@utk.edu>
Message-ID: <c31f033d5f0369922c8f4939cac687ed@gmx.net>

Aside from some tests failing on some platforms and a variety of 
modules emitting an excessive amount of perl-triggered warning 
messages, the last agreed upon consensus was to write up a couple of 
tests that verify that the traditional SeqFeatureI interface behaviour 
is maintained. Doing a stable release doesn't make much sense before 
that's taken place and the thereby identified problems have been ironed 
out because otherwise it'd suffer from the almost the same problems as 
1.5 has.

	-hilmar

On Jun 10, 2005, at 9:30 AM, Stefan Kirov wrote:

>
>
> Hilmar Lapp wrote:
>
>> Guys, don't over-inflate this. I said no offense intended, Stefan 
>> said none taken, so why don't we discontinue this thread and you guys 
>> just fix it at some point. OK?
>
> Yup :-) . But I really want to know when the next release is going to 
> happen. Some of my code is a mess right now, I have few additional 
> parsers done I have not tested well yet... So if it is going to happen 
> soon I am in trouble. I know there was some discussion about this in 
> the recent past, but please help a lazy guy out here and let me 
> know...
> Stefan
>
>>
>>     -hilmar
>>
>> On Jun 9, 2005, at 9:55 PM, Mingyi Liu wrote:
>>
>>> Brian Osborne wrote:
>>>
>>>> Bioperl,
>>>>
>>>>
>>>>> Stefan and Mingyi should fix whatever is needed to silence those
>>>>> warnings. (No offense please)
>>>>>
>>>>
>>>> Yes, I should support Hilmar here. When we are working through the 
>>>> full test
>>>> suite before a formal release our goal has always been to eliminate 
>>>> all
>>>> errors *and* warnings, not just  errors.
>>>>
>>>> Brian O.
>>>>
>>>>
>>> Hi, Brian & Hilmar,
>>>
>>> I think both of you misunderstood (or missed part of) the previous 
>>> email exchanges between Stefan and me and jumped to conclusion too 
>>> soon.  In my previous email, it began with "Stefan's right in 
>>> suggesting you turn off -w, which would make your script work.", 
>>> which likely led to your worries.  But that's totally unnecessary - 
>>> this is just a temporary solution suggested to end user.  It is not 
>>> a suggestion that we will not fix it or end user should change their 
>>> programming habit.
>>>
>>> In fact, if you please read on, in the latter part of the same 
>>> message, I suggested a fix that would fix the problem end user saw, 
>>> which Stefan immediately responded that he'd incorporate it.  I'm 
>>> sure Stefan would get rid of those annoying "use of unitialized 
>>> value" warnings too.  That's the long term solution we proposed and 
>>> (to be) implemented to fix the issue raised by end user.  So truly 
>>> there's no reason to worry or take sides here.  We don't really have 
>>> a difference in our user support approaches, despite our apparent 
>>> different attitudes towards the importance of '-w' switch. :)
>>>
>>> Mingyi
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>
> -- 
> Stefan Kirov, Ph.D.
> University of Tennessee/Oak Ridge National Laboratory
> 5700 bldg, PO BOX 2008 MS6164
> Oak Ridge TN 37831-6164
> USA
> tel +865 576 5120
> fax +865-576-5332
> e-mail: skirov@utk.edu
> sao@ornl.gov
>
> "And the wars go on with brainwashed pride
> For the love of God and our human rights
> And all these things are swept aside"
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From dbastar at yahoo.com  Fri Jun 10 00:32:42 2005
From: dbastar at yahoo.com (Duangdaow Kanhasiri)
Date: Fri Jun 10 00:25:07 2005
Subject: [Bioperl-l] Error loading sequence with load_seqdatabase.pl
In-Reply-To: <a2067db83d80b980748e1931869b1ed1@gmx.net>
Message-ID: <20050610043242.93697.qmail@web40711.mail.yahoo.com>

Thank you very much for your advice, Hilmar...

I've found that, after several times of restarting the
perl script load_seqdatabase.pl and it wouldn't run
any more with the error as: 

$perl load_seqdatabase.pl /export/Bacteria/*/*.gbk &
 [1]+  Segmentation fault      perl
load_seqdatabase.pl
 /export/Bacteria/*/*.gbk &


Finally I couldn't even run any perl command anymore
as:

$ perl --version
Segmentation fault

I've ask for help aroud here and someone told me that
the command I used might have loaded to many sequence
files names at one time that make it impossible for
the perl script load_seqdatabase.pl to handle.

I've done the work around for this problem by
re-booting the machine (in -order to make the perl
work again), and devided the genbank sequence files to
be loaded with the perl script load_seqdatabase.pl
into many small number of files and load them one
small chunk at a time.    

Now it started to run again and this time I'm praying
for it to continue working, if not, another pray is   
  that I could re-start it agin after it failed. 


Regards,

Davina


 

--- Hilmar Lapp <hlapp@gmx.net> wrote:

> First off, I wouldn't continue this thread on
> biosql-l, it's for schema 
> questions and this clearly isn't one. The script is
> a perl/bioperl 
> script and some people on the bioperl-l list may
> happen to be on a 
> platform similar to yours.
> 
> Second, you're saying now the script wouldn't run at
> all anymore? With 
> what error message? You might try to supply --debug
> as an option if the 
> script does at least something before it dies. The
> output will be 
> potentially extensive so be sure to capture in a
> file, then send it me.
> 
> If the script dies immediately I'm afraid I can't do
> anything. My gut 
> feeling is that there is something with your
> compiler, C runtime 
> library, or DBI/DBD compiled code that doesn't play
> well with your 
> perl. Did you do a binary install of perl or did you
> compile it from 
> source?
> 
> Really your best bet is to find someone who's on the
> same or a similar 
> platform and see whether he/she has had similar
> problems or none of 
> these.
> 
> 	-hilmar
> 
> On Jun 9, 2005, at 11:55 AM, Duangdaow Kanhasiri
> wrote:
> 
> > The system I use hase following configs:
> >
> > CPU:               2 @ AthlonXP2000
> > OS:                Rocks Cluster v 3.3
> > Total Memory:      2 GB
> > DBD::Pg version:   1.42
> > DBI version:       1.48
> >
> > I've attached the out put of the top command
> (top.txt)
> > with this mail.  Unfortunately that the script
> > load_seqdatabase.pl wouldn't run anymore, no
> matter
> > how many time I tried running it, therefore, I
> > couldn't measure how much it consumes the resource
> > (cpu, memory) on the machine.
> >
> > Regards,
> >
> > Davina
> >
> >
> > --- Hilmar Lapp <hlapp@gmx.net> wrote:
> >
> >> What OS are you running this on? How much memory
> >> have you got on the
> >> machine on which you run the script, and on the
> >> machine on which you
> >> run the database? Are these the same or not?
> Which
> >> version of DBI and
> >> DBD::Pg?
> >>
> >> This hasn't been reported by anyone else really
> so I
> >> suspect it's
> >> either due to too limited memory, or a problem in
> >> the DBD driver or in
> >> the DBI compiled code. Can you watch the process
> >> (using, e.g., top) and
> >> see how fast it increases in memory consumption?
> >> Since you can continue
> >> when you restart it's not something specific to
> one
> >> sequence that would
> >> trigger the problem; rather it appears whenever
> you
> >> have run through a
> >> certain number of entries the process dies.
> >>
> >> 	-hilmar
> >>
> >> On Jun 8, 2005, at 7:43 PM, Duangdaow Kanhasiri
> >> wrote:
> >>
> >>> Hi,
> >>>
> >>> I've used the bioperl script load_seqdatabase.pl
> >> (came
> >>> with the biosql' scripts) to load the bacterial
> >>> sequence in genbank format(*.gbk) into
> PostgreSQL
> >> 8.0
> >>> database on Linux machine as:
> >>>
> >>> $perl load_seqdatabase.pl
> /export/Bacteria/*/*.gbk
> >> &
> >>>
> >>> Where  under the /export/Bacteria/ path are the
> >>> Bacteria's name path e.g. Acinetobacter_sp_ADP1
> >> and
> >>> the file name are like NC_006824.gbk.
> >>>
> >>> Previously it used to load some sequences in to
> >> some
> >>> tables in biosql database (count from table
> >> bioentry)
> >>>
> >>> bioseq=# select count(*) from bioentry;
> >>>  count
> >>> -------
> >>>    33
> >>> (1 row)
> >>>
> >>>
> >>> However, after a while it then stopped with the
> >> the
> >>> error:
> >>>
> >>> [1]+  Segmentation fault      perl
> >> load_seqdatabase.pl
> >>> /export/Bacteria/*/*.gbk &
> >>>
> >>> I then checked and removed the *.gbk file that
> >> have
> >>> already been loaded in to the table, leaving
> only
> >> the
> >>> unloaded ones and ran the scripted again.  It
> >>> continued to work for some times and stopped
> >> again.  I
> >>> repeated the process several times until 173
> >> sequences
> >>> were loaded into the table:
> >>>
> >>> bioseq=# select count(*) from bioentry;
> >>>  count
> >>> -------
> >>>    173
> >>> (1 row)
> >>>
> >>> The program then stopped again and this time it
> >>> wouldn't run anymore even I tried with only on
> >> file.
> >>> The error is still the same like:
> >>>
> >>> $ perl load_seqdatabase.pl
> >>>
> >>
> >
>
/export/Bacteria/Lactobacillus_johnsonii_NCC_533/NC_005362.gbk
> >>> Segmentation fault
> >>> $
> >>>
> >>> Now I couldn't load the rest of my sequences
> into
> >> the
> >>> database anymore.  I would be very apprecialed
> if
> >> any
> >>> one knows how to solve the "Segmentation fault"
> >>> problem?
> >>>
> >>> Regards,
> >>>
> >>> Davina
> >>>
> >>>
> >>> 		
> >>> __________________________________
> >>> Discover Yahoo!
> >>> Have fun online with music videos, cool games,
> IM
> >> and more. Check it
> >>> out!
> >>> http://discover.yahoo.com/
> >>>
> >>
> >
>
online.html<load_seqdatabase.pl>_______________________________________
> >>
> >>> ________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>>
> >>
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >> -- 
> >>
> >
>
-------------------------------------------------------------
> 
=== message truncated ===



		
__________________________________ 
Discover Yahoo! 
Use Yahoo! to plan a weekend, have fun online and more. Check it out! 
http://discover.yahoo.com/
From chad at dieselwurks.com  Fri Jun 10 01:40:00 2005
From: chad at dieselwurks.com (Chad Matsalla)
Date: Fri Jun 10 01:31:58 2005
Subject: [Bioperl-l] genbank2gff and how do I use gff3 with Bio::DB::GFF?
Message-ID: <Pine.LNX.4.62.0506092334090.23634@sausage.usask.ca>



Greetings!

I have a genbank file that I would like to convert to GFF so that I can
view it in a GBrowse. I would also like to use the normal Bio::DB::GFF
(memory adaptor) interface to work with this data.

I took a genbank entry (in this case t/data/AE003644_Adh-genomic.gb) and
ran the bp_genbank2gff.pl program like this:
/usr/bin/bp_genbank2gff.pl --stdout --file
t/data/AE003644_Adh-genomic.gb > csm.gff3

Now, I want to get the segment represented by AE003644.

If this was gff2, I would successfully get that like this - I've chosen
the gffv2 file t/data/biodbgff/test.gff

my $db2 = Bio::DB::GFF->new( -adaptor => 'memory', -file => 't/data/biodbgff/test.gff' );
my $segment2 = $db2->segment(-name => 'Contig1');
my @features = $segment2->features();
print("There are this many features on Contig1 (".scalar(@features).")\n");

However, with gff3 I'm not able to get the segment. ($segment is undef)

Am I missing something? Can someone push me in the right direction?

I also want to use gff from genbank2gff in gbrowse - I can't seem to get
the thing to appear and I assume it's related to this. Is this an issue
with the reference class?
AE003644  Genbank   region    1    263309    .    .    .  ID=AE003644;Alias=AE002690,AE014134


Chad Matsalla

From dwrice at indiana.edu  Fri Jun 10 01:41:46 2005
From: dwrice at indiana.edu (Danny Rice)
Date: Fri Jun 10 01:33:35 2005
Subject: [Bioperl-l] avoiding feature parsing
Message-ID: <42A9281A.1020102@indiana.edu>

I'm cranking through a bunch of genbank or fasta files named by their 
ncbi gi.  The large genbank files take a huge amount of time to parse 
all the feature info but I am only interested in the sequence.  I've 
looked at the modules and read the docs but haven't found good 
documentation on how to read a genbank file without parsing all the 
feature info.  I tried

my $seqio = Bio::SeqIO->new(-file => "$dir/$gi", -format => "fasta");

and to my surprise it seems to parse the genbank files correctly but 
only gets the sequence, which seems to solve the problem.  My only 
question is "Is this the expected behavior and can I rely on this 
working?  And.  Is their any documentation on this behavior?".  I 
suppose this figures out that I mean: "I'm only interested in the 
sequence but go ahead and figure out the format of the input file if it 
isn't already in fasta format."  If there is a more standard or faster 
way to just get the sequence from a genbank file I'd be interested in 
that also.

-Danny
From Marc.Logghe at devgen.com  Fri Jun 10 05:05:30 2005
From: Marc.Logghe at devgen.com (Marc Logghe)
Date: Fri Jun 10 04:57:53 2005
Subject: [Bioperl-l] avoiding feature parsing
Message-ID: <0C528E3670D8CE4B8E013F6749231AA606E82F@ANTARESIA.be.devgen.com>

Hi Danny,

> my $seqio = Bio::SeqIO->new(-file => "$dir/$gi", -format => "fasta");
> 
> and to my surprise it seems to parse the genbank files 
> correctly but only gets the sequence, which seems to solve 
> the problem.  My only question is "Is this the expected 
> behavior and can I rely on this working?  And.  Is their any 

Problem is, bioperl actually has parsed the complete gebank record,
*including* the feature table. Of course, they do not show up in the
fasta dump, but all features are attached to the sequence object
anyways. This is the default behaviour.
But you can say to the builder that you are not interested in the
features.
>From the perldoc of Bio::Seq::SeqBuilder:

my $builder = $seqio->sequence_builder();
# if you need only sequence, id, and description (e.g. for
# conversion to FASTA format):
$builder->want_none();
$builder->add_wanted_slot('display_id','desc','seq');

# if you want everything except the sequence and features
$builder->want_all(1); # this is the default if it's untouched
$builder->add_unwanted_slot('seq','features');

HTH,
Marc

From hlapp at gmx.net  Fri Jun 10 05:48:25 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Jun 10 05:41:12 2005
Subject: [Bioperl-l] avoiding feature parsing
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA606E82F@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA606E82F@ANTARESIA.be.devgen.com>
Message-ID: <d685bf304f6ec9aa983899bcb1de504c@gmx.net>

Excellent answer Marc. I was starting to look up the docs again but you 
were much faster.

	-hilmar

On Jun 10, 2005, at 5:05 PM, Marc Logghe wrote:

> Hi Danny,
>
>> my $seqio = Bio::SeqIO->new(-file => "$dir/$gi", -format => "fasta");
>>
>> and to my surprise it seems to parse the genbank files
>> correctly but only gets the sequence, which seems to solve
>> the problem.  My only question is "Is this the expected
>> behavior and can I rely on this working?  And.  Is their any
>
> Problem is, bioperl actually has parsed the complete gebank record,
> *including* the feature table. Of course, they do not show up in the
> fasta dump, but all features are attached to the sequence object
> anyways. This is the default behaviour.
> But you can say to the builder that you are not interested in the
> features.
>> From the perldoc of Bio::Seq::SeqBuilder:
>
> my $builder = $seqio->sequence_builder();
> # if you need only sequence, id, and description (e.g. for
> # conversion to FASTA format):
> $builder->want_none();
> $builder->add_wanted_slot('display_id','desc','seq');
>
> # if you want everything except the sequence and features
> $builder->want_all(1); # this is the default if it's untouched
> $builder->add_unwanted_slot('seq','features');
>
> HTH,
> Marc
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From hlapp at gmx.net  Fri Jun 10 05:49:02 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Fri Jun 10 05:41:26 2005
Subject: [Bioperl-l] avoiding feature parsing
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA606E82F@ANTARESIA.be.devgen.com>
References: <0C528E3670D8CE4B8E013F6749231AA606E82F@ANTARESIA.be.devgen.com>
Message-ID: <1a2f2f558e58fc7c9d00620cd6acd6db@gmx.net>

Excellent answer Marc. I was starting to look up the docs again but you 
were much faster.

	-hilmar

On Jun 10, 2005, at 5:05 PM, Marc Logghe wrote:

> Hi Danny,
>
>> my $seqio = Bio::SeqIO->new(-file => "$dir/$gi", -format => "fasta");
>>
>> and to my surprise it seems to parse the genbank files
>> correctly but only gets the sequence, which seems to solve
>> the problem.  My only question is "Is this the expected
>> behavior and can I rely on this working?  And.  Is their any
>
> Problem is, bioperl actually has parsed the complete gebank record,
> *including* the feature table. Of course, they do not show up in the
> fasta dump, but all features are attached to the sequence object
> anyways. This is the default behaviour.
> But you can say to the builder that you are not interested in the
> features.
>> From the perldoc of Bio::Seq::SeqBuilder:
>
> my $builder = $seqio->sequence_builder();
> # if you need only sequence, id, and description (e.g. for
> # conversion to FASTA format):
> $builder->want_none();
> $builder->add_wanted_slot('display_id','desc','seq');
>
> # if you want everything except the sequence and features
> $builder->want_all(1); # this is the default if it's untouched
> $builder->add_unwanted_slot('seq','features');
>
> HTH,
> Marc
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From cjm at fruitfly.org  Fri Jun 10 12:36:25 2005
From: cjm at fruitfly.org (Chris Mungall)
Date: Fri Jun 10 12:27:22 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
Message-ID: <Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>


You're right, I could just do

 $newrange = Bio::Range->union(@ranges)

And it would work fine

However, the calling context is *another* "decorated" interface in RangeI
(disconnected_ranges) - it seems very odd to have a an interface "method"
calling a method in a class that implements that interface

I'm not sure exactly what you're proposing when you say "deprecating the
Bio::RangeI->union() construct" - how would this work? Would it just throw
a warning if $self eq "Bio::RangeI"?

On Thu, 9 Jun 2005, Aaron J. Mackey wrote:

> Or, how about deprecating the Bio::RangeI->union() construct (since
> although we've supplied implementations in interface, we don't need
> to encourage people to use them)?  This is just a weird way to do
> $newrange = Bio::Range->union(@ranges), right? (which saves a whole
> capitalized keystroke!)
>
> -Aaron
>
> On Jun 9, 2005, at 2:45 PM, Chris Mungall wrote:
>
> >
> > The pod docs for union() state that this is is valid:
> >
> >   my $newrange = Bio::RangeI->union(@ranges);
> >
> > In the subroutine body, this gets called:
> >
> >   my $self = shift;
> >   ...
> >   $self->new(...)
> >
> > Since $self is equal to the string "Bio::RangeI", rather than an
> > object
> > implementing this interface, this will result in a call to
> >
> >   Bio::Root::RootI->new("Bio::RangeI",...)
> >
> > This works fine in bp1.4, but in recent bioperl revisions this
> > results in
> > a warning message that Bio::Root::RootI->new is deprecated, and a
> > delegation to Bio::Root::Root, **omitting the name of the class to be
> > created**, thus creating a Bio::Root::Root object, which is useless
> > and
> > will inevitably break any code calling the union() method.
> >
> > I think this delegation is completely wrong, and should be removed,
> > and
> > the warning message switched to an error; OR it should be
> > undeprecated and
> > the original behaviour behaviour restored
> >
> > If we decide that RootI->new is truly deprecated, then Bio::RangeI
> > should
> > have to do some $self examination, and use the correct object
> > instantiation method, rather than $self->new. I don't really know
> > what the
> > correct object instantiation method is - perhaps just Bio::Range-
> > >new()?
> > Or should a factory be used?
> >
> > Personally, I would prefer it if Bio::RootI->new were undeprecated
> > and the
> > original behaviour restored. deprecating would make perfect sense if
> > bioperl interfaces really were interfaces, which they are not.
> >
> > Cheers
> > Chris
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
> Aaron J. Mackey, Ph.D.
> Project Manager, ApiDB Bioinformatics Resource Center
> Penn Genomics Institute, University of Pennsylvania
> email:  amackey@pcbi.upenn.edu
> office: 215-898-1205
> fax:    215-746-6697
> postal: Penn Genomics Institute
>          Goddard Labs 212
>          415 S. University Avenue
>          Philadelphia, PA  19104-6017
>
>

From brian_osborne at cognia.com  Fri Jun 10 12:56:53 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Fri Jun 10 12:49:05 2005
Subject: [Bioperl-l] Problem in parsing GenBank flatfile
In-Reply-To: <f2507cb80506090239502f5d12@mail.gmail.com>
Message-ID: <BECF3E95.1A9C%brian_osborne@cognia.com>

Yoshida,

Whatever the problem is it appears to be fixed in bioperl-live, in CVS. I
downloaded the most recent NT_015926 and it's parsed correctly.

Brian O.



On 6/9/05 5:39 AM, "Yoshida Yuichi" <yuichiyoshi@gmail.com> wrote:

> Dear all,
> 
> I am trying to parse GenBank flatfile (accession num is NT_015926)
> by calling Bio::SeqIO modules, but I can not.
> 
> - - - - - - - - - - - - - Perl program code - - - - - - - - - - - - -
> #!/usr/bin/perl
> use Bio::SeqIO;
> 
> $gbk_filename = shift @ARGV;
> $seqin = Bio::SeqIO->new(-file=>$gbk_filename, -format=>'Genbank');
> 
> while ($seqobj = $seqin->next_seq) {
>     $accession = $seqobj->accession_number,"\n";
>     foreach my $feat ($seqobj->get_SeqFeatures()){
>         if ($feat->primary_tag eq 'mRNA'){
>             $db_gene_name = join(' ',$feat->get_tag_values('gene'));
>             $db_transcript_id = join('
> ',$feat->get_tag_values('transcript_id'));
>             $start = $feat->start; $end = $feat->end;
>             print $db_transcript_id,"\t",$db_gene_name,"\t",$accession,"\t";
>             print $start,"\t",$end,"\n";
>         }
>     }
> }
> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
> 
> The following error message is shown.
> 
> - - - - - - - - - - - - - error message - - - - - - - - - - - - -
> -------------------- WARNING ---------------------
> MSG: cannot see new qualifier in feature CDS: aa:OTHER)
> ---------------------------------------------------
> 
> -------------------- WARNING ---------------------
> MSG: cannot see new qualifier in feature CDS: aa:OTHER)
> ---------------------------------------------------
> 
> -------------------- WARNING ---------------------
> MSG: cannot see new qualifier in feature CDS: aa:OTHER)
> ---------------------------------------------------
> out of memory
> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
> 
> The parts which cause the error (I guess) is shown as the followings.
> 
> - - - - - GenBank partial flatfile (NT_015926) - - - - -
>      CDS             complement(join(4528741..4528932,4543408..4543490,
>                      4581809..4582043,4616648..4616817,4632093..4632236,
>                      4643148..4643301))
>                      /gene="FLJ21820"
>                      /note="go_function: catalytic activity [goid 0003824]
>                      [evidence IEA];
>                      go_process: lipid metabolism [goid 0006629] [evidence
>                      IEA]"
>                      /codon_start=1
>                      /product="hypothetical protein FLJ21820"
>                      /protein_id="NP_068744.1"
>                      /db_xref="GI:11345458"
>                      /db_xref="GeneID:60526"
>                      /db_xref="LocusID:60526"
> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
> 
> Would you please tell me the way to solve this problem?
> 
> --
> Yuichi Yoshida <yuichiyoshi@gmail.com>
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From amackey at pcbi.upenn.edu  Fri Jun 10 13:02:43 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Fri Jun 10 12:54:30 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
Message-ID: <5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>

Yep (using whatever deprecation method [warn, throw, etc] we use  
elsewhere).  But I guess we'd need to check that Bio::RangeI itself  
doesn't ever do this.

-Aaron

On Jun 10, 2005, at 12:36 PM, Chris Mungall wrote:

> I'm not sure exactly what you're proposing when you say  
> "deprecating the
> Bio::RangeI->union() construct" - how would this work? Would it  
> just throw
> a warning if $self eq "Bio::RangeI"?

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205
fax:    215-746-6697
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017

From cjm at fruitfly.org  Fri Jun 10 15:53:07 2005
From: cjm at fruitfly.org (Chris Mungall)
Date: Fri Jun 10 15:43:39 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
	<5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>
Message-ID: <Pine.OSX.4.58.0506101246160.24971@skerryvore.dhcp.lbl.gov>


What about Bio::RangeI->disconnected_ranges(), which currently calls
Bio::RangeI->union()? It seems highly egregious for a decorated interface
to call an implementing class.

Personally I'd rather we gave up the pretense that RangeI is an interface,
and just admit it's a class like any other, and allow static method calls
like RangeI->union() (and avoiding forcing people to change code that
conforms perfectly to the documentation). I'm afraid This whole decorated
interface concept makes no sense whatsoever to me.

On Fri, 10 Jun 2005, Aaron J. Mackey wrote:

> Yep (using whatever deprecation method [warn, throw, etc] we use
> elsewhere).  But I guess we'd need to check that Bio::RangeI itself
> doesn't ever do this.
>
> -Aaron
>
> On Jun 10, 2005, at 12:36 PM, Chris Mungall wrote:
>
> > I'm not sure exactly what you're proposing when you say
> > "deprecating the
> > Bio::RangeI->union() construct" - how would this work? Would it
> > just throw
> > a warning if $self eq "Bio::RangeI"?
>
> --
> Aaron J. Mackey, Ph.D.
> Project Manager, ApiDB Bioinformatics Resource Center
> Penn Genomics Institute, University of Pennsylvania
> email:  amackey@pcbi.upenn.edu
> office: 215-898-1205
> fax:    215-746-6697
> postal: Penn Genomics Institute
>          Goddard Labs 212
>          415 S. University Avenue
>          Philadelphia, PA  19104-6017
>
>

-- Chris
From cjm at fruitfly.org  Fri Jun 10 16:25:58 2005
From: cjm at fruitfly.org (Chris Mungall)
Date: Fri Jun 10 16:17:33 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <Pine.OSX.4.58.0506101246160.24971@skerryvore.dhcp.lbl.gov>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
	<5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506101246160.24971@skerryvore.dhcp.lbl.gov>
Message-ID: <Pine.OSX.4.58.0506101322440.24971@skerryvore.dhcp.lbl.gov>



On Fri, 10 Jun 2005, Chris Mungall wrote:

> What about Bio::RangeI->disconnected_ranges(), which currently calls
> Bio::RangeI->union()? It seems highly egregious for a decorated interface
> to call an implementing class.

Ah, of course, disconnected_ranges can just call $self->union(), and
provided the caller respects the convention of not calling static methods
on an interface, then everything should be fine..

> Personally I'd rather we gave up the pretense that RangeI is an interface,
> and just admit it's a class like any other, and allow static method calls
> like RangeI->union() (and avoiding forcing people to change code that
> conforms perfectly to the documentation). I'm afraid This whole decorated
> interface concept makes no sense whatsoever to me.
>
> On Fri, 10 Jun 2005, Aaron J. Mackey wrote:
>
> > Yep (using whatever deprecation method [warn, throw, etc] we use
> > elsewhere).  But I guess we'd need to check that Bio::RangeI itself
> > doesn't ever do this.
> >
> > -Aaron
> >
> > On Jun 10, 2005, at 12:36 PM, Chris Mungall wrote:
> >
> > > I'm not sure exactly what you're proposing when you say
> > > "deprecating the
> > > Bio::RangeI->union() construct" - how would this work? Would it
> > > just throw
> > > a warning if $self eq "Bio::RangeI"?
> >
> > --
> > Aaron J. Mackey, Ph.D.
> > Project Manager, ApiDB Bioinformatics Resource Center
> > Penn Genomics Institute, University of Pennsylvania
> > email:  amackey@pcbi.upenn.edu
> > office: 215-898-1205
> > fax:    215-746-6697
> > postal: Penn Genomics Institute
> >          Goddard Labs 212
> >          415 S. University Avenue
> >          Philadelphia, PA  19104-6017
> >
> >
>
> -- Chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

-- Chris
From amackey at pcbi.upenn.edu  Fri Jun 10 16:26:24 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Fri Jun 10 16:18:21 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <Pine.OSX.4.58.0506101322440.24971@skerryvore.dhcp.lbl.gov>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
	<5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506101246160.24971@skerryvore.dhcp.lbl.gov>
	<Pine.OSX.4.58.0506101322440.24971@skerryvore.dhcp.lbl.gov>
Message-ID: <66687491-B24C-4A49-9B6F-EC8AE5B7735E@pcbi.upenn.edu>

Right.  I was just composing an email to that effect. -Aaron

On Jun 10, 2005, at 4:25 PM, Chris Mungall wrote:

> Ah, of course, disconnected_ranges can just call $self->union(), and
> provided the caller respects the convention of not calling static  
> methods
> on an interface, then everything should be fine..
>

--
Aaron J. Mackey, Ph.D.
Project Manager, ApiDB Bioinformatics Resource Center
Penn Genomics Institute, University of Pennsylvania
email:  amackey@pcbi.upenn.edu
office: 215-898-1205
fax:    215-746-6697
postal: Penn Genomics Institute
         Goddard Labs 212
         415 S. University Avenue
         Philadelphia, PA  19104-6017

From cjm at fruitfly.org  Fri Jun 10 20:07:22 2005
From: cjm at fruitfly.org (Chris Mungall)
Date: Fri Jun 10 19:57:53 2005
Subject: [Bioperl-l] Bio::RangeI::union
In-Reply-To: <66687491-B24C-4A49-9B6F-EC8AE5B7735E@pcbi.upenn.edu>
References: <Pine.LNX.4.44.0506091121130.24106-100000@sos.lbl.gov>
	<2D0A6A21-409F-45C7-9625-EC4E64831A6C@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506100930190.24894@adsl-68-126-147-89.dsl.pltn13.pacbell.net>
	<5EEB59C1-E7F1-45AC-9887-F618F3D3C584@pcbi.upenn.edu>
	<Pine.OSX.4.58.0506101246160.24971@skerryvore.dhcp.lbl.gov>
	<Pine.OSX.4.58.0506101322440.24971@skerryvore.dhcp.lbl.gov>
	<66687491-B24C-4A49-9B6F-EC8AE5B7735E@pcbi.upenn.edu>
Message-ID: <Pine.OSX.4.58.0506101705000.24971@skerryvore.dhcp.lbl.gov>


OK, I've fixed RangeI. static method calls from RangeI result in a warning
msg meing thrown, and the call delegated to Bio::Range

tests pass, committed to cvs.

And no more moaning about decorated interfaces from me!

On Fri, 10 Jun 2005, Aaron J. Mackey wrote:

> Right.  I was just composing an email to that effect. -Aaron
>
> On Jun 10, 2005, at 4:25 PM, Chris Mungall wrote:
>
> > Ah, of course, disconnected_ranges can just call $self->union(), and
> > provided the caller respects the convention of not calling static
> > methods
> > on an interface, then everything should be fine..
> >
>
> --
> Aaron J. Mackey, Ph.D.
> Project Manager, ApiDB Bioinformatics Resource Center
> Penn Genomics Institute, University of Pennsylvania
> email:  amackey@pcbi.upenn.edu
> office: 215-898-1205
> fax:    215-746-6697
> postal: Penn Genomics Institute
>          Goddard Labs 212
>          415 S. University Avenue
>          Philadelphia, PA  19104-6017
>
>

-- Chris
From avilella at gmail.com  Sat Jun 11 15:18:04 2005
From: avilella at gmail.com (Albert Vilella)
Date: Sat Jun 11 15:12:45 2005
Subject: [Bioperl-l] patch xyplot.pm negative values Bio::Graphics/GMOD
Message-ID: <1118517484.8515.12.camel@localhost.localdomain>

Hi all,

xyplot negative values:

Lincoln and Guenther: this are very hacky modifications (I still haven't
completely familiarized myself with Bio::Graphics)

I took a look at the code in xyplot.pm, and tested it on a local png
file (I don't have a GBrowse setup to test). Please check if what
has been done is correct.

It seems to me that _draw_boxes needs to be modified, so that the
boxes aren't wrongly plotted, but _draw_histogram, _draw_line and
_draw_points don't need anything special, a part from the existence of
the scale.

In _draw_boxes, negative boxes need to be plotted from the middle of
the track down to their score, so I modified it in a similar fashion
as it is done in _draw_scale

--- xyplot.pm.~1.15.~   2005-06-11 08:03:02.000000000 +0200
+++ xyplot.pm   2005-06-11 21:04:37.895586696 +0200
@@ -64,7 +64,8 @@

   my $type = $self->option('graph_type') || $self->option('graphtype')
|| 'boxes';
   $self->_draw_histogram($gd,$x,$y)  if $type eq 'histogram';
-  $self->_draw_boxes($gd,$x,$y)      if $type eq 'boxes';
+  #we need $dx and $dy for calculating $half for negative boxes
+  $self->_draw_boxes($gd,$x,$y,$dx,$dy)      if $type eq 'boxes';
   $self->_draw_line ($gd,$x,$y)      if $type eq 'line'
                                        or $type eq 'linepoints';
   $self->_draw_points($gd,$x,$y)     if $type eq 'points'
@@ -141,7 +142,7 @@

 sub _draw_boxes {
   my $self = shift;
-  my ($gd,$left,$top) = @_;
+  my ($gd,$left,$top,$dx,$dy) = @_;

   my @parts  = $self->parts;
   my $fgcolor = $self->fgcolor;
@@ -152,8 +153,17 @@
   for (my $i = 0; $i < @parts; $i++) {
     my $part = $parts[$i];
     my $next = $parts[$i+1];
+    my ($dummy1,$dummy2,$dummy3,$zero) =
$part->calculate_boundaries($left,0);
     my ($x1,$y1,$x2,$y2) = $part->calculate_boundaries($left,$top);
-    $self->filled_box($gd,$x1,$part->{_y_position},$x2,$y2,$bgcolor,
$fgcolor);
+    # If negative box
+    if ($zero < ($part->{_y_position})) {
+        my ($dummyx1,$ny1,$dummyx2,$ny2) =
$self->calculate_boundaries($dx,$dy);
+        my $half = ($ny1+$ny2)/2;
+        $self->filled_box($gd,$x1,$part->{_y_position},$x2,$half,
$bgcolor,$fgcolor);
+    # Normal positive box
+    } else {
+        $self->filled_box($gd,$x1,$part->{_y_position},$x2,$y2,
$bgcolor,$fgcolor);
+    }
     next unless $next;
     my ($x3,$y3,$x4,$y4) = $next->calculate_boundaries($left,$top);
     $gd->line($x2,$y2,$x3,$y4,$fgcolor) if $x2 < $x3;

This results in boxes being plot upward if positive and downward if
negative from the middle of the track, (midpoint between $min_score
and $max_score). I don't know if it is the best thing to do, but it
makes sense to me.

Also, negative boxes will have a different color than positive boxes. It
also makes sense to me.

If you can check if it is ok and test it in a running GBrowse server,
that would be great.

Bests,

    Albert.

PD: I haven't done anything about the log coordinates.

From jason.stajich at duke.edu  Sun Jun 12 16:15:36 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sun Jun 12 16:09:13 2005
Subject: [Bioperl-l] Putative bug in Bio/SearchIO/blast.pm
In-Reply-To: <20050609145859.0000248d@pearson.infobiogen.fr>
References: <20050609145859.0000248d@pearson.infobiogen.fr>
Message-ID: <56F7C7EB-10CD-4D2F-B9E7-6B701392EB60@duke.edu>

I'm pretty sure this is already fixed with the code in CVS.  Can you  
try it with that code -- the regexp was already corrected in  
connection to very large bitscores (Scott Markel's bug) - it is done  
slightly differently from your suggested fix as we need to handle sci- 
value in that field as well.

Also, please post bugs and diffs to http://bugzilla.open-bio.org so  
that they can be tracked - otherwise folks have to follow a mailing  
list thread to find out the resolution for a bug.

-jason
On Jun 9, 2005, at 8:58 AM, J?r?my JUST wrote:

>
>     Hello,
>
>   I think I've found a little bug in the Blast parser.
>   On that Blast result (BLASTN 2.2.9 [May-01-2004]):
>
> <<<<<<
>                                                                   
> Score    E
> Sequences producing significant alignments:                       
> (bits) Value
>
> gi|42592260|ref|NC_003070.5| Arabidopsis thaliana chromosome  
> 1, ...  75.8   8e-13
>
>
>> gi|42592260|ref|NC_003070.5| Arabidopsis thaliana chromosome 1,  
>> complete
>>
>                 sequence
>           Length = 30432563
>
>  Score = 75.8 bits (38), Expect = 8e-13
>  Identities = 104/126 (82%)
>  Strand = Plus / Minus
>
>>>>>>>
>>>>>>>
>
> the score is read as ? 8 ? instead of ? 75.8 ?.
>
>
>
>   I attach a tiny patch against Bioperl-1.5.0.
> ($Id: blast.pm,v 1.84 2004/10/28 20:40:12 jason Exp $)
>
>
>   Cheers.
>
>
> -- 
> J?r?my JUST  <jeremy_just@netcourrier.com>
>
> <blast_score_format.diff>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/



From hartzell at kestrel.alerce.com  Sun Jun 12 18:09:52 2005
From: hartzell at kestrel.alerce.com (George Hartzell)
Date: Sun Jun 12 18:03:20 2005
Subject: [Bioperl-l] Bio::Tools::Primer3.pm bug: code or doc, you decide???
Message-ID: <17068.45744.979958.907829@satchel.alerce.com>


The pod for Bio::Tools::Primer3::number_of_results says for Function:

   "Retrieve the number of primers returned from Primer3"

and for it's Notes:, it says

   "Returns the maximum number of primers returned from Primer3."

In fact, it's returning the maximum offset of the array of results,
also known as one *less* than the number of results that primer3
returned....  (see Bio::Tools::Primer3::_separate() and it's use of
$maxlocation and $self->{'maximum_primers_returned'}).

Given the method's *name*, I figured it'd tell me how many primers I'd
gotten back from primer3.

Given the method's Function doc, ditto....

Given the method's Notes, it's a bit fuzzier, but it still evokes a
count.

I'd like to fix *something*, so that I'll feel better about wasting an
hour walking the primer3 C code and pestering the authors about an off
by one bug.....

So, should I change the method to add one, or change the documentation
to specify that it's the maximum offset into the results array (even
though the names then misleading).

I'd rather fix the code, but *I* don't have to be backward
compatible....

Comments?

g.

From brian_osborne at cognia.com  Sun Jun 12 18:35:28 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Sun Jun 12 18:27:12 2005
Subject: [Bioperl-l] Bio::Tools::Primer3.pm bug: code or doc, you decide???
In-Reply-To: <17068.45744.979958.907829@satchel.alerce.com>
Message-ID: <BED230F0.1B08%brian_osborne@cognia.com>

George,

You're presenting a good argument that it's the code that should change.

Brian O.


On 6/12/05 6:09 PM, "George Hartzell" <hartzell@kestrel.alerce.com> wrote:

> 
> The pod for Bio::Tools::Primer3::number_of_results says for Function:
> 
>    "Retrieve the number of primers returned from Primer3"
> 
> and for it's Notes:, it says
> 
>    "Returns the maximum number of primers returned from Primer3."
> 
> In fact, it's returning the maximum offset of the array of results,
> also known as one *less* than the number of results that primer3
> returned....  (see Bio::Tools::Primer3::_separate() and it's use of
> $maxlocation and $self->{'maximum_primers_returned'}).
> 
> Given the method's *name*, I figured it'd tell me how many primers I'd
> gotten back from primer3.
> 
> Given the method's Function doc, ditto....
> 
> Given the method's Notes, it's a bit fuzzier, but it still evokes a
> count.
> 
> I'd like to fix *something*, so that I'll feel better about wasting an
> hour walking the primer3 C code and pestering the authors about an off
> by one bug.....
> 
> So, should I change the method to add one, or change the documentation
> to specify that it's the maximum offset into the results array (even
> though the names then misleading).
> 
> I'd rather fix the code, but *I* don't have to be backward
> compatible....
> 
> Comments?
> 
> g.
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From hartzell at kestrel.alerce.com  Sun Jun 12 20:52:24 2005
From: hartzell at kestrel.alerce.com (George Hartzell)
Date: Sun Jun 12 20:43:58 2005
Subject: [Bioperl-l] A possible fix for Bio::Tools::Run::Primer3::run().
Message-ID: <17068.55496.742709.93166@satchel.alerce.com>


Me again,

Can someone review this patch?

Bio::Tools::Primer3::_separate refers to $self->{input_options}, which
it expects to be a reference to a hash containing the arguments that
were passed to primer3, to help it figure out what is a result and
what's not.

Unfortunately, it doesn't look like it's ever set in the results
object that's passed back, so if you use $results->primer_results(0),
you end up with the input arguments mixed in.

I think that this fixes it.

I'm sure there's a way to do it in one line.....

g.

*** Bio/Tools/Run/Primer3.pm.orig	Tue Mar  1 18:26:31 2005
--- Bio/Tools/Run/Primer3.pm	Sun Jun 12 17:41:51 2005
***************
*** 452,457 ****
--- 452,466 ----
  	$self->{results_obj} = new Bio::Tools::Primer3;
  	$self->{results_obj}->_set_variable('results', $self->{results});
  	$self->{results_obj}->_set_variable('seqobject', $self->{seqobject});
+ 	# Bio::Tools::Primer3::_separate needs a hash of the primer3 arguments,
+ 	# with the arg as the key and the value as the value (surprise!).
+ 	my %input_hash;
+ 	foreach my $line (@{$self->{'primer3_input'}}) {
+ 	  my ($key, $value) = split '=', $line;
+ 	  $input_hash{$key} = $value;
+ 	}
+ 	$self->{results_obj}->_set_variable('input_options', \%input_hash);
+ 
  	$self->{results_separated}= $self->{results_obj}->_separate();
  	return $self->{results_obj};
  }
From hartzell at kestrel.alerce.com  Sun Jun 12 21:23:00 2005
From: hartzell at kestrel.alerce.com (George Hartzell)
Date: Sun Jun 12 21:16:29 2005
Subject: [Bioperl-l] A possible fix for Bio::Tools::Run::Primer3::run().
In-Reply-To: <17068.55496.742709.93166@satchel.alerce.com>
References: <17068.55496.742709.93166@satchel.alerce.com>
Message-ID: <17068.57332.657860.423494@satchel.alerce.com>

George Hartzell writes:
 > 
 > Me again,
 > 
 > Can someone review this patch?
 > [...]

Sorry to respond to my own post.

Here's a better patch, knocks the original fix down to two lines and
adds another fix so that the result object doesn't have an empty
element in it (caused by processing the boulder io record terminator).

Still, comments welcome.

g.


*** Bio/Tools/Run/Primer3.pm.orig	Tue Mar  1 18:26:31 2005
--- Bio/Tools/Run/Primer3.pm	Sun Jun 12 18:17:55 2005
***************
*** 437,442 ****
--- 437,443 ----
  			print OUT $_;
  		}
  		chomp;
+ 		next if ($_ eq "="); # skip over the boulderio record terminator.
  		my ($return, $value) = split('=',$_);
  		$self->{'results'}->{$return} = $value;
  	}
***************
*** 452,457 ****
--- 453,462 ----
  	$self->{results_obj} = new Bio::Tools::Primer3;
  	$self->{results_obj}->_set_variable('results', $self->{results});
  	$self->{results_obj}->_set_variable('seqobject', $self->{seqobject});
+ 	# Bio::Tools::Primer3::_separate needs a hash of the primer3 arguments,
+ 	# with the arg as the key and the value as the value (surprise!).
+ 	my %input_hash = map {split '='} @{$self->{'primer3_input'}};
+ 	$self->{results_obj}->_set_variable('input_options', \%input_hash);
  	$self->{results_separated}= $self->{results_obj}->_separate();
  	return $self->{results_obj};
  }
From avilella at gmail.com  Mon Jun 13 05:56:27 2005
From: avilella at gmail.com (Albert Vilella)
Date: Mon Jun 13 05:48:26 2005
Subject: [Bioperl-l] Re: patch xyplot.pm negative values Bio::Graphics/GMOD
In-Reply-To: <1118655041.15945.40.camel@mango.techgate.insilico.com>
References: <1118517484.8515.12.camel@localhost.localdomain>
	<1118655041.15945.40.camel@mango.techgate.insilico.com>
Message-ID: <1118656587.8243.24.camel@localhost.localdomain>

> I also have little experience on Bio::Graphics, but from my
> understanding I also think that draw_boxes and draw_scale needs to be
> modified. 
> 
> I did this as well and you can see my experiments on
> http://genome.insilico.at/cgi-bin/gbrowse/nimblegen
> 
> Though my approach is very hacky, I can share it. I made a copy to my
> private module gwxyplot.pm which is an overkill but good for
> experiments. I think this function should go into a new graph_type
> option in xyplot.
> 
> I think my solution is similar to yours, If you want I can test your
> version on our gbrowse installation.

This morning (with more caffeine in my veins) I found out that my
previous patch was wrong: I confounded the middle-point with the
zero-point in the vertical axis...

> 
> I still miss features to draw the scale:
> -) all over the detail view 
> -) also if no features are available, the empty scale should be drawn.
> -) do correct padding if scale is drawn.

Is this in only in GMOD side or does it also affect Bio::Graphics?

> 
> In my approach I need to configure the min_score max_score otherwise the
> scale is not done correct which is not very good ...

So, basically, min_score, max_score and draw_scale parts need some work
so that gwxyplot changes can be merged to xyplot. Is that right?

    Albert.

> > PD: I haven't done anything about the log coordinates.

From fernan at iib.unsam.edu.ar  Mon Jun 13 12:22:07 2005
From: fernan at iib.unsam.edu.ar (Fernan Aguero)
Date: Mon Jun 13 12:15:24 2005
Subject: [Bioperl-l] pubmed not used in Bio::Annotation::Reference if
	medline is present
Message-ID: <20050613162207.GT953@iib.unsam.edu.ar>

Hi!

I'm parsing GenBank files using bioperl-1.4:

my $bpSeqIoObj   = Bio::SeqIO->new
( -format => 'GenBank', -file => $dataFile );

while ( my $bpSeqObj = $bpSeqIoObj->next_seq() ) {
  my $bpAnnotObj = $bpSeqObj->annotation();
  my @bpRefObjs = $bpAnnotObj->get_Annotations('reference');
  my $bpRefObj = shift(@bpRefObjs);

  my $pubmed = $bpRefObj->{'pubmed'};
  my $medline= $bpRefObj->{'medline'};
  
  ...
}

The problem that I'm seeing is that whenever a genbank
record has both PUBMED and MEDLINE IDs,
$bpRefObj->{'pubmed'} is empty. 

It would be OK if ->{'medline'} was empty, since MEDLINE has
been replaced by pubmed, but this is not the case.

Anyone can confirm this? I haven't found any bugs open
related to this issue. Perhaps it's already fixed in 1.5 or
in CVS? I can fix it if I knew who is loading the
Bio::Annotation object upon parsing the GenBank file ...

Fernan
From brian_osborne at cognia.com  Mon Jun 13 12:38:41 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Mon Jun 13 12:32:33 2005
Subject: [Bioperl-l] pubmed not used in Bio::Annotation::Reference if
	medline is present
In-Reply-To: <20050613162207.GT953@iib.unsam.edu.ar>
Message-ID: <BED32ED1.1B4D%brian_osborne@cognia.com>

Fernan,

What is the $dataFile or id?

Brian O.


On 6/13/05 12:22 PM, "Fernan Aguero" <fernan@iib.unsam.edu.ar> wrote:

> Hi!
> 
> I'm parsing GenBank files using bioperl-1.4:
> 
> my $bpSeqIoObj   = Bio::SeqIO->new
> ( -format => 'GenBank', -file => $dataFile );
> 
> while ( my $bpSeqObj = $bpSeqIoObj->next_seq() ) {
>   my $bpAnnotObj = $bpSeqObj->annotation();
>   my @bpRefObjs = $bpAnnotObj->get_Annotations('reference');
>   my $bpRefObj = shift(@bpRefObjs);
> 
>   my $pubmed = $bpRefObj->{'pubmed'};
>   my $medline= $bpRefObj->{'medline'};
>   
>   ...
> }
> 
> The problem that I'm seeing is that whenever a genbank
> record has both PUBMED and MEDLINE IDs,
> $bpRefObj->{'pubmed'} is empty.
> 
> It would be OK if ->{'medline'} was empty, since MEDLINE has
> been replaced by pubmed, but this is not the case.
> 
> Anyone can confirm this? I haven't found any bugs open
> related to this issue. Perhaps it's already fixed in 1.5 or
> in CVS? I can fix it if I knew who is loading the
> Bio::Annotation object upon parsing the GenBank file ...
> 
> Fernan
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From fernan at iib.unsam.edu.ar  Mon Jun 13 13:33:12 2005
From: fernan at iib.unsam.edu.ar (Fernan Aguero)
Date: Mon Jun 13 13:28:00 2005
Subject: [Bioperl-l] pubmed not used in Bio::Annotation::Reference if
	medline is present
In-Reply-To: <BED32ED1.1B4D%brian_osborne@cognia.com>
References: <20050613162207.GT953@iib.unsam.edu.ar>
	<BED32ED1.1B4D%brian_osborne@cognia.com>
Message-ID: <20050613173312.GU953@iib.unsam.edu.ar>

+----[ Brian Osborne <brian_osborne@cognia.com> (13.Jun.2005 13:44):
|
| Fernan,
| 
| What is the $dataFile or id?
| 
| Brian O.
|
+----]

OK, so your question prompted me to look again in GenBank,
because I'm using GenBank files that were downloaded some
time ago ... if you go to GenBank now, there are no MEDLINE
lines. But they are in my copy of the file (I'm using the
entry for accession number AI563039 as an example,
attached). So the bug is there.  However, I don't know if
it's still relevant or worth to fix it, as it seems that
NCBI has pulled the MEDLINE line from the GenBank records.

Anyway, I'll have to download all my datasets again :(

Fernan

LOCUS       AI563039                 530 bp    mRNA    linear   EST 26-MAR-1999
DEFINITION  TENS2196 T. cruzi epimastigote normalized cDNA Library Trypanosoma
            cruzi cDNA clone 2196 5', mRNA sequence.
ACCESSION   AI563039
VERSION     AI563039.1  GI:4521421
KEYWORDS    EST.
SOURCE      Trypanosoma cruzi
  ORGANISM  Trypanosoma cruzi
            Eukaryota; Euglenozoa; Kinetoplastida; Trypanosomatidae;
            Trypanosoma; Schizotrypanum.
REFERENCE   1  (bases 1 to 530)
  AUTHORS   Verdun,R.E., Di Paolo,N.C., Urmenyi,T.P., Rondinelli,E.,
            Frasch,A.C.C. and Sanchez,D.O.
  TITLE     Gene discovery through expressed sequence tag sequencing in
            trypanosoma cruzi
  JOURNAL   Infect. Immun. 66 (11), 5393-5398 (1998)
  MEDLINE   99003155
   PUBMED   9784549
COMMENT     Contact: Sanchez D.O.
...
...
From skirov at utk.edu  Mon Jun 13 15:13:19 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Mon Jun 13 15:05:27 2005
Subject: [Bioperl-l] some notes on entrezgene parser performance
Message-ID: <42ADDACF.5040607@utk.edu>

This is brief comparison of locuslink (march download) v.s. entrezgene. 
While this is not too comprehensive it shows to some extent how 
entrezgene parser performs.
The procedure: both locuslink and entrezgene files are parsed and loaded 
into a relational database (genereg.ornl.gov/gkdb) and then the number 
of records is compared between the locuslink and entrezgene tables. 
Locuslink parser has been used for years and I know it works well. So if 
there is a nasty bug in entrezgene, that missed some of the data, I 
expect to see a decrease in the number of records in entrezgene vs. 
locuslink (some fluctuation is normal). Here are two reports (for Gene 
Ontology and RefSeq, if interested please ask and I will send additional 
reports). I think the parser is functioning normally  so far.  The only 
significant deviation is GO data for Drosophila, but that is because the 
entrezgene file simply does not contain this data. This is quite a 
restricted approach, so I can't guarantee the parser is not missing 
something. Please let me know if you notice weird behavior.
Stefan


REFSEQ report:
For organism Apis mellifera, entrez gene had 18 records more (less) than 
locuslink
And table ll_refseq_nm had 14 records more (less) than locuslink
For organism Bos taurus, entrez gene had 37113 records more (less) than 
locuslink
And table ll_refseq_nm had 362 records more (less) than locuslink
For organism Caenorhabditis elegans, entrez gene had -799 records more 
(less) than locuslink
And table ll_refseq_nm had -383 records more (less) than locuslink
For organism Canis familiaris, entrez gene had 42 records more (less) 
than locuslink
And table ll_refseq_nm had 45 records more (less) than locuslink
For organism Danio rerio, entrez gene had 2208 records more (less) than 
locuslink
And table ll_refseq_nm had 305 records more (less) than locuslink
For organism Drosophila melanogaster, entrez gene had -8814 records more 
(less) than locuslink
And table ll_refseq_nm had 1249 records more (less) than locuslink
For organism Gallus gallus, entrez gene had 16 records more (less) than 
locuslink
And table ll_refseq_nm had 192 records more (less) than locuslink
For organism Homo sapiens, entrez gene had 107382 records more (less) 
than locuslink
And table ll_refseq_nm had 151 records more (less) than locuslink
For organism Human immunodeficiency virus 1, entrez gene had -9 records 
more (less) than locuslink
And table ll_refseq_nm had -24 records more (less) than locuslink
For organism Mus musculus, entrez gene had 57427 records more (less) 
than locuslink
And table ll_refseq_nm had 49 records more (less) than locuslink
For organism Pan troglodytes, entrez gene had 19 records more (less) 
than locuslink
And table ll_refseq_nm had 18 records more (less) than locuslink
For organism Rattus norvegicus, entrez gene had 25821 records more 
(less) than locuslink
And table ll_refseq_nm had 681 records more (less) than locuslink
For organism Strongylocentrotus purpuratus, entrez gene had -29 records 
more (less) than locuslink
And table ll_refseq_nm had -8 records more (less) than locuslink
For organism Sus scrofa, entrez gene had 12 records more (less) than 
locuslink
And table ll_refseq_nm had 3 records more (less) than locuslink
For organism Takifugu rubripes, entrez gene had -238 records more (less) 
than locuslink
And table ll_refseq_nm had -7 records more (less) than locuslink
For organism Xenopus tropicalis, entrez gene had -2612 records more 
(less) than locuslink
And table ll_refseq_nm had -2403 records more (less) than locuslink

GeneOntology report
For organism Danio rerio, entrez gene had 2208 records more (less) than 
locuslink
And table ll_go had 4291 records more (less) than locuslink
For organism Drosophila melanogaster, entrez gene had -8814 records more 
(less) than locuslink
And table ll_go had -44725 records more (less) than locuslink
For organism Homo sapiens, entrez gene had 107382 records more (less) 
than locuslink
And table ll_go had 6716 records more (less) than locuslink
For organism Mus musculus, entrez gene had 57427 records more (less) 
than locuslink
And table ll_go had 2972 records more (less) than locuslink
For organism Rattus norvegicus, entrez gene had 25821 records more 
(less) than locuslink
And table ll_go had 4927 records more (less) than locuslink

From jeremy_just at netcourrier.com  Mon Jun 13 18:50:07 2005
From: jeremy_just at netcourrier.com (=?ISO-8859-15?Q?J=E9r=E9my?= JUST)
Date: Mon Jun 13 18:52:33 2005
Subject: [Bioperl-l] Putative bug in Bio/SearchIO/blast.pm
In-Reply-To: <56F7C7EB-10CD-4D2F-B9E7-6B701392EB60@duke.edu>
References: <20050609145859.0000248d@pearson.infobiogen.fr>
	<56F7C7EB-10CD-4D2F-B9E7-6B701392EB60@duke.edu>
Message-ID: <20050614005007.67bb8d41@norbert.inapg.inra.fr>

On Sun, 12 Jun 2005 16:15:36 -0400
Jason Stajich <jason.stajich@duke.edu> wrote:

> I'm pretty sure this is already fixed with the code in CVS.  Can you  
> try it with that code

  You're right.
  I should have looked at CVS before posting.


> Also, please post bugs and diffs to http://bugzilla.open-bio.org so  
> that they can be tracked

  OK, next time, I'll use bugzilla.
  Each project has its development habits, and I hadn't looked at
Bioperl and its development for nearly three years.


   Cheers.

-- 
J?r?my JUST  <jeremy_just@netcourrier.com>
From eelhaik at uh.edu  Mon Jun 13 18:38:19 2005
From: eelhaik at uh.edu (EranEl)
Date: Tue Jun 14 09:02:47 2005
Subject: [Bioperl-l] Volunteers to contributions of Perl code
Message-ID: <0II100BECISALK@mail.uh.edu>

Dear sir

 

I read your message in the bioperl forum regarding the conversion from
phylip to fasta

I was wondering if you have the perl code that does that

 

Thank you very much

 

____________________________________

Eran Elhaik:           Lab Phone: (713) 743-2312

Doctoral Student  

University of Houston 

HYPERLINK
"http://nsm.uh.edu:16080/~dgraur/eran/main.htm"http://nsm.uh.edu:16080/~dgra
ur/eran/main.htm

____________________________________

 


-- 
No virus found in this outgoing message.
Checked by AVG Anti-Virus.
Version: 7.0.323 / Virus Database: 267.6.9 - Release Date: 11/06/2005
 
From ChaosMK2 at gmx.net  Mon Jun 13 16:58:31 2005
From: ChaosMK2 at gmx.net (ChaosMK2)
Date: Tue Jun 14 09:03:17 2005
Subject: [Bioperl-l] Bioperl module: Bio::Tools::Run::Alignment::TCoffee
Message-ID: <42ADF377.6060906@gmx.net>

I would like to use your TCoffe module but I encountered some problems. 
First I post the code then I will write my questions.

#!/usr/bin/perl;
use strict;
use warnings;
use Bio::Tools::Run::Alignment::TCoffee;

print "Enter full name of directory containing t_*fasta files:\n";
chomp(my $dir = <>);
chdir $dir;

#my @params = ("ktuple" => 2, "matrix" => "BLOSUM", "tg-mode" => 0, 
"output" => "fasta_aln", "score_html");
my @params = ("ktuple" => 2, "matrix" => "BLOSUM", "output" => 
"fasta_aln",);
my $factory = Bio::Tools::Run::Alignment::TCoffee->new(@params);
my @multizFiles = grep(!-d, glob("t_MULTIZ_BLAT_*fasta"));
for my $multizFile (@multizFiles)
{
  open(INPUT, "<", $multizFile);
  open(FILE, ">", "Temp");
  for(<INPUT>)
  {        
     s/^(\w\w)\t([-acgtu]+)$/>$1\n$2/i;
      print FILE;
  }
  close FILE;
  close INPUT;
  my $file = File::Spec->catfile($dir, "Temp");            
  my $aln = $factory->align($file);
  open(FILE, ">", "TCoffee_$multizFile");
  print FILE $aln;
  close FILE;
  unlink $file;
}
exit;

First: if I use tg-mode I get the exeption "unallowed parameter TG-MODE !"
Second: the same exeption with score_html (Considering your description 
I can have more than one output format. Or is it my fault and I have to 
write it another way?)
Third and main problem: I am working on a Windows XP system so I guess 
thats the reason but here comes what the exception tells me:
TCoffee call crashed: 256 [command -in=...]
Before that windows reports an error: Command "-in" was not found...

How to resolve that. Do I have to use Linux? I would have the possiblity 
but not the admin rights to install all the modules but thats my problem 
and would not be an obstacle. Are there any other solutions for my 
problem or is my code buggy? Thank you for any help provided.

Sebastian
From jason.stajich at duke.edu  Tue Jun 14 09:32:50 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Tue Jun 14 09:28:11 2005
Subject: [Bioperl-l] Volunteers to contributions of Perl code
In-Reply-To: <0II100BECISALK@mail.uh.edu>
References: <0II100BECISALK@mail.uh.edu>
Message-ID: <8902037E-D3BA-40A6-AA81-73F11D52C952@duke.edu>

See Bio::AlignIO module.

On Jun 13, 2005, at 6:38 PM, EranEl wrote:

> Dear sir
>
>
>
> I read your message in the bioperl forum regarding the conversion from
> phylip to fasta
>
> I was wondering if you have the perl code that does that
>
>
>
> Thank you very much
>
>
>
> ____________________________________
>
> Eran Elhaik:           Lab Phone: (713) 743-2312
>
> Doctoral Student
>
> University of Houston
>
> HYPERLINK
> "http://nsm.uh.edu:16080/~dgraur/eran/main.htm"http://nsm.uh.edu: 
> 16080/~dgra
> ur/eran/main.htm
>
> ____________________________________
>
>
>
>
> -- 
> No virus found in this outgoing message.
> Checked by AVG Anti-Virus.
> Version: 7.0.323 / Virus Database: 267.6.9 - Release Date: 11/06/2005
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From ram at i122server.vu-wien.ac.at  Tue Jun 14 10:18:06 2005
From: ram at i122server.vu-wien.ac.at (Rambabu Gudavalli)
Date: Tue Jun 14 10:22:08 2005
Subject: [Bioperl-l] how can i get GO terms
Message-ID: <c034ebfaa5e7cf2ce9e9a5e0d13b1540@i122server.vu-wien.ac.at>

Dear All,
    i am trying to get the Gene Ontology for melanogaster genome. could 
any one know how to get them.
i have the melanogaster gene names (ex: CG17178). i want the biological 
function and biological process etc from Gene ontology.
thank you.
Ram

From chad at dieselwurks.com  Tue Jun 14 13:02:36 2005
From: chad at dieselwurks.com (Chad Matsalla)
Date: Tue Jun 14 12:54:17 2005
Subject: [Bioperl-l] genbank2gff and how do I use gff3 with Bio::DB::GFF?
Message-ID: <Pine.LNX.4.62.0506141056220.10925@sausage.usask.ca>


Greetings,

It's a bit cheesy to follow up on my own post but due to the
underwhelming response I thought I'd tell people that evertything works
fine if you use bp_genbank2gff3.pl.

Since bp_genbank2gff.pl doesn't work quite properly and hasn't been
changed for over a year can it just be moved to the attic to prevent
other people from trying[1] to work with it?

Thanks!

Chad Matsalla


[1] For some strange reason.


From lstein at cshl.edu  Tue Jun 14 14:00:36 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Tue Jun 14 13:52:57 2005
Subject: [Bioperl-l] Re: patch xyplot.pm negative values Bio::Graphics/GMOD
In-Reply-To: <1118517484.8515.12.camel@localhost.localdomain>
References: <1118517484.8515.12.camel@localhost.localdomain>
Message-ID: <200506141400.37019.lstein@cshl.edu>

Hi Albert,

Much obliged to you on this. Unfortunately the patch got wordwrapped in 
transit.  Could you send the patch as an attachment? Sometimes you need to 
gzip the attachment first.

Lincoln

On Saturday 11 June 2005 03:18 pm, Albert Vilella wrote:
> Hi all,
>
> xyplot negative values:
>
> Lincoln and Guenther: this are very hacky modifications (I still haven't
> completely familiarized myself with Bio::Graphics)
>
> I took a look at the code in xyplot.pm, and tested it on a local png
> file (I don't have a GBrowse setup to test). Please check if what
> has been done is correct.
>
> It seems to me that _draw_boxes needs to be modified, so that the
> boxes aren't wrongly plotted, but _draw_histogram, _draw_line and
> _draw_points don't need anything special, a part from the existence of
> the scale.
>
> In _draw_boxes, negative boxes need to be plotted from the middle of
> the track down to their score, so I modified it in a similar fashion
> as it is done in _draw_scale
>
> --- xyplot.pm.~1.15.~   2005-06-11 08:03:02.000000000 +0200
> +++ xyplot.pm   2005-06-11 21:04:37.895586696 +0200
> @@ -64,7 +64,8 @@
>
>    my $type = $self->option('graph_type') || $self->option('graphtype')
>
> || 'boxes';
>
>    $self->_draw_histogram($gd,$x,$y)  if $type eq 'histogram';
> -  $self->_draw_boxes($gd,$x,$y)      if $type eq 'boxes';
> +  #we need $dx and $dy for calculating $half for negative boxes
> +  $self->_draw_boxes($gd,$x,$y,$dx,$dy)      if $type eq 'boxes';
>    $self->_draw_line ($gd,$x,$y)      if $type eq 'line'
>                                         or $type eq 'linepoints';
>    $self->_draw_points($gd,$x,$y)     if $type eq 'points'
> @@ -141,7 +142,7 @@
>
>  sub _draw_boxes {
>    my $self = shift;
> -  my ($gd,$left,$top) = @_;
> +  my ($gd,$left,$top,$dx,$dy) = @_;
>
>    my @parts  = $self->parts;
>    my $fgcolor = $self->fgcolor;
> @@ -152,8 +153,17 @@
>    for (my $i = 0; $i < @parts; $i++) {
>      my $part = $parts[$i];
>      my $next = $parts[$i+1];
> +    my ($dummy1,$dummy2,$dummy3,$zero) =
> $part->calculate_boundaries($left,0);
>      my ($x1,$y1,$x2,$y2) = $part->calculate_boundaries($left,$top);
> -    $self->filled_box($gd,$x1,$part->{_y_position},$x2,$y2,$bgcolor,
> $fgcolor);
> +    # If negative box
> +    if ($zero < ($part->{_y_position})) {
> +        my ($dummyx1,$ny1,$dummyx2,$ny2) =
> $self->calculate_boundaries($dx,$dy);
> +        my $half = ($ny1+$ny2)/2;
> +        $self->filled_box($gd,$x1,$part->{_y_position},$x2,$half,
> $bgcolor,$fgcolor);
> +    # Normal positive box
> +    } else {
> +        $self->filled_box($gd,$x1,$part->{_y_position},$x2,$y2,
> $bgcolor,$fgcolor);
> +    }
>      next unless $next;
>      my ($x3,$y3,$x4,$y4) = $next->calculate_boundaries($left,$top);
>      $gd->line($x2,$y2,$x3,$y4,$fgcolor) if $x2 < $x3;
>
> This results in boxes being plot upward if positive and downward if
> negative from the middle of the track, (midpoint between $min_score
> and $max_score). I don't know if it is the best thing to do, but it
> makes sense to me.
>
> Also, negative boxes will have a different color than positive boxes. It
> also makes sense to me.
>
> If you can check if it is ok and test it in a running GBrowse server,
> that would be great.
>
> Bests,
>
>     Albert.
>
> PD: I haven't done anything about the log coordinates.

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From hartzell at kestrel.alerce.com  Tue Jun 14 13:48:48 2005
From: hartzell at kestrel.alerce.com (George Hartzell)
Date: Tue Jun 14 14:39:07 2005
Subject: [Bioperl-l] Bio::Tools::Primer3.pm bug: code or doc, you decide???
In-Reply-To: <BED230F0.1B08%brian_osborne@cognia.com>
References: <17068.45744.979958.907829@satchel.alerce.com>
	<BED230F0.1B08%brian_osborne@cognia.com>
Message-ID: <17071.6272.927626.702576@satchel.alerce.com>

Brian Osborne writes:
 > George,
 > 
 > You're presenting a good argument that it's the code that should change.
 > 
 > Brian O.
 > 
 > 
 > On 6/12/05 6:09 PM, "George Hartzell" <hartzell@kestrel.alerce.com> wrote:
 > 
 > > 
 > > The pod for Bio::Tools::Primer3::number_of_results says for Function:
 > > 
 > >    "Retrieve the number of primers returned from Primer3"
 > > 
 > > and for it's Notes:, it says
 > > 
 > >    "Returns the maximum number of primers returned from Primer3."
 > > 
 > > In fact, it's returning the maximum offset of the array of results,
 > > also known as one *less* than the number of results that primer3
 > > returned....  (see Bio::Tools::Primer3::_separate() and it's use of
 > > $maxlocation and $self->{'maximum_primers_returned'}).
 > > 
 > > Given the method's *name*, I figured it'd tell me how many primers I'd
 > > gotten back from primer3.
 > > 
 > > Given the method's Function doc, ditto....
 > > 
 > > Given the method's Notes, it's a bit fuzzier, but it still evokes a
 > > count.
 > > 
 > > I'd like to fix *something*, so that I'll feel better about wasting an
 > > hour walking the primer3 C code and pestering the authors about an off
 > > by one bug.....
 > > 
 > > So, should I change the method to add one, or change the documentation
 > > to specify that it's the maximum offset into the results array (even
 > > though the names then misleading).
 > > 
 > > I'd rather fix the code, but *I* don't have to be backward
 > > compatible....
 > > 
 > > Comments?

Here's a patch that fixes it.

It changes the behaviour, code that used to work will now have an off
by one error.

There should be a "Headsup!  We just made a non-backward-compatible
change" warning if when this gets committed.

g.


-------------- next part --------------
A non-text attachment was scrubbed...
Name: patch-Primer3.pm
Type: application/octet-stream
Size: 942 bytes
Desc: not available
Url : http://portal.open-bio.org/pipermail/bioperl-l/attachments/20050614/c27aff49/patch-Primer3.obj
From hlapp at gnf.org  Tue Jun 14 14:55:38 2005
From: hlapp at gnf.org (Hilmar Lapp)
Date: Tue Jun 14 14:46:09 2005
Subject: [Bioperl-l] Re: memory error while loading SwissProt into Oracle
	using bioperl-db
In-Reply-To: <Pine.GSO.4.33.0506141050110.4029-100000@amsel>
References: <Pine.GSO.4.33.0506141050110.4029-100000@amsel>
Message-ID: <3ba087a1f2d128f023b94d871b0366fa@gnf.org>


On Jun 14, 2005, at 2:52 AM, Jana Bauckmann wrote:

> Hi,
>
> I would like to load SwissProt data into my Oracle 9.2 database with
> BioSQL as schema using load_seqdatabase.pl from bioperl-db. I've got 
> two
> problems:
>
> 1) I get many (about 1300) warnings stating integrity constraint 
> errors:
>
> ORA-02291: integrity constraint (BIOSQL_SP.FKDBX_REF) violated - parent
> key not found (DBD ERROR: OCIStmtExecute)
>
> ORA-01400: cannot insert NULL into 
> ("BIOSQL_SP"."SG_REFERENCE"."AUTHORS")
> (DBD ERROR: OCIStmtExecute)

If there is indeed no authors for the respective reference in the 
respective SwissProt entries then this is expected because 
Reference.Authors may not be NULL.

You should, however, see more than just the error message above; 
supposedly there is a warning message following or preceding it that 
informs about not all foreign keys succeeded to insert, and the message 
should give the primary key. This should be the primary key for the 
bioentry that should have gotten the reference attached. Using SQL you 
should then be able to identify which record it is and then you can 
look it up on the Swissprot site or in your Swissprot source file.

If the bioentry itself fails to load because of this problem then you 
should see an error message to this effect, with full stack trace. 
Otherwise the bioentry did load, just the reference didn't, and if you 
don't really need this particular reference, you don't need to worry 
about it.

You may also want to consider trying to upgrade to a CVS snapshot from 
either the 1.4 branch or the main trunk. There have been a few fixes to 
modules that I believe include the swissprot parser.

>
> 2) The script stops after 2 hours (34500 tuples in table BioEntry) with
> message: Out of memory!
>
> I guess problem 1 causes problem 2. Is this reasonable or do I have two
> separated problems?

The one before may not even be a real problem, see above. It is 
extremely unlikely that it causes the memory problem.

Swissprot is is a large, very diverse, and richly annotated data 
source, and because bioperl-db caches a lot of stuff like ontology 
terms, references, and dbxrefs the loader process will eventually use 
up anywhere between 500MB and 1.3GB of RAM.

Given the amount of memory you have this shouldn't be a limitation 
though at all, unless maybe if you gave all the memory to Oracle 
running on the same machine.

I've had a memory leak issue with DBD::Oracle, the Oracle 9iR2 client 
library, and multi-thread enabled perl 5.8.1 on MacOSX. You may be 
seeing a similar problem. Try watching the loader process in top and 
see how fast the memory consumption grows. It will grow due to the 
object cache filling up, but if you see it eating up more than 1GB 
before 100,000 records loaded you're likely to have hit a memory leak.

If that's the case you'll have to rebuild your own perl from source 
with multi-threading disabled.

	-hilmar

>
> I run Oracle and the load script on the same machine with:
> Suse Linux 9.0 (kernel 2.4.21-291-smp) with  12 GB RAM
> perl 5.8.1, built for i586-linux-thread-multi
> bioperl 1.4
> bioperl-db 0.1

BTW I'm assuming this is not correct; otherwise the latest BioSQL 
schema wouldn't be supported, let alone the Oracle version of it. You 
probably obtained a snapshot from CVS?

> DBI 1.48
> DBD::Oracle 1.16
> Oracle 9.2
> BioSQL schema for Oracle (downloaded from http://cvs.open-bio.org/ on 
> 6th
> June 2005)
>
> Thanks for any suggestions,
> Jana
>
> _______________________________________________
> BioSQL-l mailing list
> BioSQL-l@open-bio.org
> http://open-bio.org/mailman/listinfo/biosql-l
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------

From cain at cshl.edu  Tue Jun 14 16:53:29 2005
From: cain at cshl.edu (Scott Cain)
Date: Tue Jun 14 16:45:29 2005
Subject: [Bioperl-l] genbank2gff and how do I use gff3 with Bio::DB::GFF?
In-Reply-To: <Pine.LNX.4.62.0506141056220.10925@sausage.usask.ca>
References: <Pine.LNX.4.62.0506141056220.10925@sausage.usask.ca>
Message-ID: <1118782409.3813.34.camel@localhost.localdomain>

Hi Chad,

Sorry I haven't reproduced your results; I've been dragged down by other
matters.  If I can recap to make sure I have it right:

 bp_genbank2gff.pl will correctly generate gff2
 bp_genbank2gff3.pl will correctly generate gff3

If I have that right, I would be reluctant to pitch bp_genbank2gff.pl as
there are still plenty of people (that is, the overwhelming majority)
that use gff2.  I nearly certain (without even looking) that they could
be documented better.

What would be really great would be if you could submit this as a bug on
bioperl's bugzilla, so I won't forget about it.  I have a few software
releases I really want to get out in the next week or so, so I know I
won't get to it real soon.

Thanks,
Scott


On Tue, 2005-06-14 at 11:02 -0600, Chad Matsalla wrote:
> Greetings,
> 
> It's a bit cheesy to follow up on my own post but due to the
> underwhelming response I thought I'd tell people that evertything works
> fine if you use bp_genbank2gff3.pl.
> 
> Since bp_genbank2gff.pl doesn't work quite properly and hasn't been
> changed for over a year can it just be moved to the attic to prevent
> other people from trying[1] to work with it?
> 
> Thanks!
> 
> Chad Matsalla
> 
> 
> [1] For some strange reason.
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From tuantran167 at gmail.com  Tue Jun 14 20:03:47 2005
From: tuantran167 at gmail.com (Tuan A. Tran)
Date: Tue Jun 14 19:55:50 2005
Subject: [Bioperl-l] extract info from .game.xml
Message-ID: <cc7ec2a05061417032adeed4a@mail.gmail.com>

Hi,

I am trying to extract some information from a file filename.game.xml
(I got this file from flybase.org). I wrote a simple script to test
it. However, I keep getting the following message

------------- EXCEPTION  -------------
MSG: No annotations
STACK Bio::SeqIO::game::gameHandler::load
/usr/local/share/perl/5.8.4/Bio/SeqIO/game/gameHandler.pm:121
STACK Bio::SeqIO::game::_getseqs
/usr/local/share/perl/5.8.4/Bio/SeqIO/game.pm:156
STACK Bio::SeqIO::game::next_seq
/usr/local/share/perl/5.8.4/Bio/SeqIO/game.pm:101
STACK toplevel fetchseq_game_xml.pl:64

I have no idea why. Can anyone help?
Thanks in advance,
TAT

---------------------------------
My simple script is

#!/usr/local/lib/perl

use strict;

sub NULL () {0};

use Bio::Seq;
use Bio::SeqIO;
#use Bio::SeqIO::game;
#use Bio::Annotation;
use Bio::SearchIO;
use Bio::AlignIO;
use Bio::SimpleAlign;
use Bio::LocatableSeq;
use Bio::Tools::Run::StandAloneBlast;
use Bio::Tools::Run::Alignment::Clustalw;
use Getopt::Long;
use Bio::DB::GenBank;
use Bio::DB::Flat::BDB;
#use Bio::Index::GenBank;
use Bio::Index::Fasta;
use Bio::SeqFeature::Generic;
use DBI;


my $infile = shift;
my $in = Bio::SeqIO->new( -file=> $infile, -format=>'game');

while (my $query = $in->next_seq() ) {

	print $query->id,"\n";
}

From chad at dieselwurks.com  Tue Jun 14 22:53:02 2005
From: chad at dieselwurks.com (Chad Matsalla)
Date: Tue Jun 14 22:44:44 2005
Subject: [Bioperl-l] genbank2gff and how do I use gff3 with Bio::DB::GFF?
In-Reply-To: <1118782409.3813.34.camel@localhost.localdomain>
References: <Pine.LNX.4.62.0506141056220.10925@sausage.usask.ca>
	<1118782409.3813.34.camel@localhost.localdomain>
Message-ID: <Pine.LNX.4.62.0506142036290.11883@sausage.usask.ca>


On Tue, 14 Jun 2005, Scott Cain wrote:
> Sorry I haven't reproduced your results; I've been dragged down by other
> matters.  If I can recap to make sure I have it right:
>
> bp_genbank2gff.pl will correctly generate gff2

I don't know how to ask it to produce gff2. As far as I can tell from
the source it generates v3 only and under default use it produces gff3.
And the gff3 it produces returns undef to the segment() call in [1].

> bp_genbank2gff3.pl will correctly generate gff3

Yes, it generates gff that I can successfully bind to using code I
provided earlier and included here[1].

I'm not at all a gff expert so I was hoping for someone else[2] to tell
me the difference between the gff3 produced by genbank2gff and
genbank2gff3. Whew, that's a mouthfull to say out loud.

> If I have that right, I would be reluctant to pitch bp_genbank2gff.pl as
> there are still plenty of people (that is, the overwhelming majority)
> that use gff2.  I nearly certain (without even looking) that they could
> be documented better.

I'd be pleased for information on how to make either script produce
gff2. Am I missing something?

> What would be really great would be if you could submit this as a bug on
> bioperl's bugzilla, so I won't forget about it.  I have a few software
> releases I really want to get out in the next week or so, so I know I
> won't get to it real soon.

I'd love to report a bug but I'm not clear on what I'm reporting. Is it
that the gff3 produced by genbank2gff is incomplete in some way? Or is
it that the gff3 produced by genbank2gff requires some special technique
to use as in [1]? Or is it that genbank2gff should be producing gff2?

Thanks for your advice on how to treat this! These scripts provide a
great start to working with these systems.

Chad Matsalla

[1]
my $db2 = Bio::DB::GFF->new( -adaptor => 'memory', -file => './t/data/AE003644_Adh-genomic.gff' );
my $segment2 = $db2->segment(-name => 'AE003644');
my @features = $segment2->features();
print("There are this many features on AE003644 (".scalar(@features).")\n");

[2] wink wink, nudge nudge
From priesel at caesar.de  Wed Jun 15 02:53:30 2005
From: priesel at caesar.de (Saskia Priesel)
Date: Wed Jun 15 02:45:06 2005
Subject: [Bioperl-l] Module: Bio::Structure::IO
Message-ID: <42AFCFFE.6080605@caesar.de>

Hello to all,

I have a problem with very much Files from the PDB (Protein Data Bank).
I want to analyse 30000 PDB Files. For this I take the Bioperl Module
Bio::Structure::IO for reading the whole entry. Below I give you the
source code. My Problem is now that I will have to much open entries in
the memory. Is there a method or so in the module which can handle this?

sub filter_data {
    my $pdb_files_ref = shift;

    my @pdb_files = @$pdb_files_ref;
    #print join ("\n",@pdb_files);

    #initialize variables
    my @file_data = ();
    my $min_length = 0;
    my $max_length = 100;

    for(my $i=0;$i<=$#pdb_files;$i++) {
      my $data = $pdb_files[$i];
      #print "$data\n";

      my $structio = Bio::Structure::IO->new(-file => "$data", '-format'
=> 'pdb');

      my $structure = $structio->next_structure();

      print "Structure",$structure->id,"\n";

      my @chain_list = $structure->get_chains();

      my $length = scalar @chain_list;
      #print "Laenge: $length\n";
      #print "Letztes Element: $chain_list[-1]\n";

      for(my $i=0;$i<=$#chain_list;$i++) {
        my $chain = $chain_list[$i];
        #print "Chain: $chain\n";

        my $chainid = $chain->id;
        #print "Chain: $chainid\n";

        if($chainid =~ m/default/) {
          $pseq = $structure->seqres();
          my $default_seq = $pseq->seq();
          #print "$default_seq\n";
          if(length($default_seq) >= $min_length && length($default_seq)
<= $max_length) {
            if($default_seq =~ m/.*C.*C.*C/i == 0) {
              print "Structure",$structure->id,"\n";
              print "Chain: $chainid\n";
              print "$default_seq\n";
              print "Laenge: ",length($default_seq),"\n";
              }
            }
          next;
          }

        my $pseq = $structure->seqres($chainid);

        if (!$pseq){
          last;
          }

        my $sequence = $pseq->seq();
        #print "$sequence\n";

        if(length($sequence) >= $min_length && length($sequence) <=
$max_length) {
          if($sequence =~ m/.*C.*C.*C/i == 0) {
            print "Structure",$structure->id,"\n";
            print "Chain: $chainid\n";
            print "$sequence\n";
            print "Laenge: ",length($sequence),"\n";
            next;
            }
          }
       }
     }
  }

From michael.watson at bbsrc.ac.uk  Wed Jun 15 10:14:27 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Wed Jun 15 10:07:54 2005
Subject: [Bioperl-l] locus_tag of features in Bio::SeqFeature->gff_string
Message-ID: <8975119BCD0AC5419D61A9CF1A923E950172D73D@iahce2knas1.iah.bbsrc.reserved>

Hi

I've noticed that some locus tags are reported with "'s round them and
some are not when gff_string is called on a feature.

E.g. in NC_002755.gbk, MT2384.1 comes out as "MT2384.1", and MT4034
comes out as MT4034.  The dot seems to be the deciding factor.

Not a massive issue, by any means... :-S

Mick

From jason.stajich at duke.edu  Wed Jun 15 11:42:26 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Jun 15 11:35:23 2005
Subject: [Bioperl-l] locus_tag of features in Bio::SeqFeature->gff_string
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E950172D73D@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E950172D73D@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <7A7F0AC8-DA95-4587-BBAC-D64664F68D84@duke.edu>

http://www.sanger.ac.uk/Software/formats/GFF/ 
GFF_Spec.shtml#attribute_field

I see the a Sequence attribute field with strings containing "."  
being escaped.  I assume that is why you see this in the current  
gff_string implementation.


I don't know if this persists in GFF3 as things are slightly  
different in terms of what needs to be escaped/protected in quotes.

I think things have really grown organically wrt GFF input/output - I  
don't know if the Bio::FeatureIO system provides a more uniform  
solution for the future?

-jason

On Jun 15, 2005, at 10:14 AM, michael watson ((IAH-C)) wrote:

> Hi
>
> I've noticed that some locus tags are reported with "'s round them and
> some are not when gff_string is called on a feature.
>
> E.g. in NC_002755.gbk, MT2384.1 comes out as "MT2384.1", and MT4034
> comes out as MT4034.  The dot seems to be the deciding factor.
>
> Not a massive issue, by any means... :-S
>
> Mick
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


From asu at gnf.org  Wed Jun 15 15:32:35 2005
From: asu at gnf.org (Andrew Su)
Date: Wed Jun 15 15:24:19 2005
Subject: [Bioperl-l] aligned sequence from hmmer output
Message-ID: <26AA69A5942B374388D123E5B8D121BE1D758F@EXCHCLUSTER01.lj.gnf.org>

Hello,

Does anyone know of an easy way to get the sequence from an alignment in
hmmer output?  I think from blast output, it's something like
$hsp->seq('query') or $hsp->seq('target'), but when I try this for a
hmmer hsp, it throws an exception complaining about trying to create a
seq object with a sequence that has "." and "+" and such (pasted below).


for example, my program looks something like this:

$in = new Bio::SearchIO( -format => 'hmmer',  -file => $ARGV[0] ); 
while( my $result = $in->next_result ) {
	while( $hit = $result->next_hit ) {
		while( $hsp = $hit->next_domain ) {
			print
$hit->name,",",$hsp->evalue,",",$hsp->score, "\n";
		}
	}
}

... and I'd like to output the matched sequence as well.  Anyone have
any thoughts on how I would accomplish this?

(apologies if this has previously been addressed; couldn't find the
right combination of search strings to fish the answer out of the
archives...)

thanks,
-andrew


------------- EXCEPTION  -------------
MSG: Attempting to set the sequence to [aggttaa.a.cggtcaa.aa<-*] which
does not look healthy
STACK Bio::PrimarySeq::seq
/depts/CompDisc/lib/perl/Bio/PrimarySeq.pm:267
STACK Bio::PrimarySeq::new
/depts/CompDisc/lib/perl/Bio/PrimarySeq.pm:217
STACK Bio::LocatableSeq::new
/depts/CompDisc/lib/perl/Bio/LocatableSeq.pm:100
STACK Bio::Search::HSP::HSPI::seq
/depts/CompDisc/lib/perl/Bio/Search/HSP/HSPI.pm:572
STACK toplevel ./parse_hmmer.pl:17


From jason.stajich at gmail.com  Wed Jun 15 15:08:10 2005
From: jason.stajich at gmail.com (Jason Stajich)
Date: Wed Jun 15 15:30:33 2005
Subject: [Bioperl-l] Fwd: query
References: <20050615185742.84407.qmail@web50608.mail.yahoo.com>
Message-ID: <E784C519-2537-4BCC-8E93-37F5EF157ED9@bioperl.org>



Begin forwarded message:

> From: Maitry Kothari <maitry_kothari@yahoo.com>
> Date: June 15, 2005 2:57:42 PM EDT
> To: jason@bioperl.org
> Subject: query
>
>
> hi,
> I am student of MS (computer) , in this semester i have sub bio- 
> informatics & i m doing my project & in that i have to compare two  
> text files & have to get one out put file. how can i do this with  
> perl?
> thanks
> maitry
>
> Send instant messages to your online friends http:// 
> uk.messenger.yahoo.com
>

--
Jason Stajich
jason.stajich-at-gmail.com or jason-at-bioperl.org
http://jason.open-bio.org

From jason.stajich at duke.edu  Wed Jun 15 15:51:33 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Jun 15 15:44:17 2005
Subject: [Bioperl-l] aligned sequence from hmmer output
In-Reply-To: <26AA69A5942B374388D123E5B8D121BE1D758F@EXCHCLUSTER01.lj.gnf.org>
References: <26AA69A5942B374388D123E5B8D121BE1D758F@EXCHCLUSTER01.lj.gnf.org>
Message-ID: <9E3F9E4D-35EC-4257-ADF2-286A42B4CF2D@duke.edu>

You can get them as strings:
$hsp->hit_string and $hsp->query_string.  $hsp->homology_string gives  
you the middle.

-jason
On Jun 15, 2005, at 3:32 PM, Andrew Su wrote:

> Hello,
>
> Does anyone know of an easy way to get the sequence from an  
> alignment in
> hmmer output?  I think from blast output, it's something like
> $hsp->seq('query') or $hsp->seq('target'), but when I try this for a
> hmmer hsp, it throws an exception complaining about trying to create a
> seq object with a sequence that has "." and "+" and such (pasted  
> below).
>
>
> for example, my program looks something like this:
>
> $in = new Bio::SearchIO( -format => 'hmmer',  -file => $ARGV[0] );
> while( my $result = $in->next_result ) {
>     while( $hit = $result->next_hit ) {
>         while( $hsp = $hit->next_domain ) {
>             print
> $hit->name,",",$hsp->evalue,",",$hsp->score, "\n";
>         }
>     }
> }
>
> ... and I'd like to output the matched sequence as well.  Anyone have
> any thoughts on how I would accomplish this?
>
> (apologies if this has previously been addressed; couldn't find the
> right combination of search strings to fish the answer out of the
> archives...)
>
> thanks,
> -andrew
>
>
> ------------- EXCEPTION  -------------
> MSG: Attempting to set the sequence to [aggttaa.a.cggtcaa.aa<-*] which
> does not look healthy
> STACK Bio::PrimarySeq::seq
> /depts/CompDisc/lib/perl/Bio/PrimarySeq.pm:267
> STACK Bio::PrimarySeq::new
> /depts/CompDisc/lib/perl/Bio/PrimarySeq.pm:217
> STACK Bio::LocatableSeq::new
> /depts/CompDisc/lib/perl/Bio/LocatableSeq.pm:100
> STACK Bio::Search::HSP::HSPI::seq
> /depts/CompDisc/lib/perl/Bio/Search/HSP/HSPI.pm:572
> STACK toplevel ./parse_hmmer.pl:17
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


From hartzell at kestrel.alerce.com  Wed Jun 15 20:03:59 2005
From: hartzell at kestrel.alerce.com (George Hartzell)
Date: Wed Jun 15 19:55:30 2005
Subject: [Bioperl-l] Bio::Graphics.pm example/documentation fix
Message-ID: <17072.49647.402834.351364@satchel.alerce.com>


I couldn't get the example from the Bio::Graphics.pm pod doc to work
as written.

I think that the second add_track should take $wholeseq as it's first
argument, not $seq.

I also think that the comment at the top of the example, talking about
a script named red_and_blue.pl, is an historical artifact.

Here's a patch that fixes both of these.  Can someone more familiar
with how this works tell me if after applying this patch example
generates the glyphs it should?

Thanks,

g.

*** Bio/Graphics.pm.orig	Wed Jun 15 16:54:30 2005
--- Bio/Graphics.pm	Wed Jun 15 16:58:01 2005
***************
*** 12,21 ****
  =head1 SYNOPSIS
  
-  # This script generates a PNG picture of a 10K region containing a
-  # set of red features and a set of blue features. Call it like this:
-  #         red_and_blue.pl > redblue.png
-  # you can now view the picture with your favorite image application
- 
- 
   # This script parses a GenBank or EMBL file named on the command
   # line and produces a PNG rendering of it.  Call it like this:
--- 12,15 ----
***************
*** 54,58 ****
   		  -tick => 2);
  
!  $panel->add_track($seq,
   		  -glyph  => 'generic',
   		  -bgcolor => 'blue',
--- 48,52 ----
   		  -tick => 2);
  
!  $panel->add_track($wholeseq,
   		  -glyph  => 'generic',
   		  -bgcolor => 'blue',

From schuerer at genomining.com  Thu Jun 16 04:26:14 2005
From: schuerer at genomining.com (Katja Schuerer)
Date: Thu Jun 16 04:19:52 2005
Subject: [Bioperl-l] Course in informatics for biology 2006 at Institut
	Pasteur
Message-ID: <1118910373.4577.44.camel@dhcp-142.genomining.net>

 

        Course in informatics for biology 2006 at Institut Pasteur
                


In the series of courses offered at the Pasteur Institute, a course  
will be offered in informatics in biology. The next session will take
place from January to end of April 2006.

The main goal of this course is to provide researchers in biology an  
initial exposure to informatics. Admitance in the course is reserved for
those with a degree in biology or a related discipline.

With more and more bioinformatics tools available, it becomes  
increasingly important for researchers in biology to be able both to
manage their data, implement their ideas, and judge for themselves the
usefulness of new algorithms and software.

This course will emphasize fundamental aspects of computer science and  
apply them to biological examples. Theoretical aspects (algorithm
development, logic, problem modeling and design methods), and technical
applications (databases and web technologies) that are relevant for
biologists will be thoroughly discussed.


Programming is presented through the object-oriented paradigm, using a  
modern high-level language, Python, provided with tools for biology and
enabling both prototyping or scripting and the building of important
software systems. Learning of additional languages (perl and C) will be
available for interested students.

Learning during the course will be reinforced with computing exercises, 
and effective training will be provided by a 2 month research project.

The working language of the course is French.

For further information, please consult:  

	http://www.pasteur.fr/formation/infobio-en.html

 *** Registration will be closed on October 15 2005. ***

Sincerely,

--
Catherine Letondal, Institut Pasteur  & Katja Schuerer, Genomining
Course informatics for biology -- www.pasteur.fr/formation/infobio



From avilella at gmail.com  Thu Jun 16 05:30:52 2005
From: avilella at gmail.com (Albert Vilella)
Date: Thu Jun 16 05:22:59 2005
Subject: [Bioperl-l] scales in xyplot.pm negative values Bio::Graphics for
	GBrowse
In-Reply-To: <200506141400.37019.lstein@cshl.edu>
References: <1118517484.8515.12.camel@localhost.localdomain>
	<200506141400.37019.lstein@cshl.edu>
Message-ID: <1118914253.8228.23.camel@localhost.localdomain>

Hi all,

I post this here for suggestions:

How would we like to set the scale or xyplots with respect to
min_value and max_value in cases where negative values exist. For
example:

Ex1: min_value=-1 max_value=5

Set: 0 to the middle of the plot, then plot from +5 to -5:

+5 +
   |
   |
   |
 0 +-----------------------------------------
   |
   |                         
   |                       
-5 +  

Set: the scale to plot from +5 to -1, which will fill up all the
plot (as in UCSC wiggle tracks):

+5 +
   |
   |
   |
   |
   |                         
 0 +-----------------------------------------
   |                       
-1 +  

Comments?

Bests,

    Albert.

From jcsanchez at cib.csic.es  Thu Jun 16 05:11:57 2005
From: jcsanchez at cib.csic.es (Juan Carlos Sanchez Ferrero)
Date: Thu Jun 16 10:02:44 2005
Subject: [Bioperl-l] pfam query
Message-ID: <42B1425D.3030109@cib.csic.es>



hello,

Does anyone know if it is possible to make a batch query using bioperl 
to the pfam database ?
 i tried using Bio::Tools::WWW,
but i am only able to get by the swisspfam accession number,
and what i am interested is in making new queries....


Thanks in advance for any help

jc
From sdavis2 at mail.nih.gov  Thu Jun 16 10:40:03 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Thu Jun 16 10:33:02 2005
Subject: [Bioperl-l] pfam query
In-Reply-To: <42B1425D.3030109@cib.csic.es>
References: <42B1425D.3030109@cib.csic.es>
Message-ID: <eb337a134b26acf5358f8d50b8f0fd02@mail.nih.gov>


On Jun 16, 2005, at 5:11 AM, Juan Carlos Sanchez Ferrero wrote:

>
>
> hello,
>
> Does anyone know if it is possible to make a batch query using bioperl 
> to the pfam database ?
> i tried using Bio::Tools::WWW,
> but i am only able to get by the swisspfam accession number,
> and what i am interested is in making new queries....

I'm not sure what you are trying to do, but have you looked at ensembl 
mart?  You can access the MySQL database running the ensembl mart 
directly to query for genes with certain pfam domains or all pfam 
domains for given (or all genes).

Sean

From jcsanchez at cib.csic.es  Thu Jun 16 11:33:54 2005
From: jcsanchez at cib.csic.es (Juan Carlos Sanchez Ferrero)
Date: Thu Jun 16 14:05:04 2005
Subject: [Bioperl-l] pfam query
In-Reply-To: <eb337a134b26acf5358f8d50b8f0fd02@mail.nih.gov>
References: <42B1425D.3030109@cib.csic.es>
	<eb337a134b26acf5358f8d50b8f0fd02@mail.nih.gov>
Message-ID: <42B19BE2.8030206@cib.csic.es>



No is not that,
what i am more interested is in get the graphical representation of the 
domains of each of my prots
here is an example, i can do this:

#! /usr/bin/perl -w



use Bio::Tools::WWW qw(:obj);

$pfam=$BioWWW->search_url('pfam_sp_uk');



print  STDERR "$pfam\n";




$query= $pfam.'Q9P902'

system "wget -p $query";

exit;

and it works fine,
but in contrast if i modify it in order to search for a seq

this
$pfam=$BioWWW->search_url('pfam_sp_uk');   to      
$pfam=$BioWWW->search_url('pfam_seq_uk');

and the $query to something like $query=$pfam.'MTASDFPFCVLLIDFNPD..........'

i got an error saying that i haven't given a query sequence.....


maybe i am doing something wrong or maybe it is not possible do it this 
way, i don't know


jc




Sean Davis wrote:

>
> On Jun 16, 2005, at 5:11 AM, Juan Carlos Sanchez Ferrero wrote:
>
>>
>>
>> hello,
>>
>> Does anyone know if it is possible to make a batch query using 
>> bioperl to the pfam database ?
>> i tried using Bio::Tools::WWW,
>> but i am only able to get by the swisspfam accession number,
>> and what i am interested is in making new queries....
>
>
> I'm not sure what you are trying to do, but have you looked at ensembl 
> mart?  You can access the MySQL database running the ensembl mart 
> directly to query for genes with certain pfam domains or all pfam 
> domains for given (or all genes).
>
> Sean
>

From tuantran167 at gmail.com  Sat Jun 18 01:42:41 2005
From: tuantran167 at gmail.com (Tuan A. Tran)
Date: Sat Jun 18 01:34:54 2005
Subject: [Bioperl-l] parsing blast output
Message-ID: <cc7ec2a050617224227cee319@mail.gmail.com>

Hi,

When I blasted my query sequence against a database, the got the
following line (for example)

>3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1; species=dmel

Using bioperl module, 
 $blast_report = $factory->blastall($query);
I can extract some information like ID = 3R using
 $blast_report->next_result->hits()->name;

 If I want to keep the entire line as show above what should I do? Is
there a module in bioperl? I really appreciate if someone can tell me
how to do it.

Thanks,
TAT

From iak13000 at gmail.com  Sat Jun 18 06:41:13 2005
From: iak13000 at gmail.com (Irshad Khan)
Date: Sat Jun 18 06:33:38 2005
Subject: [Bioperl-l] parsing blast output
In-Reply-To: <7851868c05061803392128884a@mail.gmail.com>
References: <cc7ec2a050617224227cee319@mail.gmail.com>
	<7851868c05061803392128884a@mail.gmail.com>
Message-ID: <7851868c050618034136f5ae31@mail.gmail.com>

On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
> Hi,
> 
> If it is in the description part may be you can try this
> 
> $blast_report->next_result->hits()->description;
> 
> let me know if it works
> 
> Irshad
> 
> On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
> > Hi,
> >
> > When I blasted my query sequence against a database, the got the
> > following line (for example)
> >
> > >3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1; species=dmel
> >
> > Using bioperl module,
> >  $blast_report = $factory->blastall($query);
> > I can extract some information like ID = 3R using
> >  $blast_report->next_result->hits()->name;
> >
> >  If I want to keep the entire line as show above what should I do? Is
> > there a module in bioperl? I really appreciate if someone can tell me
> > how to do it.
> >
> > Thanks,
> > TAT
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>

From jason.stajich at duke.edu  Sat Jun 18 09:34:26 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat Jun 18 09:27:19 2005
Subject: [Bioperl-l] parsing blast output
In-Reply-To: <7851868c050618034136f5ae31@mail.gmail.com>
References: <cc7ec2a050617224227cee319@mail.gmail.com>
	<7851868c05061803392128884a@mail.gmail.com>
	<7851868c050618034136f5ae31@mail.gmail.com>
Message-ID: <84833BC2-0C70-4978-9719-9F2D6C052594@duke.edu>

Except that hits() returns a list.
while( my $result = $blast_report->next_result ) {
  while( my $hit= $result->next_hit ) {
   print $hit->name, " ", $hit->description, "\n";
  }
}

See the HOWTO as well.

On Jun 18, 2005, at 6:41 AM, Irshad Khan wrote:

> On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
>
>> Hi,
>>
>> If it is in the description part may be you can try this
>>
>> $blast_report->next_result->hits()->description;
>>
>> let me know if it works
>>
>> Irshad
>>
>> On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
>>
>>> Hi,
>>>
>>> When I blasted my query sequence against a database, the got the
>>> following line (for example)
>>>
>>>
>>>> 3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1;  
>>>> species=dmel
>>>>
>>>
>>> Using bioperl module,
>>>  $blast_report = $factory->blastall($query);
>>> I can extract some information like ID = 3R using
>>>  $blast_report->next_result->hits()->name;
>>>
>>>  If I want to keep the entire line as show above what should I  
>>> do? Is
>>> there a module in bioperl? I really appreciate if someone can  
>>> tell me
>>> how to do it.
>>>
>>> Thanks,
>>> TAT
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From iak13000 at gmail.com  Sat Jun 18 10:15:19 2005
From: iak13000 at gmail.com (Irshad Khan)
Date: Sat Jun 18 10:07:48 2005
Subject: [Bioperl-l] parsing blast output
In-Reply-To: <cc7ec2a05061806512c85d755@mail.gmail.com>
References: <cc7ec2a050617224227cee319@mail.gmail.com>
	<7851868c05061803392128884a@mail.gmail.com>
	<7851868c050618034136f5ae31@mail.gmail.com>
	<cc7ec2a05061806512c85d755@mail.gmail.com>
Message-ID: <7851868c05061807151a27ab22@mail.gmail.com>

hi Tuan,

To parse blast reports i use to use Bio::SearchIO; so Try jason's loop
by using SearchIO

putting together you can write like

use Bio::SearchIO;

while( my $result = $blast_report->next_result ) {
 while( my $hit= $result->next_hit ) {
  print $hit->name, " ", $hit->description, "\n";
 }
}

let me know if it works.


On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
> Hi Irshad,
> 
> I did try it before and got an error
> Can't locate object method "description" via package
> "Bio::Search::HSP::GenericHSP"
> 
> I also looked at instructions of the above package. I could not find
> method "description". Do you know where I can find an example?
> 
> Tuan
> 
> 
> On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
> > On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
> > > Hi,
> > >
> > > If it is in the description part may be you can try this
> > >
> > > $blast_report->next_result->hits()->description;
> > >
> > > let me know if it works
> > >
> > > Irshad
> > >
> > > On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
> > > > Hi,
> > > >
> > > > When I blasted my query sequence against a database, the got the
> > > > following line (for example)
> > > >
> > > > >3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1; species=dmel
> > > >
> > > > Using bioperl module,
> > > >  $blast_report = $factory->blastall($query);
> > > > I can extract some information like ID = 3R using
> > > >  $blast_report->next_result->hits()->name;
> > > >
> > > >  If I want to keep the entire line as show above what should I do? Is
> > > > there a module in bioperl? I really appreciate if someone can tell me
> > > > how to do it.
> > > >
> > > > Thanks,
> > > > TAT
> > > >
> > > > _______________________________________________
> > > > Bioperl-l mailing list
> > > > Bioperl-l@portal.open-bio.org
> > > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > > >
> > >
> >
>

From tuantran167 at gmail.com  Sun Jun 19 09:49:41 2005
From: tuantran167 at gmail.com (Tuan A. Tran)
Date: Sun Jun 19 09:42:38 2005
Subject: [Bioperl-l] about Bio::DB::GFF
Message-ID: <cc7ec2a05061906491255ad4f@mail.gmail.com>

Hi,

I read instructions about how to use Bio::DB::GFF.  I quoted the last
part of it.
At the end of it, there is a comment
"This limitation will be corrected in the next version of Bio::DB::GFF"

I just wonder if there is a new version in which this limitation is corrected.

Tuan

----------------------------------------------------------------------------------
This module will accept GFF3 files, as described at
http://song.sourceforge.net/gff3.shtml. However, the implementation
has some limitations.


    1. GFF version string is required
    The GFF file b<must> contain the version comment:

     ##gff-version 3

    Unless this version string is present at the top of the GFF file, the
loader will attempt to parse the file in GFF2 format, with
less-than-desirable results.

    2. Only one level of nesting allowed
    A major restriction is that Bio::DB::GFF only allows one level of
nesting of features.  For nesting, the Target tag will be used
preferentially followed by the ID tag, followed by the Parent tag.
This means that if genes are represented like this:

      XXXX XXXX gene XXXX XXXX XXXX ID=myGene
  XXXX XXXX mRNA XXXX XXXX XXXX ID=myTranscript;Parent=myGene
  XXXX XXXX exon XXXX XXXX XXXX Parent=myTranscript
  XXXX XXXX exon XXXX XXXX XXXX Parent=myTranscript

    Then there will be one group called myGene containing the "gene"
feature and one group called myTranscript containing the mRNA, and two
exons.

    You can work around this restriction to some extent by using the Alias
attribute literally:

      XXXX XXXX gene XXXX XXXX XXXX ID=myGene
  XXXX XXXX mRNA XXXX XXXX XXXX ID=myTranscript;Parent=myGene;Alias=myGene
  XXXX XXXX exon XXXX XXXX XXXX Parent=myTranscript;Alias=myGene
  XXXX XXXX exon XXXX XXXX XXXX Parent=myTranscript;Alias=myGene

    This limitation will be corrected in the next version of Bio::DB::GFF.

From lstein at cshl.edu  Sun Jun 19 13:12:07 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Sun Jun 19 13:05:09 2005
Subject: [Bioperl-l] Drawing sequences in the "other" direction
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E950172D55A@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E950172D55A@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <200506191312.07629.lstein@cshl.edu>

Hi Michael,

Have you tried passing -flip=>1 to Bio::Graphics::Panel->new()?

Lincoln

On Tuesday 24 May 2005 08:16 am, michael watson (IAH-C) wrote:
> Hi
>
> I'm trying to draw images of bits of aligned bacterial genomes with the
> genes marked on as features.  Reasonably often a gene in one species is
> on the +1 strand, and in another species it's on the -1 strand.  I want
> to draw an image of these genes "aligned", one on top of the other, both
> facing in the same direction (obviously those that I have flipped I will
> annotate as such).
>
> I have been drawing images using Bio::Graphics::Panel and the add_track
> method, but I can't figure out how to draw the sequence, and all it's
> features, running in the opposite direction.  In fact, I doubt there is
> one unless someone can point it out?
>
> I did think of drawing them in the right orientation and using the linux
> "convert" command to flip the image, but then all the text is backwards!
>
> Any help appreciated
>
> Mick
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From michael.watson at bbsrc.ac.uk  Sun Jun 19 14:18:07 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Sun Jun 19 14:10:18 2005
Subject: [Bioperl-l] Drawing sequences in the "other" direction
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95020679A8@iahce2knas1.iah.bbsrc.reserved>

Hi Lincoln, List

Yeah, flip works great on the whole panel, but I have my top track which is a genome in the +1 direction, then I want to add another track which is a second genome, aligned to the first, but it runs in the -1 direction, I want to flip the second track but not the first...

Would running through all the features and re-jigging the co-ordinates of all the features work?  I was hoping to avoid it... though I guess somewhere buried in the guts of Bio::Graphics::Panel, this code must already be written...?

Mick



-----Original Message-----
From:	Lincoln Stein [mailto:lstein@cshl.edu]
Sent:	Sun 19/06/2005 6:12 PM
To:	bioperl-l@portal.open-bio.org
Cc:	michael watson (IAH-C)
Subject:	Re: [Bioperl-l] Drawing sequences in the "other" direction

Hi Michael,

Have you tried passing -flip=>1 to Bio::Graphics::Panel->new()?

Lincoln

On Tuesday 24 May 2005 08:16 am, michael watson (IAH-C) wrote:
> Hi
>
> I'm trying to draw images of bits of aligned bacterial genomes with the
> genes marked on as features.  Reasonably often a gene in one species is
> on the +1 strand, and in another species it's on the -1 strand.  I want
> to draw an image of these genes "aligned", one on top of the other, both
> facing in the same direction (obviously those that I have flipped I will
> annotate as such).
>
> I have been drawing images using Bio::Graphics::Panel and the add_track
> method, but I can't figure out how to draw the sequence, and all it's
> features, running in the opposite direction.  In fact, I doubt there is
> one unless someone can point it out?
>
> I did think of drawing them in the right orientation and using the linux
> "convert" command to flip the image, but then all the text is backwards!
>
> Any help appreciated
>
> Mick
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724




From hz5 at njit.edu  Sun Jun 19 22:19:51 2005
From: hz5 at njit.edu (hz5@njit.edu)
Date: Sun Jun 19 22:12:35 2005
Subject: [Bioperl-l] Drawing sequences in the "other" direction
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95020679A8@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E95020679A8@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <1119233991.42b627c7b995b@webmail.njit.edu>

Michael,
This is what I did to solve this problem:
I will have one panel render +1 seq, then use another panel to render the -1 
seq in the "flipped" direction, then use copy to join the 2 panel into one 
picture.

haibo

Quoting "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>:

> 
> 
> Hi Lincoln, List
> 
> Yeah, flip works great on the whole panel, but I have my top track which
> is a genome in the +1 direction, then I want to add another track which
> is a second genome, aligned to the first, but it runs in the -1
> direction, I want to flip the second track but not the first...
> 
> Would running through all the features and re-jigging the co-ordinates
> of all the features work?  I was hoping to avoid it... though I guess
> somewhere buried in the guts of Bio::Graphics::Panel, this code must
> already be written...?
> 
> Mick
> 
> 
> 
> -----Original Message-----
> From:	Lincoln Stein [mailto:lstein@cshl.edu]
> Sent:	Sun 19/06/2005 6:12 PM
> To:	bioperl-l@portal.open-bio.org
> Cc:	michael watson (IAH-C)
> Subject:	Re: [Bioperl-l] Drawing sequences in the "other" direction
> 
> Hi Michael,
> 
> Have you tried passing -flip=>1 to Bio::Graphics::Panel->new()?
> 
> Lincoln
> 
> On Tuesday 24 May 2005 08:16 am, michael watson (IAH-C) wrote:
> > Hi
> >
> > I'm trying to draw images of bits of aligned bacterial genomes with
> the
> > genes marked on as features.  Reasonably often a gene in one species
> is
> > on the +1 strand, and in another species it's on the -1 strand.  I
> want
> > to draw an image of these genes "aligned", one on top of the other,
> both
> > facing in the same direction (obviously those that I have flipped I
> will
> > annotate as such).
> >
> > I have been drawing images using Bio::Graphics::Panel and the
> add_track
> > method, but I can't figure out how to draw the sequence, and all
> it's
> > features, running in the opposite direction.  In fact, I doubt there
> is
> > one unless someone can point it out?
> >
> > I did think of drawing them in the right orientation and using the
> linux
> > "convert" command to flip the image, but then all the text is
> backwards!
> >
> > Any help appreciated
> >
> > Mick
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> -- 
> Lincoln D. Stein
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 



=========================================================
Haibo Zhang, PhD
Computational Biology
http://www.cyberpostdoc.org/
Share postdoc information in cyberspace. Welcome your stories, suggestions and 
advice!
From whs at ebi.ac.uk  Mon Jun 20 03:46:30 2005
From: whs at ebi.ac.uk (Will Spooner)
Date: Mon Jun 20 03:38:40 2005
Subject: [Bioperl-l] parsing blast output
In-Reply-To: <84833BC2-0C70-4978-9719-9F2D6C052594@duke.edu>
Message-ID: <Pine.LNX.4.44.0506200842100.20171-100000@sarek.ebi.ac.uk>

Hi Jason,

I have, in the past, wanted to work with HSP objects out of context of the 
Hit object. There is currently no way to fetch the description in this 
case. How easy would it be to propogate the $hit->description to the 
$hsp->seqdesc attribute during the report parsing?

Will

On Sat, 18 Jun 2005, Jason Stajich wrote:

> Except that hits() returns a list.
> while( my $result = $blast_report->next_result ) {
>   while( my $hit= $result->next_hit ) {
>    print $hit->name, " ", $hit->description, "\n";
>   }
> }
> 
> See the HOWTO as well.
> 
> On Jun 18, 2005, at 6:41 AM, Irshad Khan wrote:
> 
> > On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
> >
> >> Hi,
> >>
> >> If it is in the description part may be you can try this
> >>
> >> $blast_report->next_result->hits()->description;
> >>
> >> let me know if it works
> >>
> >> Irshad
> >>
> >> On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
> >>
> >>> Hi,
> >>>
> >>> When I blasted my query sequence against a database, the got the
> >>> following line (for example)
> >>>
> >>>
> >>>> 3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1;  
> >>>> species=dmel
> >>>>
> >>>
> >>> Using bioperl module,
> >>>  $blast_report = $factory->blastall($query);
> >>> I can extract some information like ID = 3R using
> >>>  $blast_report->next_result->hits()->name;
> >>>
> >>>  If I want to keep the entire line as show above what should I  
> >>> do? Is
> >>> there a module in bioperl? I really appreciate if someone can  
> >>> tell me
> >>> how to do it.
> >>>
> >>> Thanks,
> >>> TAT
> >>>
> >>> _______________________________________________
> >>> Bioperl-l mailing list
> >>> Bioperl-l@portal.open-bio.org
> >>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >>>
> >>>
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12/
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

From bqcao at physics.uc.edu  Mon Jun 20 15:53:40 2005
From: bqcao at physics.uc.edu (Baoqiang Cao)
Date: Mon Jun 20 15:45:35 2005
Subject: [Bioperl-l] how to get entries from swiss-prot
Message-ID: <Pine.LNX.4.58.0506201549390.13140@earth.phy.uc.edu>

Dear All,

I'd like to download all entries in swiss-prot with keywords "phage 
organelle", any package I can use for this purpose? Thanks.

Best,
 B. Cao
From jason.stajich at duke.edu  Mon Jun 20 19:51:56 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon Jun 20 19:43:28 2005
Subject: [Bioperl-l] Bio::SearchIO::hmmer
In-Reply-To: <4627846405060106084c917610@mail.gmail.com>
References: <4627846405060106084c917610@mail.gmail.com>
Message-ID: <8BA71CE8-2DE3-4DE0-AF3C-44C3A4DA5C98@duke.edu>

It really wasn't designed to parse A0 format.  I think we've slowly  
tried to plug the gaps.

Okay I've fixed it, give the latest code from CVS a whirl.

And I don't see how your code is going to work wrt printing out the  
hit_string if you don't have any alignments in the file.

-jason
On Jun 1, 2005, at 9:08 AM, Sean O'Keeffe wrote:

> Hi,
> I was wondering how Bio::SearchIO::hmmer parses hmmpfam/hmmsearch
> result files. I have a set of hmmpam result hits without alignments in
> a file which I generated using hmmpfam locally (-A0 option on the
> command line). Is this considered a valid result by
> Bio::SearchIO::hmmer? If so, what might be wrong with the code below
> (which gets as far as the first while loop and doesn't enter any
> other):
>
> use strict;
> use Bio::SearchIO;
>
> my $inhmmfile = "test-hmm.smart";
> my $outputfilename = "HMM-test.hmmer.parsed";
> my $fastafilename = "$outputfilename".".fasta";
> my $inevalue =1;
> my $inlength =20;
> my ($myresult,$myhit,$myhsp,$mysignificance,$mylength,
> $mynohit,$mylasthit,$mylastresult,$mypercent) = 0;
>
> unless (open(PARSEDFILE, ">$outputfilename")) {
>                print "Could not open file $outputfilename !\n";
>                exit;
>        }
>
> unless (open(FASTAFILE, ">$fastafilename")) {
>                print "Could not open file $fastafilename !\n";
>                exit;
>        }
>
> my $in = new Bio::SearchIO(-format => 'hmmer', -file => $inhmmfile);
>
> while(my $result = $in->next_result ) {
>        $myresult++;
>        while (my $hit = $result->next_hit ) {
>                $myhit++;
>                while (my $hsp = $hit->next_hsp ) {
>                        $myhsp++;
>                        if( $hsp->length('total') >= $inlength ) {
>                                $mylength++;
>                                if ( $hit->significance <=  
> $inevalue ) {
>                                        $mysignificance++;
>
>                                        print PARSEDFILE
> $result->query_name,"\t",
>                                        $result- 
> >query_description,"\t",
>                                        $result->query_length, "\t",
>                                        $hit->description, "\t",
>                                        $hit->accession, "\t",
>                                        $hit->bits, "\t",
>                                        $hit->significance, "\t",
>                                        $hsp->num_identical, "\t",
>                                        $hsp->num_conserved,"\t",
>                                        $hsp->start('query'),"\t",
>                                        $hsp->end('query'),"\t",
>                                        $hsp->start('hit'),"\t",
>                                        $hsp->end('hit'),"\n";
>
>                                        print FASTAFILE  "> ",
> $hit->description,"\n",
>                                        $hsp->hit_string,"\n";
>                                }
>                        }
>                }
>        }
>
>        if ($myhit == 0) {
>               $mynohit++;
>        }
>
>        $myhit = 0;
> }
>
> $mypercent = $mynohit*100 / $myresult;
>
> print "\n\n", $myresult, " query sequence(s)\n";
> print "\n", $myhsp, " HSP sequence(s) \n";
> print "\n", $mylength, " hit(s) presenting the minimum requested  
> length\n";
> print "\n", $mysignificance, " hit(s) presenting the minimum requested
> E-value\n";
> print "\n", $mynohit, " query sequence(s) presenting < NO HITS > ";
> close (PARSEDFILE);
> close (FASTAFILE);
> exit;
>
>
> Output is:
> Use of uninitialized value in numeric eq (==) at ../hmm-test-parse.pl
> line 58, <GEN1> line 40126.
>
>
> 1 query sequence(s)
>
> Use of uninitialized value in print at ../hmm-test-parse.pl line 68,
> <GEN1> line 40126.
>  HSP sequence(s)
>
> Use of uninitialized value in print at ../hmm-test-parse.pl line 69,
> <GEN1> line 40126.
>  hit(s) presenting the minimum requested length
>
> Use of uninitialized value in print at ../hmm-test-parse.pl line 70,
> <GEN1> line 40126.
>  hit(s) presenting the minimum requested E-value
>
> 1 query sequence(s) presenting < NO HITS > (100.00 %)
>
>
> Thanks very much,
> Sean.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From jason.stajich at duke.edu  Mon Jun 20 19:51:58 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon Jun 20 19:43:42 2005
Subject: [Bioperl-l] parsing blast output
In-Reply-To: <Pine.LNX.4.44.0506200842100.20171-100000@sarek.ebi.ac.uk>
References: <Pine.LNX.4.44.0506200842100.20171-100000@sarek.ebi.ac.uk>
Message-ID: <8F6ACB1D-FD6A-4BE8-B222-91330901AAD1@duke.edu>

done.

Propigating query name and desc as well

Try:
  $hsp->query->seq_id;
  $hsp->query->seqdesc;
  $hsp->hit->seq_id;
  $hsp->hit->seqdesc;

-jason
On Jun 20, 2005, at 3:46 AM, Will Spooner wrote:

> Hi Jason,
>
> I have, in the past, wanted to work with HSP objects out of context  
> of the
> Hit object. There is currently no way to fetch the description in this
> case. How easy would it be to propogate the $hit->description to the
> $hsp->seqdesc attribute during the report parsing?
>
> Will
>
> On Sat, 18 Jun 2005, Jason Stajich wrote:
>
>
>> Except that hits() returns a list.
>> while( my $result = $blast_report->next_result ) {
>>   while( my $hit= $result->next_hit ) {
>>    print $hit->name, " ", $hit->description, "\n";
>>   }
>> }
>>
>> See the HOWTO as well.
>>
>> On Jun 18, 2005, at 6:41 AM, Irshad Khan wrote:
>>
>>
>>> On 6/18/05, Irshad Khan <iak13000@gmail.com> wrote:
>>>
>>>
>>>> Hi,
>>>>
>>>> If it is in the description part may be you can try this
>>>>
>>>> $blast_report->next_result->hits()->description;
>>>>
>>>> let me know if it works
>>>>
>>>> Irshad
>>>>
>>>> On 6/18/05, Tuan A. Tran <tuantran167@gmail.com> wrote:
>>>>
>>>>
>>>>> Hi,
>>>>>
>>>>> When I blasted my query sequence against a database, the got the
>>>>> following line (for example)
>>>>>
>>>>>
>>>>>
>>>>>> 3R type=chromosome; loc=3R:1..27905053; ID=3R; release=r4.1;
>>>>>> species=dmel
>>>>>>
>>>>>>
>>>>>
>>>>> Using bioperl module,
>>>>>  $blast_report = $factory->blastall($query);
>>>>> I can extract some information like ID = 3R using
>>>>>  $blast_report->next_result->hits()->name;
>>>>>
>>>>>  If I want to keep the entire line as show above what should I
>>>>> do? Is
>>>>> there a module in bioperl? I really appreciate if someone can
>>>>> tell me
>>>>> how to do it.
>>>>>
>>>>> Thanks,
>>>>> TAT
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l@portal.open-bio.org
>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>>
>>>>>
>>>>
>>>>
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>
>> --
>> Jason Stajich
>> Duke University
>> http://www.duke.edu/~jes12/
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From hz5 at njit.edu  Mon Jun 20 22:58:30 2005
From: hz5 at njit.edu (hz5@njit.edu)
Date: Mon Jun 20 22:50:28 2005
Subject: [Bioperl-l] Drawing sequences in the "other" direction
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E950172D778@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E950172D778@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <1119322710.42b782560eb1c@webmail.njit.edu>

Hi Michael,
I have the cooresponding code here, hope it will help:

foreach my $p(@allpanel){
        my $tim = GD::Image->new($p->width(), $p->height());
        $p->gd($tim);
        $gdImg->copy($tim, $0, $hid, 0, 0, $p->width(), $p->height());
        $hid += $p->height();
}
my $pngData = $gdImg->png();
haibo
//cheers

Quoting "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>:

> Hi Haibo
> 
> Sorry, is "copy" a bioperl function or a linux/windows one?  I tried
> this using an external linux command, but it had trouble figuring out
> what size the images were
> 
> Mick
> 
> -----Original Message-----
> From: hz5@njit.edu [mailto:hz5@njit.edu] 
> Sent: 20 June 2005 03:20
> To: michael watson (IAH-C)
> Cc: bioperl-l@portal.open-bio.org
> Subject: RE: [Bioperl-l] Drawing sequences in the "other" direction
> 
> 
> Michael,
> This is what I did to solve this problem:
> I will have one panel render +1 seq, then use another panel to render
> the -1 
> seq in the "flipped" direction, then use copy to join the 2 panel into
> one 
> picture.
> 
> haibo
> 
> Quoting "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>:
> 
> > 
> > 
> > Hi Lincoln, List
> > 
> > Yeah, flip works great on the whole panel, but I have my top track 
> > which is a genome in the +1 direction, then I want to add another 
> > track which is a second genome, aligned to the first, but it runs in
> 
> > the -1 direction, I want to flip the second track but not the
> first...
> > 
> > Would running through all the features and re-jigging the
> co-ordinates
> 
> > of all the features work?  I was hoping to avoid it... though I guess
> 
> > somewhere buried in the guts of Bio::Graphics::Panel, this code must
> 
> > already be written...?
> > 
> > Mick
> > 
> > 
> > 
> > -----Original Message-----
> > From:	Lincoln Stein [mailto:lstein@cshl.edu]
> > Sent:	Sun 19/06/2005 6:12 PM
> > To:	bioperl-l@portal.open-bio.org
> > Cc:	michael watson (IAH-C)
> > Subject:	Re: [Bioperl-l] Drawing sequences in the "other"
> direction
> > 
> > Hi Michael,
> > 
> > Have you tried passing -flip=>1 to Bio::Graphics::Panel->new()?
> > 
> > Lincoln
> > 
> > On Tuesday 24 May 2005 08:16 am, michael watson (IAH-C) wrote:
> > > Hi
> > >
> > > I'm trying to draw images of bits of aligned bacterial genomes
> with
> > the
> > > genes marked on as features.  Reasonably often a gene in one
> species
> > is
> > > on the +1 strand, and in another species it's on the -1 strand.  I
> > want
> > > to draw an image of these genes "aligned", one on top of the
> other,
> > both
> > > facing in the same direction (obviously those that I have flipped
> I
> > will
> > > annotate as such).
> > >
> > > I have been drawing images using Bio::Graphics::Panel and the
> > add_track
> > > method, but I can't figure out how to draw the sequence, and all
> > it's
> > > features, running in the opposite direction.  In fact, I doubt
> there
> > is
> > > one unless someone can point it out?
> > >
> > > I did think of drawing them in the right orientation and using the
> > linux
> > > "convert" command to flip the image, but then all the text is
> > backwards!
> > >
> > > Any help appreciated
> > >
> > > Mick
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org 
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > 
> > --
> > Lincoln D. Stein
> > Cold Spring Harbor Laboratory
> > 1 Bungtown Road
> > Cold Spring Harbor, NY 11724
> > 
> > 
> > 
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org 
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > 
> 
> 
> 
> =========================================================
> Haibo Zhang, PhD
> Computational Biology
> http://www.cyberpostdoc.org/
> Share postdoc information in cyberspace. Welcome your stories,
> suggestions and 
> advice!
> 



=========================================================
Haibo Zhang, PhD
Computational Biology
http://www.cyberpostdoc.org/
Share postdoc information in cyberspace. Welcome your stories, suggestions and 
advice!
From heikki at ebi.ac.uk  Tue Jun 21 05:02:01 2005
From: heikki at ebi.ac.uk (Heikki Lehvaslaiho)
Date: Tue Jun 21 05:16:39 2005
Subject: [Bioperl-l] Announce: SeqHound access modules
Message-ID: <200506211002.01147.heikki@ebi.ac.uk>


I've just committed two files into bioperl-live:
  Bio::DB::SeqHound
  t/SeqHound_DB.t

They give and test sequence retrieval from the SeqHound database:
  http://www.blueprint.org/seqhound/

The code is written by Rong Yao, Hao Lieu and Ian Donaldson.

Enjoy,

 -Heikki


-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________
From michael.watson at bbsrc.ac.uk  Tue Jun 21 05:56:51 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue Jun 21 05:52:39 2005
Subject: [Bioperl-l] how to get entries from swiss-prot
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95020679AF@iahce2knas1.iah.bbsrc.reserved>

I just did an SRS all text search of swissprot at the EBI:

Query "(([swissprot-AllText:phage*] & [swissprot-AllText:organelle*]) | [swissprot-AllText:phage organelle*]) " found 1 entries

Even searching the whole of uniprot only throws up two entries.

So either SRS isn't working as expected, or you don't really have much of a problem here....

Failing that, you can use the Bio::DB::Query interface to search the protein database at the NCBI - doing a quick search, entrez throws out 9 results for phage organelle :-)

-----Original Message-----
From:	bioperl-l-bounces@portal.open-bio.org on behalf of Baoqiang Cao
Sent:	Mon 20/06/2005 8:53 PM
To:	bioperl-l@portal.open-bio.org
Cc:	
Subject:	[Bioperl-l] how to get entries from swiss-prot
Dear All,

I'd like to download all entries in swiss-prot with keywords "phage 
organelle", any package I can use for this purpose? Thanks.

Best,
 B. Cao
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




From brian_osborne at cognia.com  Tue Jun 21 08:41:25 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Jun 21 08:34:49 2005
Subject: [Bioperl-l] how to get entries from swiss-prot
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95020679AF@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <BEDD8335.1E93%brian_osborne@cognia.com>

B.,

You mean "phage" or "organelle", yes? Phages, or bacteriophages, do not have
organelles so combining these 2 terms with AND is going to retrieve very few
entries.

As Michael suggested, you could try Bio::DB::Query, it's described in the
Beginner's HOWTO:

http://bioperl.org/HOWTOs


Brian O.


On 6/21/05 5:56 AM, "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>
wrote:

> I just did an SRS all text search of swissprot at the EBI:
> 
> Query "(([swissprot-AllText:phage*] & [swissprot-AllText:organelle*]) |
> [swissprot-AllText:phage organelle*]) " found 1 entries
> 
> Even searching the whole of uniprot only throws up two entries.
> 
> So either SRS isn't working as expected, or you don't really have much of a
> problem here....
> 
> Failing that, you can use the Bio::DB::Query interface to search the protein
> database at the NCBI - doing a quick search, entrez throws out 9 results for
> phage organelle :-)
> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org on behalf of Baoqiang Cao
> Sent: Mon 20/06/2005 8:53 PM
> To: bioperl-l@portal.open-bio.org
> Cc: 
> Subject: [Bioperl-l] how to get entries from swiss-prot
> Dear All,
> 
> I'd like to download all entries in swiss-prot with keywords "phage
> organelle", any package I can use for this purpose? Thanks.
> 
> Best,
>  B. Cao
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From michael.watson at bbsrc.ac.uk  Tue Jun 21 08:52:15 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue Jun 21 08:44:14 2005
Subject: [Bioperl-l] how to get entries from swiss-prot
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95020679C1@iahce2knas1.iah.bbsrc.reserved>

Actually, the phrase "phage organelle", when enclosed in speech marks, is almost a googlewhack ;-)

http://www.google.co.uk/search?hl=en&q=%22phage+organelle%22&btnG=Google+Search&meta=

However, there is one paper that refers to a phage tail as an organelle:

http://jb.asm.org/cgi/content/full/185/14/4022


-----Original Message-----
From:	Brian Osborne [mailto:brian_osborne@cognia.com]
Sent:	Tue 21/06/2005 1:41 PM
To:	michael watson (IAH-C); Baoqiang Cao; bioperl-l@portal.open-bio.org
Cc:	
Subject:	Re: [Bioperl-l] how to get entries from swiss-prot
B.,

You mean "phage" or "organelle", yes? Phages, or bacteriophages, do not have
organelles so combining these 2 terms with AND is going to retrieve very few
entries.

As Michael suggested, you could try Bio::DB::Query, it's described in the
Beginner's HOWTO:

http://bioperl.org/HOWTOs


Brian O.


On 6/21/05 5:56 AM, "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>
wrote:

> I just did an SRS all text search of swissprot at the EBI:
> 
> Query "(([swissprot-AllText:phage*] & [swissprot-AllText:organelle*]) |
> [swissprot-AllText:phage organelle*]) " found 1 entries
> 
> Even searching the whole of uniprot only throws up two entries.
> 
> So either SRS isn't working as expected, or you don't really have much of a
> problem here....
> 
> Failing that, you can use the Bio::DB::Query interface to search the protein
> database at the NCBI - doing a quick search, entrez throws out 9 results for
> phage organelle :-)
> 
> -----Original Message-----
> From: bioperl-l-bounces@portal.open-bio.org on behalf of Baoqiang Cao
> Sent: Mon 20/06/2005 8:53 PM
> To: bioperl-l@portal.open-bio.org
> Cc: 
> Subject: [Bioperl-l] how to get entries from swiss-prot
> Dear All,
> 
> I'd like to download all entries in swiss-prot with keywords "phage
> organelle", any package I can use for this purpose? Thanks.
> 
> Best,
>  B. Cao
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l






From brian_osborne at cognia.com  Tue Jun 21 09:07:31 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Jun 21 08:59:20 2005
Subject: [Bioperl-l] how to get entries from swiss-prot
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95020679C1@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <BEDD8953.1E9B%brian_osborne@cognia.com>

Michael,

Jonathan King! That's funny. An unconventional thinker who was way ahead of
his time in some ways, he had this notion of a protein folding imtermediate
many years before it was accepted, and he studied these intermediates as a
phage geneticist, not as a crystallographer or structural biologist.

Brian O.


On 6/21/05 8:52 AM, "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>
wrote:

> Actually, the phrase "phage organelle", when enclosed in speech marks, is
> almost a googlewhack ;-)
> 
> http://www.google.co.uk/search?hl=en&q=%22phage+organelle%22&btnG=Google+Searc
> h&meta=
> 
> However, there is one paper that refers to a phage tail as an organelle:
> 
> http://jb.asm.org/cgi/content/full/185/14/4022
> 
> 
> -----Original Message-----
> From: Brian Osborne [mailto:brian_osborne@cognia.com]
> Sent: Tue 21/06/2005 1:41 PM
> To: michael watson (IAH-C); Baoqiang Cao; bioperl-l@portal.open-bio.org
> Cc: 
> Subject: Re: [Bioperl-l] how to get entries from swiss-prot
> B.,
> 
> You mean "phage" or "organelle", yes? Phages, or bacteriophages, do not have
> organelles so combining these 2 terms with AND is going to retrieve very few
> entries.
> 
> As Michael suggested, you could try Bio::DB::Query, it's described in the
> Beginner's HOWTO:
> 
> http://bioperl.org/HOWTOs
> 
> 
> Brian O.
> 
> 
> On 6/21/05 5:56 AM, "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>
> wrote:
> 
>> I just did an SRS all text search of swissprot at the EBI:
>> 
>> Query "(([swissprot-AllText:phage*] & [swissprot-AllText:organelle*]) |
>> [swissprot-AllText:phage organelle*]) " found 1 entries
>> 
>> Even searching the whole of uniprot only throws up two entries.
>> 
>> So either SRS isn't working as expected, or you don't really have much of a
>> problem here....
>> 
>> Failing that, you can use the Bio::DB::Query interface to search the protein
>> database at the NCBI - doing a quick search, entrez throws out 9 results for
>> phage organelle :-)
>> 
>> -----Original Message-----
>> From: bioperl-l-bounces@portal.open-bio.org on behalf of Baoqiang Cao
>> Sent: Mon 20/06/2005 8:53 PM
>> To: bioperl-l@portal.open-bio.org
>> Cc: 
>> Subject: [Bioperl-l] how to get entries from swiss-prot
>> Dear All,
>> 
>> I'd like to download all entries in swiss-prot with keywords "phage
>> organelle", any package I can use for this purpose? Thanks.
>> 
>> Best,
>>  B. Cao
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> 
> 


From michael.spitzer at uni-muenster.de  Tue Jun 21 09:27:40 2005
From: michael.spitzer at uni-muenster.de (Michael Spitzer)
Date: Tue Jun 21 09:24:23 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
Message-ID: <42B815CC.3090009@uni-muenster.de>

Dear All,

For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the taxon 
ID as given in the corresponding full GenBank record. Which is the 
easiest way to accomplish this task automatically? Does Bioperl help? 
Can one access this function via the NCBI website (possibly, using 
Bioperl)? Or, does one have to download the whole GenBank database?

All I could find out is that there is a function 'gi2taxid' in the NCBI 
toolkit, but I have no experience with using the toolkit, and I hope 
that there is an easier 'Bioperl' way to solve the problem - could 
BIO::DB::NCBIHelper be the way to go? Any help or hints are greatly 
appreciated!

Kind regards,

Michael Spitzer
From michael.watson at bbsrc.ac.uk  Tue Jun 21 10:27:36 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue Jun 21 11:40:49 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
Message-ID: <8975119BCD0AC5419D61A9CF1A923E95020679D9@iahce2knas1.iah.bbsrc.reserved>

Bio::DB::Query::GenBank can be used to query GenBank, and Bio::DB::GenBank can be used to retrieve records.

After that it depends where the taxon id is stored - if it is stored in the feature table, as in:

                     /mol_type="mRNA"
                     /cultivar="Nipponbare"
                     /db_xref="taxon:39947"
                     /clone="R2345"
                     /dev_stage="seedling"

Then once you have the Bio::Seq object from Bio::DB::GenBank you can iterate through the feature table and look at each tag-value pair (using the "has_tag" and "each_tag_value" methods) to look for something like db_xref="taxon:39947"

HTH

Mick


-----Original Message-----
From:	bioperl-l-bounces@portal.open-bio.org on behalf of Michael Spitzer
Sent:	Tue 21/06/2005 2:27 PM
To:	bioperl-l@bioperl.org
Cc:	
Subject:	[Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
Dear All,

For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the taxon 
ID as given in the corresponding full GenBank record. Which is the 
easiest way to accomplish this task automatically? Does Bioperl help? 
Can one access this function via the NCBI website (possibly, using 
Bioperl)? Or, does one have to download the whole GenBank database?

All I could find out is that there is a function 'gi2taxid' in the NCBI 
toolkit, but I have no experience with using the toolkit, and I hope 
that there is an easier 'Bioperl' way to solve the problem - could 
BIO::DB::NCBIHelper be the way to go? Any help or hints are greatly 
appreciated!

Kind regards,

Michael Spitzer
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l




From jason.stajich at duke.edu  Tue Jun 21 12:02:30 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Tue Jun 21 11:54:06 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
In-Reply-To: <8975119BCD0AC5419D61A9CF1A923E95020679D9@iahce2knas1.iah.bbsrc.reserved>
References: <8975119BCD0AC5419D61A9CF1A923E95020679D9@iahce2knas1.iah.bbsrc.reserved>
Message-ID: <5529868E-3C19-4D30-9720-62A0AEAF8709@duke.edu>

There is also a gi2taxonid file that you can download and index  
locally if you are going to do this a lot.  DB_File is useful for  
this as you can tie a hash to the file and re-use the index.

ftp://ftp.ncbi.nih.gov/pub/taxonomy/

AFAIK there is no direct NCBI utility to query with a gi and get the  
taxonid easily for every record - the download of the sequence record  
and then parsing is fine but will be slow if you have to do this over  
many many records.

The Bio::DB::Taxonomy modules are useful if you want to walk up and  
down the taxonomy hierarchy and get sub-sections and/or query for the  
least common node.

I use it in conjunction with the gi2taxid file (indexed) to identify  
DB search results by taxonomic groups.


-jason

On Jun 21, 2005, at 10:27 AM, michael watson ((IAH-C)) wrote:

> Bio::DB::Query::GenBank can be used to query GenBank, and  
> Bio::DB::GenBank can be used to retrieve records.
>
> After that it depends where the taxon id is stored - if it is  
> stored in the feature table, as in:
>
>                      /mol_type="mRNA"
>                      /cultivar="Nipponbare"
>                      /db_xref="taxon:39947"
>                      /clone="R2345"
>                      /dev_stage="seedling"
>
> Then once you have the Bio::Seq object from Bio::DB::GenBank you  
> can iterate through the feature table and look at each tag-value  
> pair (using the "has_tag" and "each_tag_value" methods) to look for  
> something like db_xref="taxon:39947"
>
> HTH
>
> Mick
>
>
> -----Original Message-----
> From:    bioperl-l-bounces@portal.open-bio.org on behalf of Michael  
> Spitzer
> Sent:    Tue 21/06/2005 2:27 PM
> To:    bioperl-l@bioperl.org
> Cc:
> Subject:    [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
> Dear All,
>
> For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the  
> taxon
> ID as given in the corresponding full GenBank record. Which is the
> easiest way to accomplish this task automatically? Does Bioperl help?
> Can one access this function via the NCBI website (possibly, using
> Bioperl)? Or, does one have to download the whole GenBank database?
>
> All I could find out is that there is a function 'gi2taxid' in the  
> NCBI
> toolkit, but I have no experience with using the toolkit, and I hope
> that there is an easier 'Bioperl' way to solve the problem - could
> BIO::DB::NCBIHelper be the way to go? Any help or hints are greatly
> appreciated!
>
> Kind regards,
>
> Michael Spitzer
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


From khufaz83 at yahoo.com  Wed Jun 22 02:44:18 2005
From: khufaz83 at yahoo.com (hafiz yusof)
Date: Wed Jun 22 02:35:43 2005
Subject: [Bioperl-l] cannot find path to blastall
Message-ID: <20050622064418.15683.qmail@web52507.mail.yahoo.com>

I'm trying to set up a standalone blast and I'm
getting an error message;

MSG: cannot find path to blastall

and i have running this code under Linux and i also
haven't find blastall file in /usr/local/bin/, what
should i do?



code:



#!/usr/bin/perl

use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;

my $Seq_in = Bio::SeqIO->new (-file
=>"/home/hafiz/bioperl/fasta", -format => 'fasta');
my $query = $Seq_in->next_seq();


my $factory =
Bio::Tools::Run::StandAloneBlast->new('program'  =>
'blastp',
                                                 
'database' => 'ecoli.nt',
                                                 
_READMETHOD => "Blast"
                                                  );
my $blast_report = $factory->blastall($query);
my $result = $blast_report->next_result;

while( my $hit = $result->next_hit()) {
    print "\thit name: ", $hit->name(), "
significance: ",

$hit->significance(), "\n";}


Send instant messages to your online friends http://uk.messenger.yahoo.com 
From rob at salmonella.org  Wed Jun 22 02:46:23 2005
From: rob at salmonella.org (Rob Edwards)
Date: Wed Jun 22 02:37:46 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
In-Reply-To: <42B815CC.3090009@uni-muenster.de>
References: <42B815CC.3090009@uni-muenster.de>
Message-ID: <1003840011d840032395bf3ed408185b@salmonella.org>

Possibly the easiest way to do this is using the eutils facilities.

e.g.

This url will retrieve the tax id for gi 1234
http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi? 
dbfrom=nucleotide&db=taxonomy&id=1234

will return:
<eLinkResult>
<LinkSet>
	<DbFrom>nucleotide</DbFrom>
	<IdList>
		<Id>1234</Id>
	</IdList>
	<LinkSetDb>
		<DbTo>taxonomy</DbTo>
		<LinkName>nucleotide_taxonomy</LinkName>
		<Link>
			<Id>9940</Id>
		</Link>
	</LinkSetDb>
</LinkSet>
</eLinkResult>

Rob


On Jun 21, 2005, at 6:27 AM, Michael Spitzer wrote:

> Dear All,
>
> For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the  
> taxon ID as given in the corresponding full GenBank record. Which is  
> the easiest way to accomplish this task automatically? Does Bioperl  
> help? Can one access this function via the NCBI website (possibly,  
> using Bioperl)? Or, does one have to download the whole GenBank  
> database?
>
> All I could find out is that there is a function 'gi2taxid' in the  
> NCBI toolkit, but I have no experience with using the toolkit, and I  
> hope that there is an easier 'Bioperl' way to solve the problem -  
> could BIO::DB::NCBIHelper be the way to go? Any help or hints are  
> greatly appreciated!
>
> Kind regards,
>
> Michael Spitzer
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From l.douchy at gmail.com  Wed Jun 22 03:03:08 2005
From: l.douchy at gmail.com (Laurent DOUCHY)
Date: Wed Jun 22 02:54:32 2005
Subject: [Bioperl-l] cannot find path to blastall
In-Reply-To: <20050622064418.15683.qmail@web52507.mail.yahoo.com>
References: <20050622064418.15683.qmail@web52507.mail.yahoo.com>
Message-ID: <2fb209dd0506220003c4c4613@mail.gmail.com>

try with this on the top of your code.

#!/usr/bin/perl
 
use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;

BEGIN 
{
	$ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
}

...

2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
> I'm trying to set up a standalone blast and I'm
> getting an error message;
> 
> MSG: cannot find path to blastall
> 
> and i have running this code under Linux and i also
> haven't find blastall file in /usr/local/bin/, what
> should i do?
> 
> code:
> 
> #!/usr/bin/perl
> 
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my $Seq_in = Bio::SeqIO->new (-file
> =>"/home/hafiz/bioperl/fasta", -format => 'fasta');
> my $query = $Seq_in->next_seq();
> 
> my $factory =
> Bio::Tools::Run::StandAloneBlast->new('program'  =>
> 'blastp',
> 
> 'database' => 'ecoli.nt',
> 
> _READMETHOD => "Blast"
>                                                   );
> my $blast_report = $factory->blastall($query);
> my $result = $blast_report->next_result;
> 
> while( my $hit = $result->next_hit()) {
>     print "\thit name: ", $hit->name(), "
> significance: ",
> 
> $hit->significance(), "\n";}
> 
> Send instant messages to your online friends http://uk.messenger.yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From khufaz83 at yahoo.com  Wed Jun 22 03:10:36 2005
From: khufaz83 at yahoo.com (hafiz yusof)
Date: Wed Jun 22 03:02:02 2005
Subject: [Bioperl-l] cannot find path to blastall
In-Reply-To: <2fb209dd0506220003c4c4613@mail.gmail.com>
Message-ID: <20050622071037.20860.qmail@web52502.mail.yahoo.com>

i have done running this code, and i getting this
error;

-------------------- WARNING ---------------------
MSG: cannot find path to blastall
---------------------------------------------------
Can't call method "next_result" on an undefined value
at blast1.pl line 22, <GEN0> line 1.
BEGIN failed--compilation aborted at blast1.pl line
29.




#!/usr/bin/perl

use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;


BEGIN
{

$ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";


my $Seq_in = Bio::SeqIO->new (-file
=>"/home/hafiz/bioperl/fasta", -format => 'fasta');
my $query = $Seq_in->next_seq();

my $factory =
Bio::Tools::Run::StandAloneBlast->new('program'  =>
'blastp',
                                                 
'database' => 'ecoli.nt',
                                                 
_READMETHOD => "Blast"
                                                  );
my $blast_report = $factory->blastall($query);
my $result = $blast_report->next_result;

while( my $hit = $result->next_hit()) {
    print "\thit name: ", $hit->name(), "
significance: ",

$hit->significance(), "\n";}

}














--- Laurent DOUCHY <l.douchy@gmail.com> wrote:

> try with this on the top of your code.
> 
> #!/usr/bin/perl
>  
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::Run::StandAloneBlast;
> 
> BEGIN 
> {
> 
>
$ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
> }
> 
> ...
> 
> 2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
> > I'm trying to set up a standalone blast and I'm
> > getting an error message;
> > 
> > MSG: cannot find path to blastall
> > 
> > and i have running this code under Linux and i
> also
> > haven't find blastall file in /usr/local/bin/,
> what
> > should i do?
> > 
> > code:
> > 
> > #!/usr/bin/perl
> > 
> > use strict;
> > use Bio::SeqIO;
> > use Bio::Tools::Run::StandAloneBlast;
> > 
> > my $Seq_in = Bio::SeqIO->new (-file
> > =>"/home/hafiz/bioperl/fasta", -format =>
> 'fasta');
> > my $query = $Seq_in->next_seq();
> > 
> > my $factory =
> > Bio::Tools::Run::StandAloneBlast->new('program' 
> =>
> > 'blastp',
> > 
> > 'database' => 'ecoli.nt',
> > 
> > _READMETHOD => "Blast"
> >                                                  
> );
> > my $blast_report = $factory->blastall($query);
> > my $result = $blast_report->next_result;
> > 
> > while( my $hit = $result->next_hit()) {
> >     print "\thit name: ", $hit->name(), "
> > significance: ",
> > 
> > $hit->significance(), "\n";}
> > 
> > Send instant messages to your online friends
> http://uk.messenger.yahoo.com
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> 


Send instant messages to your online friends http://uk.messenger.yahoo.com 
From taerwin at tpg.com.au  Wed Jun 22 03:14:52 2005
From: taerwin at tpg.com.au (Tim Erwin)
Date: Wed Jun 22 03:10:08 2005
Subject: [Bioperl-l] cannot find path to blastall
In-Reply-To: <20050622064418.15683.qmail@web52507.mail.yahoo.com>
References: <20050622064418.15683.qmail@web52507.mail.yahoo.com>
Message-ID: <1119424493.5442.68.camel@bacp4>

Hi Hafiz

You could try setting the executable with the code:

$factory->executable(?/some_dir/blastall?);


Otherwise you could use a symbolic link in /usr/local/bin
to point to your blastall exe.

i.e. 

$> cd /usr/local/bin
$> ln -s /some_dir/blastall .

Regards,

Tim

On Wed, 2005-06-22 at 07:44 +0100, hafiz yusof wrote:
> I'm trying to set up a standalone blast and I'm
> getting an error message;
> 
> MSG: cannot find path to blastall
> 
> and i have running this code under Linux and i also
> haven't find blastall file in /usr/local/bin/, what
> should i do?
> 
> 
> 
> code:
> 
> 
> 
> #!/usr/bin/perl
> 
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my $Seq_in = Bio::SeqIO->new (-file
> =>"/home/hafiz/bioperl/fasta", -format => 'fasta');
> my $query = $Seq_in->next_seq();
> 
> 
> my $factory =
> Bio::Tools::Run::StandAloneBlast->new('program'  =>
> 'blastp',
>                                                  
> 'database' => 'ecoli.nt',
>                                                  
> _READMETHOD => "Blast"
>                                                   );
> my $blast_report = $factory->blastall($query);
> my $result = $blast_report->next_result;
> 
> while( my $hit = $result->next_hit()) {
>     print "\thit name: ", $hit->name(), "
> significance: ",
> 
> $hit->significance(), "\n";}
> 
> 
> Send instant messages to your online friends http://uk.messenger.yahoo.com 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

From l.douchy at gmail.com  Wed Jun 22 03:22:21 2005
From: l.douchy at gmail.com (Laurent DOUCHY)
Date: Wed Jun 22 03:14:01 2005
Subject: [Bioperl-l] cannot find path to blastall
In-Reply-To: <20050622071037.20860.qmail@web52502.mail.yahoo.com>
References: <2fb209dd0506220003c4c4613@mail.gmail.com>
	<20050622071037.20860.qmail@web52502.mail.yahoo.com>
Message-ID: <2fb209dd05062200223aeae94a@mail.gmail.com>

hum ... sory but you must replace the path to blast program. I think
that the database path is important to.

#!/usr/bin/perl

use strict;
use Bio::SeqIO;
use Bio::Tools::Run::StandAloneBlast;


BEGIN
{
$ENV{PATH}=":yourPath/Blast/blast-2.2.10/bin/:";
}

my $Seq_in = Bio::SeqIO->new (-file
=>"/home/hafiz/bioperl/fasta", -format => 'fasta');
my $query = $Seq_in->next_seq();

my $factory =
Bio::Tools::Run::StandAloneBlast->new('program'  =>
'blastp',

'database' => 'yourPath/ecoli.nt',

_READMETHOD => "Blast"
                                                 );
my $blast_report = $factory->blastall($query);
my $result = $blast_report->next_result;

while( my $hit = $result->next_hit()) {
   print "\thit name: ", $hit->name(), "
significance: ",

$hit->significance(), "\n";}



2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
> i have done running this code, and i getting this
> error;
> 
> -------------------- WARNING ---------------------
> MSG: cannot find path to blastall
> ---------------------------------------------------
> Can't call method "next_result" on an undefined value
> at blast1.pl line 22, <GEN0> line 1.
> BEGIN failed--compilation aborted at blast1.pl line
> 29.
> 
> 
> #!/usr/bin/perl
> 
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::Run::StandAloneBlast;
> 
> BEGIN
> {
> 
> $ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
> 
> my $Seq_in = Bio::SeqIO->new (-file
> =>"/home/hafiz/bioperl/fasta", -format => 'fasta');
> my $query = $Seq_in->next_seq();
> 
> my $factory =
> Bio::Tools::Run::StandAloneBlast->new('program'  =>
> 'blastp',
> 
> 'database' => 'ecoli.nt',
> 
> _READMETHOD => "Blast"
>                                                   );
> my $blast_report = $factory->blastall($query);
> my $result = $blast_report->next_result;
> 
> while( my $hit = $result->next_hit()) {
>     print "\thit name: ", $hit->name(), "
> significance: ",
> 
> $hit->significance(), "\n";}
> 
> }
> 
> --- Laurent DOUCHY <l.douchy@gmail.com> wrote:
> 
> > try with this on the top of your code.
> >
> > #!/usr/bin/perl
> >
> > use strict;
> > use Bio::SeqIO;
> > use Bio::Tools::Run::StandAloneBlast;
> >
> > BEGIN
> > {
> >
> >
> $ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
> > }
> >
> > ...
> >
> > 2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
> > > I'm trying to set up a standalone blast and I'm
> > > getting an error message;
> > >
> > > MSG: cannot find path to blastall
> > >
> > > and i have running this code under Linux and i
> > also
> > > haven't find blastall file in /usr/local/bin/,
> > what
> > > should i do?
> > >
> > > code:
> > >
> > > #!/usr/bin/perl
> > >
> > > use strict;
> > > use Bio::SeqIO;
> > > use Bio::Tools::Run::StandAloneBlast;
> > >
> > > my $Seq_in = Bio::SeqIO->new (-file
> > > =>"/home/hafiz/bioperl/fasta", -format =>
> > 'fasta');
> > > my $query = $Seq_in->next_seq();
> > >
> > > my $factory =
> > > Bio::Tools::Run::StandAloneBlast->new('program'
> > =>
> > > 'blastp',
> > >
> > > 'database' => 'ecoli.nt',
> > >
> > > _READMETHOD => "Blast"
> > >
> > );
> > > my $blast_report = $factory->blastall($query);
> > > my $result = $blast_report->next_result;
> > >
> > > while( my $hit = $result->next_hit()) {
> > >     print "\thit name: ", $hit->name(), "
> > > significance: ",
> > >
> > > $hit->significance(), "\n";}
> > >
> > > Send instant messages to your online friends
> > http://uk.messenger.yahoo.com
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > >
> >
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
> 
> Send instant messages to your online friends http://uk.messenger.yahoo.com
>

From n.haigh at sheffield.ac.uk  Wed Jun 22 03:51:30 2005
From: n.haigh at sheffield.ac.uk (Nathan Haigh)
Date: Wed Jun 22 03:42:58 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
In-Reply-To: <42B815CC.3090009@uni-muenster.de>
Message-ID: <!~!UENERkVCMDkAAQACAAAAAAAAAAAAAAAAABgAAAAAAAAAIBuBbth5gEeZS9eEGziB38KAAAAQAAAANcjfm0t0Eki38RGFla7AxgEAAAAA@sheffield.ac.uk>

Atlas Web tools also provide a web based service that is capable of doing
this:
http://bioinformatics.ubc.ca/atlas/webtools/gi2tax.php

http://bioinformatics.ubc.ca/atlas/webtools/

They use the gi2taxonid file from ncbi as mentioned by Jason. I personally
create a DB_File of the gi2taxonid file - if your working with a species for
which sequences are being rapidly sequenced you'll have to download the file
on a regular basis to ensure the new GI numbners are mapped to a taxonid.

Nath


-----Original Message-----
From: bioperl-l-bounces@portal.open-bio.org
[mailto:bioperl-l-bounces@portal.open-bio.org] On Behalf Of Michael Spitzer
Sent: 21 June 2005 14:28
To: bioperl-l@bioperl.org
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?

Dear All,

For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the taxon 
ID as given in the corresponding full GenBank record. Which is the 
easiest way to accomplish this task automatically? Does Bioperl help? 
Can one access this function via the NCBI website (possibly, using 
Bioperl)? Or, does one have to download the whole GenBank database?

All I could find out is that there is a function 'gi2taxid' in the NCBI 
toolkit, but I have no experience with using the toolkit, and I hope 
that there is an easier 'Bioperl' way to solve the problem - could 
BIO::DB::NCBIHelper be the way to go? Any help or hints are greatly 
appreciated!

Kind regards,

Michael Spitzer
_______________________________________________
Bioperl-l mailing list
Bioperl-l@portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l


From ro_phls2 at dh.gov.hk  Wed Jun 22 05:11:32 2005
From: ro_phls2 at dh.gov.hk (Andrew Leung)
Date: Wed Jun 22 05:01:53 2005
Subject: [Bioperl-l] Which version of standalone BLAST binary to use?
Message-ID: <20050622090958.FQU7020.pimx07@Leungkcro>

Hello,
My workstation is running with an "Intel 3.2GHz/1MB Xeon (EM64T) Processor"
and "Redhat Linux Enterprise WS for AMD64/EM64T". Which binary version of
standalone BLAST should I install?
The various likely options from NCBI are:
1. linux-ia32 
2. linux-x64
3. linux-ia64
Thank you for your advice.
Andrew

From jason.stajich at duke.edu  Wed Jun 22 09:42:04 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Jun 22 09:34:14 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
In-Reply-To: <1003840011d840032395bf3ed408185b@salmonella.org>
References: <42B815CC.3090009@uni-muenster.de>
	<1003840011d840032395bf3ed408185b@salmonella.org>
Message-ID: <4DC08AC1-230D-424E-B3C6-7A2A745A020F@duke.edu>

cool - i don't remember that being part of the eutils interface  
before - I'll see about adding it to the Bio::DB::Taxonomy module now.

-jason
On Jun 22, 2005, at 2:46 AM, Rob Edwards wrote:

> Possibly the easiest way to do this is using the eutils facilities.
>
> e.g.
>
> This url will retrieve the tax id for gi 1234
> http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi? 
> dbfrom=nucleotide&db=taxonomy&id=1234
>
> will return:
> <eLinkResult>
> <LinkSet>
>     <DbFrom>nucleotide</DbFrom>
>     <IdList>
>         <Id>1234</Id>
>     </IdList>
>     <LinkSetDb>
>         <DbTo>taxonomy</DbTo>
>         <LinkName>nucleotide_taxonomy</LinkName>
>         <Link>
>             <Id>9940</Id>
>         </Link>
>     </LinkSetDb>
> </LinkSet>
> </eLinkResult>
>
> Rob
>
>
> On Jun 21, 2005, at 6:27 AM, Michael Spitzer wrote:
>
>
>> Dear All,
>>
>> For a list of approx. 20 GI numbers (NCBI GenBank IDs) I need the  
>> taxon ID as given in the corresponding full GenBank record. Which  
>> is the easiest way to accomplish this task automatically? Does  
>> Bioperl help? Can one access this function via the NCBI website  
>> (possibly, using Bioperl)? Or, does one have to download the whole  
>> GenBank database?
>>
>> All I could find out is that there is a function 'gi2taxid' in the  
>> NCBI toolkit, but I have no experience with using the toolkit, and  
>> I hope that there is an easier 'Bioperl' way to solve the problem  
>> - could BIO::DB::NCBIHelper be the way to go? Any help or hints  
>> are greatly appreciated!
>>
>> Kind regards,
>>
>> Michael Spitzer
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From jason.stajich at duke.edu  Wed Jun 22 09:45:31 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Wed Jun 22 09:37:48 2005
Subject: [Bioperl-l] cannot find path to blastall
In-Reply-To: <2fb209dd05062200223aeae94a@mail.gmail.com>
References: <2fb209dd0506220003c4c4613@mail.gmail.com>
	<20050622071037.20860.qmail@web52502.mail.yahoo.com>
	<2fb209dd05062200223aeae94a@mail.gmail.com>
Message-ID: <8B55F5EC-819D-4686-9907-ACD926D501EE@duke.edu>

It looks like you are completely resetting the PATH variable - you  
probably want to append that.
Alternatively, you can also say

BEGIN {
     ENV{'BLASTDIR'} = '/path/to/BLAST/dir';
}
use Bio::Tools::Run::StandAloneBlast;


I think you want the BEGIN block in this instance before the use stmt  
to insure the variable is set before the module is included (as we  
setup some of that stuff at include time since those initializations  
are also in a BEGIN block).

-jason

On Jun 22, 2005, at 3:22 AM, Laurent DOUCHY wrote:

> hum ... sory but you must replace the path to blast program. I think
> that the database path is important to.
>
> #!/usr/bin/perl
>
> use strict;
> use Bio::SeqIO;
> use Bio::Tools::Run::StandAloneBlast;
>
>
> BEGIN
> {
> $ENV{PATH}=":yourPath/Blast/blast-2.2.10/bin/:";
> }
>
> my $Seq_in = Bio::SeqIO->new (-file
> =>"/home/hafiz/bioperl/fasta", -format => 'fasta');
> my $query = $Seq_in->next_seq();
>
> my $factory =
> Bio::Tools::Run::StandAloneBlast->new('program'  =>
> 'blastp',
>
> 'database' => 'yourPath/ecoli.nt',
>
> _READMETHOD => "Blast"
>                                                  );
> my $blast_report = $factory->blastall($query);
> my $result = $blast_report->next_result;
>
> while( my $hit = $result->next_hit()) {
>    print "\thit name: ", $hit->name(), "
> significance: ",
>
> $hit->significance(), "\n";}
>
>
>
> 2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
>
>> i have done running this code, and i getting this
>> error;
>>
>> -------------------- WARNING ---------------------
>> MSG: cannot find path to blastall
>> ---------------------------------------------------
>> Can't call method "next_result" on an undefined value
>> at blast1.pl line 22, <GEN0> line 1.
>> BEGIN failed--compilation aborted at blast1.pl line
>> 29.
>>
>>
>> #!/usr/bin/perl
>>
>> use strict;
>> use Bio::SeqIO;
>> use Bio::Tools::Run::StandAloneBlast;
>>
>> BEGIN
>> {
>>
>> $ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
>>
>> my $Seq_in = Bio::SeqIO->new (-file
>> =>"/home/hafiz/bioperl/fasta", -format => 'fasta');
>> my $query = $Seq_in->next_seq();
>>
>> my $factory =
>> Bio::Tools::Run::StandAloneBlast->new('program'  =>
>> 'blastp',
>>
>> 'database' => 'ecoli.nt',
>>
>> _READMETHOD => "Blast"
>>                                                   );
>> my $blast_report = $factory->blastall($query);
>> my $result = $blast_report->next_result;
>>
>> while( my $hit = $result->next_hit()) {
>>     print "\thit name: ", $hit->name(), "
>> significance: ",
>>
>> $hit->significance(), "\n";}
>>
>> }
>>
>> --- Laurent DOUCHY <l.douchy@gmail.com> wrote:
>>
>>
>>> try with this on the top of your code.
>>>
>>> #!/usr/bin/perl
>>>
>>> use strict;
>>> use Bio::SeqIO;
>>> use Bio::Tools::Run::StandAloneBlast;
>>>
>>> BEGIN
>>> {
>>>
>>>
>>>
>> $ENV{PATH}=":/home/bioinfo/Laurent/Utils/Blast/blast-2.2.10/bin/:";
>>
>>> }
>>>
>>> ...
>>>
>>> 2005/6/22, hafiz yusof <khufaz83@yahoo.com>:
>>>
>>>> I'm trying to set up a standalone blast and I'm
>>>> getting an error message;
>>>>
>>>> MSG: cannot find path to blastall
>>>>
>>>> and i have running this code under Linux and i
>>>>
>>> also
>>>
>>>> haven't find blastall file in /usr/local/bin/,
>>>>
>>> what
>>>
>>>> should i do?
>>>>
>>>> code:
>>>>
>>>> #!/usr/bin/perl
>>>>
>>>> use strict;
>>>> use Bio::SeqIO;
>>>> use Bio::Tools::Run::StandAloneBlast;
>>>>
>>>> my $Seq_in = Bio::SeqIO->new (-file
>>>> =>"/home/hafiz/bioperl/fasta", -format =>
>>>>
>>> 'fasta');
>>>
>>>> my $query = $Seq_in->next_seq();
>>>>
>>>> my $factory =
>>>> Bio::Tools::Run::StandAloneBlast->new('program'
>>>>
>>> =>
>>>
>>>> 'blastp',
>>>>
>>>> 'database' => 'ecoli.nt',
>>>>
>>>> _READMETHOD => "Blast"
>>>>
>>>>
>>> );
>>>
>>>> my $blast_report = $factory->blastall($query);
>>>> my $result = $blast_report->next_result;
>>>>
>>>> while( my $hit = $result->next_hit()) {
>>>>     print "\thit name: ", $hit->name(), "
>>>> significance: ",
>>>>
>>>> $hit->significance(), "\n";}
>>>>
>>>> Send instant messages to your online friends
>>>>
>>> http://uk.messenger.yahoo.com
>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>>
>>>>
>>>
>>>
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>>>
>>>>
>>>
>>>
>>
>> Send instant messages to your online friends http:// 
>> uk.messenger.yahoo.com
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12/


From amackey at pcbi.upenn.edu  Wed Jun 22 09:46:09 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Wed Jun 22 09:38:13 2005
Subject: [Bioperl-l] More unresolved issues with Bio::AnnotatableI 
Message-ID: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>


Because AnnotatableI has implementations for add_tag and get_tag that  
invoke Bio::Annotation::OntologyTerm, and therefore Graph::Directed,  
which relies on Scalar::Util::weaken(), therefore I cannot even use  
basic Bio::Seq functionality on any perl that doesn't have weak  
references (oddly, this cropped up in a 5.8.0 install via an RPM that  
was evidently compiled without support for weak references, so this  
isn't just an "ancient perl" problem).

This is something of a showstopper for any 1.6; in effect, we'd need  
to disable Annotation::OntologyTerm use for any Perl without weak  
reference support.

We've said it before, and we need to say it again: the changes made  
to the feature/annotation object model are seriously impeding our  
ability to move forward to a release (and frighteningly, the GBrowse  
distribution now includes those parts of 1.5 that it relies on, so a  
user's BioPerl install could be a hodge-podge of 1.4/1.5 code).  This  
seems important to all GMOD projects, so why hasn't there been any  
work on it?

Thanks,

-Aaron

From khoueiry at ibdm.univ-mrs.fr  Wed Jun 22 06:07:48 2005
From: khoueiry at ibdm.univ-mrs.fr (khoueiry)
Date: Wed Jun 22 09:39:50 2005
Subject: [Bioperl-l] Pattern search with gap
Message-ID: <1119434868.14595.14.camel@DavidLinux>

Skipped content of type multipart/alternative-------------- next part --------------
while($i<=length($seqstring) - $winSize){
	
	my $nucCount = 0;
	my $substring = substr($seqstring, $i, $winSize);
	
	#If the substring doesn't contain nuc or begins with a gap
	if($substring !~ /[AGCT]/ or $substring =~ /^-/){
		$i++;
		next;
	}
	
	#if the substring doesn't contain gap		
	if($substring !~ /-/){
		#print $substring."\n";
		if($substring eq $qseq){
			print "$qseq found on $i..".($i+length($qseq))."\n";
			last;
		}
		$i++;
	}
	
	if($substring =~ /-/){
		$nucCount++ while $substring =~ /[AGCT]/g;
		my $first = $i;
		my $j = 1;
		while($nucCount < length($qseq)){		
			$substring = substr($seqstring, $i, $winSize+$j);
			$j++;
			$nucCount = 0;
			$nucCount++ while $substring =~ /[AGCT]/g;
		}
		my $last = ($i + $winSize+$j) - 1;
		
		if($nucCount = length($qseq)){
			my $gapCount = $substring =~ s/-//g;
			if($substring eq $qseq){
				print "$qseq found on $i..";
				print "$last\t"."with $gapCount Gap(s)\n";
				last;
			}
		}
		
		$i++;
		
		print $substring."\t";
		print $first."..".$last."\t".$nucCount."\n";
		$nucCount = 0;
	}	
}	
From walsh at cenix-bioscience.com  Wed Jun 22 10:04:20 2005
From: walsh at cenix-bioscience.com (Andrew Walsh)
Date: Wed Jun 22 09:55:53 2005
Subject: [Bioperl-l] Pattern search with gap
In-Reply-To: <1119434868.14595.14.camel@DavidLinux>
References: <1119434868.14595.14.camel@DavidLinux>
Message-ID: <42B96FE4.3040400@cenix-bioscience.com>

Hello,

You could try substituting N's for your gaps and then use WU-BLAST with 
a wordsize equal to your input sequence (setting penalties for indels 
very high to ensure perfect matches).  I imagine that would be faster 
than scanning the sequence as you are doing.

Hope that helps,

Andrew

khoueiry wrote:
> Hello,
> 
> I want to parse a gapped sequence and search for a pattern in it... What
> is important for me is to get the Position of the pattern Start and End
> taking gaps into account:
> 
> i.e : 
> my $seqstring =
> "--------------------CAAAATAAATAGGTTATACAGAAACA---------------------AGATAAAAATTACA";
> my $qseq    = "CAAGATA";
> 
> so the result should give me : start  = 61 and End  = 89
> 
> I wrote a program to do that.. It works well but when working with very
> large sequences (And I have a lot of them), it take a lot of time.... 
> 
> In fact, my program parse the sequence with a sliding window equal the
> length of the pattern...
> 
> the while loop is attached :
> 
> Any suggestion will be appreciated....
> 
> 
> Pierre
> 
> 
> 
> 
> 
> ------------------------------------------------------------------------
> 
> while($i<=length($seqstring) - $winSize){
> 	
> 	my $nucCount = 0;
> 	my $substring = substr($seqstring, $i, $winSize);
> 	
> 	#If the substring doesn't contain nuc or begins with a gap
> 	if($substring !~ /[AGCT]/ or $substring =~ /^-/){
> 		$i++;
> 		next;
> 	}
> 	
> 	#if the substring doesn't contain gap		
> 	if($substring !~ /-/){
> 		#print $substring."\n";
> 		if($substring eq $qseq){
> 			print "$qseq found on $i..".($i+length($qseq))."\n";
> 			last;
> 		}
> 		$i++;
> 	}
> 	
> 	if($substring =~ /-/){
> 		$nucCount++ while $substring =~ /[AGCT]/g;
> 		my $first = $i;
> 		my $j = 1;
> 		while($nucCount < length($qseq)){		
> 			$substring = substr($seqstring, $i, $winSize+$j);
> 			$j++;
> 			$nucCount = 0;
> 			$nucCount++ while $substring =~ /[AGCT]/g;
> 		}
> 		my $last = ($i + $winSize+$j) - 1;
> 		
> 		if($nucCount = length($qseq)){
> 			my $gapCount = $substring =~ s/-//g;
> 			if($substring eq $qseq){
> 				print "$qseq found on $i..";
> 				print "$last\t"."with $gapCount Gap(s)\n";
> 				last;
> 			}
> 		}
> 		
> 		$i++;
> 		
> 		print $substring."\t";
> 		print $first."..".$last."\t".$nucCount."\n";
> 		$nucCount = 0;
> 	}	
> }	
> 
> 
> ------------------------------------------------------------------------
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 
------------------------------------------------------------------
Andrew Walsh, M.Sc.
Bioinformatics Software Engineer
IT Unit
Cenix BioScience GmbH
Tatzberg 47
01307 Dresden
Germany
Tel. +49-351-4173 137
Fax  +49-351-4173 109

public key: http://www.cenix-bioscience.com/public_keys/walsh.gpg
------------------------------------------------------------------

From hotafin at gmail.com  Wed Jun 22 10:13:31 2005
From: hotafin at gmail.com (Tamas Horvath)
Date: Wed Jun 22 10:05:00 2005
Subject: [Bioperl-l] Pattern search with gap
In-Reply-To: <1119434868.14595.14.camel@DavidLinux>
References: <1119434868.14595.14.camel@DavidLinux>
Message-ID: <c343d70805062207133bf817dc@mail.gmail.com>

Here's a much simpler code:

#!/usr/bin/perl

#                        10        20        30        40   45   50   
    60        7072
#              
123456789012345678901234567890123456789012345678901234567890123456789012345678901
my $seqstring ="--------------------CAAAATAAATAGGTTATACAGAAACA---------------------AGATAAAAATTACA";
my $qseq    = "CAAGATA";

my @qqq = split (//,$qseq);
my $pat = join('-*',@qqq);

my $pat_rege = qr/$pat/;

$seqstring =~ /$pat_rege/;
my $before = $`;
my $match_seq = $&;
my $before_length = length $before;
my $mseq_length = length $match_seq;
my $start = 1 + $before_length;
my $end = $before_length + $mseq_length;
print "Start:$start End:$end\n";
#Start:45 End:72

It should be quite fast. try it out, and let me know, if it works well for you!

Hota

On 6/22/05, khoueiry <khoueiry@ibdm.univ-mrs.fr> wrote:
> Hello,
> 
> I want to parse a gapped sequence and search for a pattern in it... What
> is important for me is to get the Position of the pattern Start and End
> taking gaps into account:
> 
> i.e :
> my $seqstring =
> "--------------------CAAAATAAATAGGTTATACAGAAACA---------------------AGATAAAAATTACA";
> my $qseq    = "CAAGATA";
> 
> so the result should give me : start  = 61 and End  = 89
> 
> I wrote a program to do that.. It works well but when working with very
> large sequences (And I have a lot of them), it take a lot of time....
> 
> In fact, my program parse the sequence with a sliding window equal the
> length of the pattern...
> 
> the while loop is attached :
> 
> Any suggestion will be appreciated....
> 
> 
> Pierre
> 
> 
> 
> --
> ==========================
> Pierre Khoueiry
> LGPD/IBDM
> Campus de Luminy, Case 907
> 13288 Marseille cedex 9, France
> Tel : +33 (0)4 91 82 94 18
> Fax : +33 (0)4 91 82 06 82
> 
> ==========================
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
>

From hotafin at gmail.com  Wed Jun 22 10:26:52 2005
From: hotafin at gmail.com (Tamas Horvath)
Date: Wed Jun 22 10:18:48 2005
Subject: [Bioperl-l] Pattern search with gap
In-Reply-To: <c343d70805062207133bf817dc@mail.gmail.com>
References: <1119434868.14595.14.camel@DavidLinux>
	<c343d70805062207133bf817dc@mail.gmail.com>
Message-ID: <c343d70805062207262ff7d8f1@mail.gmail.com>

And a slightly different code for multiple recognition:

my $seqstring ="--------------------CAAAATAAATAGGTTATACAGAAACA---------------------AGATAAAAATTACA--CAAG-AT-A----";
my $qseq    = "CAAGATA";

my @qqq = split (//,$qseq);
my $pat = join('-*',@qqq);

my $pat_rege = qr/$pat/;

while ($seqstring =~ /$pat_rege/g) {
my $before = $`;
my $match_seq = $&;
my $before_length = length $before;
my $mseq_length = length $match_seq;
my $start = 1 + $before_length;
my $end = $before_length + $mseq_length;
print "Start:$start End:$end\n";
}
#Start:45 End:72
#Start:84 End:92

From patrick at bennour.de  Wed Jun 22 11:43:29 2005
From: patrick at bennour.de (Patrick Bennour)
Date: Wed Jun 22 11:34:58 2005
Subject: [Bioperl-l] Looking for an Application to visualize Promoter
	Prediction results
Message-ID: <002301c57741$23c1f320$2101a8c0@windowsxp>

Dear All,

I am looking for an application that does at least some of the following.

Input: different promoter prediction analysis programs (like CpgProD, Eponine, FirstEF, McPromoter)
The application should then
- automatically parse the results
- visualize the results in an graphical diagram,
  that contains the input sequence
- visualize the different predictions in an comparative diagram
- combine some predictions to improve prediction quality

Thanks for your suggestions

From khoueiry at ibdm.univ-mrs.fr  Wed Jun 22 12:02:32 2005
From: khoueiry at ibdm.univ-mrs.fr (khoueiry)
Date: Wed Jun 22 11:52:53 2005
Subject: [Bioperl-l] Pattern search with gap
In-Reply-To: <c343d70805062207262ff7d8f1@mail.gmail.com>
References: <1119434868.14595.14.camel@DavidLinux>
	<c343d70805062207133bf817dc@mail.gmail.com>
	<c343d70805062207262ff7d8f1@mail.gmail.com>
Message-ID: <1119456152.14595.24.camel@DavidLinux>

Thanks,

In fact, after posting my mail, I tried another loop by. It detect
position (by pos()) without the gaps and then I loop on the gapped
sequence counting nucleotides and gaps till i get to the pos() already
detected thus. the new start is the number of nucleotides and gaps... 

Tamas, I tried your loop and it is  a lot faster than my new one ..
Thanks,, I will go for it..

Pierre





Le mercredi 22 juin 2005 ? 16:26 +0200, Tamas Horvath a ?crit :

> And a slightly different code for multiple recognition:
> 
> my $seqstring ="--------------------CAAAATAAATAGGTTATACAGAAACA---------------------AGATAAAAATTACA--CAAG-AT-A----";
> my $qseq    = "CAAGATA";
> 
> my @qqq = split (//,$qseq);
> my $pat = join('-*',@qqq);
> 
> my $pat_rege = qr/$pat/;
> 
> while ($seqstring =~ /$pat_rege/g) {
> my $before = $`;
> my $match_seq = $&;
> my $before_length = length $before;
> my $mseq_length = length $match_seq;
> my $start = 1 + $before_length;
> my $end = $before_length + $mseq_length;
> print "Start:$start End:$end\n";
> }
> #Start:45 End:72
> #Start:84 End:92
From hotafin at gmail.com  Wed Jun 22 12:30:20 2005
From: hotafin at gmail.com (Tamas Horvath)
Date: Wed Jun 22 12:24:27 2005
Subject: [Bioperl-l] mystery
Message-ID: <c343d7080506220930715ea14a@mail.gmail.com>

while ($pdb_data =~ /(REMARK 999.*)/g) {
     die "die2";
    }
die"die1" if $pdb_data =~ /(REMARK 999.*)/;

the following code terminates with "die1". Does anyone know why?
the $pdb_data is a string of a pdb entry (1PHK)

it has the following REMARK 999 lines:

REMARK 999
REMARK 999 SEQUENCE
REMARK 999 1PHK       SWS     P00518       1 -    14 NOT IN ATOMS LIST
REMARK 999 1PHK       SWS     P00518     292 -   386 NOT IN ATOMS LIST

From laurichj at bioinfo.ucr.edu  Wed Jun 22 13:02:10 2005
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Wed Jun 22 12:53:32 2005
Subject: [Bioperl-l] mystery
In-Reply-To: <c343d7080506220930715ea14a@mail.gmail.com>
References: <c343d7080506220930715ea14a@mail.gmail.com>
Message-ID: <20050622170210.GA1203@bioinfo.ucr.edu>

On Wed 06/22/05 18:30, Tamas Horvath wrote:
> while ($pdb_data =~ /(REMARK 999.*)/g) {
>      die "die2";
>     }
> die"die1" if $pdb_data =~ /(REMARK 999.*)/;
> 
> the following code terminates with "die1". Does anyone know why?
> the $pdb_data is a string of a pdb entry (1PHK)

Odd seems to work here (as expected, "die2"). Check the odd perl
variables that change the behavior of things (man perlvar).

-- 

------------------------------------------------------
| Josh Lauricha            | Ford, you're turning    |
| laurichj@bioinfo.ucr.edu | into a penguin. Stop    |
| Bioinformatics, UCR      | it                      |
|----------------------------------------------------|
| OpenPG:                                            |
|  4E7D 0FC0 DB6C E91D 4D7B C7F3 9BE9 8740 E4DC 6184 |
|----------------------------------------------------|
| Geek Code: Version 3.12                            |
| GAT/CS$/IT$ d+ s-: a-->--- C++++$ UL++++$ P++ L++++|
| $E--- W+ N o? K? w--(---) O? M+(++) V? PS++ PE-(--)|
| Y+ PGP+++ t--- 5+++ X+ R tv DI++ D--- G++          |
| e++ h- r++ z?                                      |
|----------------------------------------------------|
From hotafin at gmail.com  Wed Jun 22 13:03:24 2005
From: hotafin at gmail.com (Tamas Horvath)
Date: Wed Jun 22 12:54:46 2005
Subject: [Bioperl-l] mystery
In-Reply-To: <42B998BB.5040601@virchow.uni-wuerzburg.de>
References: <c343d7080506220930715ea14a@mail.gmail.com>
	<42B998BB.5040601@virchow.uni-wuerzburg.de>
Message-ID: <c343d708050622100354f77e9e@mail.gmail.com>

well, I have some other loops in my script wich are all work fine.
Maybe this is some sort of mysterious bug of the IDE's debugger...
thank's anyway.

PS.: Afterwards I've tested it "outside" the IDE, and it worked fine
for me to...

On 6/22/05, Andreas Boehm <andreas.boehm@virchow.uni-wuerzburg.de> wrote:
> Hi,
> 
> it works fine with my perl version:
> perl5 (revision 5.0 version 8 subversion 0)
> 
> Maybe you have a buggy compilation, that has a problem with the /g in
> your while-loop?
> 
> regards,
> Andreas Boehm
> 
> Tamas Horvath wrote:
> > while ($pdb_data =~ /(REMARK 999.*)/g) {
> >      die "die2";
> >     }
> > die"die1" if $pdb_data =~ /(REMARK 999.*)/;
> >
> > the following code terminates with "die1". Does anyone know why?
> > the $pdb_data is a string of a pdb entry (1PHK)
> >
> > it has the following REMARK 999 lines:
> >
> > REMARK 999
> > REMARK 999 SEQUENCE
> > REMARK 999 1PHK       SWS     P00518       1 -    14 NOT IN ATOMS LIST
> > REMARK 999 1PHK       SWS     P00518     292 -   386 NOT IN ATOMS LIST
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> 
>

From raoul.bonnal at itb.cnr.it  Wed Jun 22 15:29:31 2005
From: raoul.bonnal at itb.cnr.it (Raoul Jean Pierre Bonnal)
Date: Wed Jun 22 15:21:15 2005
Subject: [Bioperl-l] Read alignment produced by blast's option -m (4|6)
Message-ID: <yqtzZ5QH.1119468571.0788480.rbonnal@mail.mi.cnr.it>

Hi,

do you know a way to load the output produced by balstn using the option
-m 4 or 6, so that then I can manage it as a multi alignment for example
with the Bio::Align ?

RJP

From rvosa at sfu.ca  Wed Jun 22 15:37:14 2005
From: rvosa at sfu.ca (Rutger Vos)
Date: Wed Jun 22 15:28:45 2005
Subject: [Bioperl-l] CORBA::ORBit on Win32 ActivePerl v5.8.4
Message-ID: <42B9BDEA.7010301@sfu.ca>

Dear fellow BioPerlers,

has anyone been able to get CORBA::ORBit to install on native Win32 
(ActivePerl)? How did you do it (compiler, flags, libs)?

Thanks!

Rutger

-- 
++++++++++++++++++++++++++++++++++++++++++++
Rutger Vos, PhD. candidate
Department of Biological Sciences
Simon Fraser University
8888 University Drive
Burnaby, BC, V5A1S6
Phone: 604-291-5625 
Fax: 604-291-3496
Personal site: http://www.sfu.ca/~rvosa
FAB* lab: http://www.sfu.ca/~fabstar
++++++++++++++++++++++++++++++++++++++++++++


From bioperlanand at yahoo.com  Wed Jun 22 16:17:16 2005
From: bioperlanand at yahoo.com (Anand Venkatraman)
Date: Wed Jun 22 16:10:03 2005
Subject: [Bioperl-l] How to convert GFF to GAME XML
Message-ID: <20050622201716.73996.qmail@web32905.mail.mud.yahoo.com>

Hi,

Does anybody know if there is a bioperl way of
converting a gff file to "game xml" format.

If the answer is no, can anybody suggest some tools.

Thanks in advance.

Anand


		
__________________________________ 
Discover Yahoo! 
Use Yahoo! to plan a weekend, have fun online and more. Check it out! 
http://discover.yahoo.com/
From lstein at cshl.edu  Wed Jun 22 17:17:50 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Wed Jun 22 17:10:03 2005
Subject: [Bioperl-l] Drawing sequences in the "other" direction
In-Reply-To: <1119233991.42b627c7b995b@webmail.njit.edu>
References: <8975119BCD0AC5419D61A9CF1A923E95020679A8@iahce2knas1.iah.bbsrc.reserved>
	<1119233991.42b627c7b995b@webmail.njit.edu>
Message-ID: <200506221717.50991.lstein@cshl.edu>

That's the exact solution I would have proposed.

Lincoln

On Sunday 19 June 2005 10:19 pm, hz5@njit.edu wrote:
> Michael,
> This is what I did to solve this problem:
> I will have one panel render +1 seq, then use another panel to render the
> -1 seq in the "flipped" direction, then use copy to join the 2 panel into
> one picture.
>
> haibo
>
> Quoting "michael watson (IAH-C)" <michael.watson@bbsrc.ac.uk>:
> > Hi Lincoln, List
> >
> > Yeah, flip works great on the whole panel, but I have my top track which
> > is a genome in the +1 direction, then I want to add another track which
> > is a second genome, aligned to the first, but it runs in the -1
> > direction, I want to flip the second track but not the first...
> >
> > Would running through all the features and re-jigging the co-ordinates
> > of all the features work?  I was hoping to avoid it... though I guess
> > somewhere buried in the guts of Bio::Graphics::Panel, this code must
> > already be written...?
> >
> > Mick
> >
> >
> >
> > -----Original Message-----
> > From:	Lincoln Stein [mailto:lstein@cshl.edu]
> > Sent:	Sun 19/06/2005 6:12 PM
> > To:	bioperl-l@portal.open-bio.org
> > Cc:	michael watson (IAH-C)
> > Subject:	Re: [Bioperl-l] Drawing sequences in the "other" direction
> >
> > Hi Michael,
> >
> > Have you tried passing -flip=>1 to Bio::Graphics::Panel->new()?
> >
> > Lincoln
> >
> > On Tuesday 24 May 2005 08:16 am, michael watson (IAH-C) wrote:
> > > Hi
> > >
> > > I'm trying to draw images of bits of aligned bacterial genomes with
> >
> > the
> >
> > > genes marked on as features.  Reasonably often a gene in one species
> >
> > is
> >
> > > on the +1 strand, and in another species it's on the -1 strand.  I
> >
> > want
> >
> > > to draw an image of these genes "aligned", one on top of the other,
> >
> > both
> >
> > > facing in the same direction (obviously those that I have flipped I
> >
> > will
> >
> > > annotate as such).
> > >
> > > I have been drawing images using Bio::Graphics::Panel and the
> >
> > add_track
> >
> > > method, but I can't figure out how to draw the sequence, and all
> >
> > it's
> >
> > > features, running in the opposite direction.  In fact, I doubt there
> >
> > is
> >
> > > one unless someone can point it out?
> > >
> > > I did think of drawing them in the right orientation and using the
> >
> > linux
> >
> > > "convert" command to flip the image, but then all the text is
> >
> > backwards!
> >
> > > Any help appreciated
> > >
> > > Mick
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l@portal.open-bio.org
> > > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
> > --
> > Lincoln D. Stein
> > Cold Spring Harbor Laboratory
> > 1 Bungtown Road
> > Cold Spring Harbor, NY 11724
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> =========================================================
> Haibo Zhang, PhD
> Computational Biology
> http://www.cyberpostdoc.org/
> Share postdoc information in cyberspace. Welcome your stories, suggestions
> and advice!
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From lstein at cshl.edu  Wed Jun 22 17:21:14 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Wed Jun 22 17:13:07 2005
Subject: [Bioperl-l] scales in xyplot.pm negative values Bio::Graphics for
	GBrowse
In-Reply-To: <1118914253.8228.23.camel@localhost.localdomain>
References: <1118517484.8515.12.camel@localhost.localdomain>
	<200506141400.37019.lstein@cshl.edu>
	<1118914253.8228.23.camel@localhost.localdomain>
Message-ID: <200506221721.15784.lstein@cshl.edu>

I like the second choice better!

Lincoln

On Thursday 16 June 2005 05:30 am, Albert Vilella wrote:
> Hi all,
>
> I post this here for suggestions:
>
> How would we like to set the scale or xyplots with respect to
> min_value and max_value in cases where negative values exist. For
> example:
>
> Ex1: min_value=-1 max_value=5
>
> Set: 0 to the middle of the plot, then plot from +5 to -5:
>
> +5 +
>
>
>
>  0 +-----------------------------------------
>
>
>
> -5 +
>
> Set: the scale to plot from +5 to -1, which will fill up all the
> plot (as in UCSC wiggle tracks):
>
> +5 +
>
>
>
>
>
>  0 +-----------------------------------------
>
> -1 +
>
> Comments?
>
> Bests,
>
>     Albert.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From lstein at cshl.edu  Wed Jun 22 17:21:14 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Wed Jun 22 17:13:12 2005
Subject: [Bioperl-l] scales in xyplot.pm negative values Bio::Graphics for
	GBrowse
In-Reply-To: <1118914253.8228.23.camel@localhost.localdomain>
References: <1118517484.8515.12.camel@localhost.localdomain>
	<200506141400.37019.lstein@cshl.edu>
	<1118914253.8228.23.camel@localhost.localdomain>
Message-ID: <200506221721.15784.lstein@cshl.edu>

I like the second choice better!

Lincoln

On Thursday 16 June 2005 05:30 am, Albert Vilella wrote:
> Hi all,
>
> I post this here for suggestions:
>
> How would we like to set the scale or xyplots with respect to
> min_value and max_value in cases where negative values exist. For
> example:
>
> Ex1: min_value=-1 max_value=5
>
> Set: 0 to the middle of the plot, then plot from +5 to -5:
>
> +5 +
>
>
>
>  0 +-----------------------------------------
>
>
>
> -5 +
>
> Set: the scale to plot from +5 to -1, which will fill up all the
> plot (as in UCSC wiggle tracks):
>
> +5 +
>
>
>
>
>
>  0 +-----------------------------------------
>
> -1 +
>
> Comments?
>
> Bests,
>
>     Albert.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From lstein at cshl.edu  Wed Jun 22 17:25:22 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Wed Jun 22 17:17:02 2005
Subject: [Bioperl-l] Problems with Bio/Graphics/Feature.pm
In-Reply-To: <0DCE537D-CFDA-43B6-A8D8-687BAC352794@duke.edu>
References: <8975119BCD0AC5419D61A9CF1A923E950121BB7B@iahce2knas1.iah.bbsrc.reserved>
	<0DCE537D-CFDA-43B6-A8D8-687BAC352794@duke.edu>
Message-ID: <200506221725.23138.lstein@cshl.edu>

Thanks to Jason for fixing that. I'm afraid that I've been partly responsible 
for the drift.

Lincoln

On Monday 09 May 2005 03:54 pm, Jason Stajich wrote:
> yes I know - that is why I fixed that script in CVS just now.  'you'
> was meant generally - fault of the script and API drifting apart so
> not your (Mick) fault at all.
>
> -j
>
> On May 9, 2005, at 3:11 PM, michael watson ((IAH-C)) wrote:
> > Hi
> >
> > I didn't deliberately pass a RichSeq object - a call in the
> > render_sequence.pl script did i.e. render_sequence.pl doesn't work
> > "out of the box".
> >
> > I think it's this piece of code that breaks it:
> >
> > $panel->add_track(arrow => $seq,
> >   -bump => 0,
> >   -double=>1,
> >   -tick => 2);
> >
> > Mick
> >
> > :-)
> >
> > -----Original Message-----
> > From:    Jason Stajich [mailto:jason.stajich@duke.edu]
> > Sent:    Mon 09/05/2005 7:27 PM
> > To:    michael watson (IAH-C)
> > Cc:    bioperl-l@portal.open-bio.org
> > Subject:    Re: [Bioperl-l] Problems with Bio/Graphics/Feature.pm
> >
> > you need to pass in a SeqFeature::Generic or Graphics::Feature obj
> > instead of Sequence object.
> >
> > I updated the code in CVS:
> >
> > http://cvs.open-bio.org/cgi-bin/viewcvs/viewcvs.cgi/bioperl-live/
> > examples/biographics/render_sequence.pl?rev=1.2&cvsroot=bioperl
> >
> > [fyi Bio::DB Bio::Graphics developers]
> > There was something else weird about how this was working - somehow
> > Bio::Location objects are getting passed to the description and label
> > functions.  I don't quite understand, might be my local code playing
> > too.
> >
> > -jason
> >
> > On May 9, 2005, at 6:29 AM, michael watson ((IAH-C)) wrote:
> >> Hi
> >>
> >> I'm hacking around with the render_sequence.pl example script and
> >> keep
> >> getting errors:
> >>
> >> Can't locate object method "seq_id" via package
> >> "Bio::Seq::RichSeq" at
> >> /usr/local/bioperl-1.5.0/Bio/Graphics/Feature.pm line 269, <DATA>
> >> line
> >> 191.
> >>
> >> I also get a similar message about not being able to locate object
> >> method "start", which is called on the next line of
> >> Bio::Graphics::Feature.pm
> >>
> >> I vaguely recall asking about this previously - was a solution ever
> >> presented?
> >>
> >> Many thanks in advance
> >>
> >> Mick
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l@portal.open-bio.org
> >> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From sm_middha at yahoo.com  Wed Jun 22 18:24:23 2005
From: sm_middha at yahoo.com (sumit middha)
Date: Wed Jun 22 18:16:28 2005
Subject: [Bioperl-l] FASTA.pm issue
Message-ID: <20050622222423.9075.qmail@web30712.mail.mud.yahoo.com>


Hello,

I have a trouble with using fasta module

I use the required statements

use Bio::DB::Fasta;
use Bio::Seq;

The error was:

AnyDBM_File doesn't define an EXISTS method at
/usr/local/lib/perl5/site_perl/5.8.5/Bio/DB/Fasta.pm
line 577

thanks,
sm

__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From taerwin at tpg.com.au  Wed Jun 22 19:47:53 2005
From: taerwin at tpg.com.au (Tim Erwin)
Date: Wed Jun 22 19:43:25 2005
Subject: [Bioperl-l] Which version of standalone BLAST binary to use?
In-Reply-To: <20050622090958.FQU7020.pimx07@Leungkcro>
References: <20050622090958.FQU7020.pimx07@Leungkcro>
Message-ID: <1119484073.5442.73.camel@bacp4>

Hi Andrew,

The linux-ia32 should work,

The linux-ia64 if for the intel itanium and the x64 is for x86_64 (AMD
and am not sure how this would go on the xeon).

The Xeon (EM64T) should be able to run both 64 and 32 bit binaries, so
you shouldn't have any problems with the ia32.

Regards,

Tim

On Wed, 2005-06-22 at 17:11 +0800, Andrew Leung wrote:
> Hello,
> My workstation is running with an "Intel 3.2GHz/1MB Xeon (EM64T) Processor"
> and "Redhat Linux Enterprise WS for AMD64/EM64T". Which binary version of
> standalone BLAST should I install?
> The various likely options from NCBI are:
> 1. linux-ia32 
> 2. linux-x64
> 3. linux-ia64
> Thank you for your advice.
> Andrew
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

From allenday at ucla.edu  Wed Jun 22 20:43:44 2005
From: allenday at ucla.edu (Allen Day)
Date: Wed Jun 22 20:35:12 2005
Subject: [Bioperl-l] Re: More unresolved issues with Bio::AnnotatableI 
In-Reply-To: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
References: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
Message-ID: <Pine.LNX.4.58.0506221735130.6755@sumo.ctrl.ucla.edu>

Hi,

Where is the dependency on Graph::Directed introduced?  A grep through
Bio/* in bioperl-live on HEAD reveals several references in the POD to
Graph.pm, but I don't see it anywhere in the code.

I don't know if Chris Mungall's GO-Perl API removes the dependency on
Graph::Directed, but it is certainly easier to use than Bio::OntologyIO as
a means to access the OBO ontologies.  I'm willing to look into converting
Bio::Annotation::OntologyTerm to use GO::Model::* instead of
Bio::Ontology::Term, but it may interfere with other projects using the
class (e.g. bioperl-db).

Hilmar, I know you were looking at the GO-Perl codebase recently, can you
comment on any of the above?

-Allen


On Wed, 22 Jun 2005, Aaron J. Mackey wrote:

> 
> Because AnnotatableI has implementations for add_tag and get_tag that  
> invoke Bio::Annotation::OntologyTerm, and therefore Graph::Directed,  
> which relies on Scalar::Util::weaken(), therefore I cannot even use  
> basic Bio::Seq functionality on any perl that doesn't have weak  
> references (oddly, this cropped up in a 5.8.0 install via an RPM that  
> was evidently compiled without support for weak references, so this  
> isn't just an "ancient perl" problem).
> 
> This is something of a showstopper for any 1.6; in effect, we'd need  
> to disable Annotation::OntologyTerm use for any Perl without weak  
> reference support.
> 
> We've said it before, and we need to say it again: the changes made  
> to the feature/annotation object model are seriously impeding our  
> ability to move forward to a release (and frighteningly, the GBrowse  
> distribution now includes those parts of 1.5 that it relies on, so a  
> user's BioPerl install could be a hodge-podge of 1.4/1.5 code).  This  
> seems important to all GMOD projects, so why hasn't there been any  
> work on it?
> 
> Thanks,
> 
> -Aaron
> 
From amackey at pcbi.upenn.edu  Wed Jun 22 20:45:08 2005
From: amackey at pcbi.upenn.edu (Aaron J. Mackey)
Date: Wed Jun 22 20:40:37 2005
Subject: [Bioperl-l] Re: More unresolved issues with Bio::AnnotatableI
In-Reply-To: <Pine.LNX.4.58.0506221735130.6755@sumo.ctrl.ucla.edu>
References: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
	<Pine.LNX.4.58.0506221735130.6755@sumo.ctrl.ucla.edu>
Message-ID: <42BA0614.90102@pcbi.upenn.edu>

I think Graph::Directed comes with Graph (since Graph is just a wrapper 
for Graph::Directed and Graph::Undirected)

-Aaron

Allen Day wrote:

> Hi,
> 
> Where is the dependency on Graph::Directed introduced?  A grep through
> Bio/* in bioperl-live on HEAD reveals several references in the POD to
> Graph.pm, but I don't see it anywhere in the code.
> 
> I don't know if Chris Mungall's GO-Perl API removes the dependency on
> Graph::Directed, but it is certainly easier to use than Bio::OntologyIO as
> a means to access the OBO ontologies.  I'm willing to look into converting
> Bio::Annotation::OntologyTerm to use GO::Model::* instead of
> Bio::Ontology::Term, but it may interfere with other projects using the
> class (e.g. bioperl-db).
> 
> Hilmar, I know you were looking at the GO-Perl codebase recently, can you
> comment on any of the above?
> 
> -Allen
> 
> 
> On Wed, 22 Jun 2005, Aaron J. Mackey wrote:
> 
> 
>>Because AnnotatableI has implementations for add_tag and get_tag that  
>>invoke Bio::Annotation::OntologyTerm, and therefore Graph::Directed,  
>>which relies on Scalar::Util::weaken(), therefore I cannot even use  
>>basic Bio::Seq functionality on any perl that doesn't have weak  
>>references (oddly, this cropped up in a 5.8.0 install via an RPM that  
>>was evidently compiled without support for weak references, so this  
>>isn't just an "ancient perl" problem).
>>
>>This is something of a showstopper for any 1.6; in effect, we'd need  
>>to disable Annotation::OntologyTerm use for any Perl without weak  
>>reference support.
>>
>>We've said it before, and we need to say it again: the changes made  
>>to the feature/annotation object model are seriously impeding our  
>>ability to move forward to a release (and frighteningly, the GBrowse  
>>distribution now includes those parts of 1.5 that it relies on, so a  
>>user's BioPerl install could be a hodge-podge of 1.4/1.5 code).  This  
>>seems important to all GMOD projects, so why hasn't there been any  
>>work on it?
>>
>>Thanks,
>>
>>-Aaron
>>
From hlapp at gmx.net  Thu Jun 23 01:41:20 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun 23 01:33:07 2005
Subject: [Bioperl-l] Re: More unresolved issues with Bio::AnnotatableI 
In-Reply-To: <Pine.LNX.4.58.0506221735130.6755@sumo.ctrl.ucla.edu>
References: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
	<Pine.LNX.4.58.0506221735130.6755@sumo.ctrl.ucla.edu>
Message-ID: <1a67060b1ade16d12f992949ed0ca5ae@gmx.net>

Graph::Directed is part of the Graph.pm package. In fact, the graph 
used by SimpleGOEngine is an instance of Graph::Directed.

If accessing $seq->annotation would now need Graph::Directed installed 
and functional, then the reason almost certainly is due to the changes 
Aaron pinpoints. More precisely, any ontology term needs to be in an 
ontology, and the ontology needs a backing ontology engine to support 
the graph-based algorithms like traversal etc.

SimpleGOEngine is the default engine being used if you don't specify 
another one, and it itself is merely a wrapper around an instance 
Graph.pm (the superclass of Graph::Directed).

This breaks down on a seemingly simple use case because the modules 
using Graph.pm have been programmed (by ChrisZ and myself) with the 
concept that if you use them you'll almost always also want the engine 
API functional. Now with the transition to a much more pervasive use of 
ontology terms, you easily have a situation in which all you'll ever 
want from a term's ontology is its name.

So I suggest that I (or any taker is welcome) make this more robust by 
loading Graph.pm and friends only on demand within SimpleGOEngine when 
the methods depending on it are actually used.

As for adapting the go-perl API to Bioperl, yes that's what I've done 
but have yet to test. As soon as I'm convinced that it works I'll 
commit it though. Note that this isn't really the panacea to all 
ontology-related problems in Bioperl though. The issue Aaron's hit is 
due to assumptions being made too quick about what a user has installed 
and what she's going to call, hence can be fixed accordingly. Also, 
Graph.pm is not a necessarily dispensible dependency; it implements 
many algorithms on graphs (connected subgraphs, shortest path, etc) 
that go-perl doesn't but which can be very useful. I decided to adapt 
go-perl to Bioperl primarily to finally delegate responsibility for 
dealing with the oddities of the dag-edit and obo-family of file 
formats to those who claim they solved all that :)

	-hilmar

On Jun 22, 2005, at 8:43 PM, Allen Day wrote:

> Hi,
>
> Where is the dependency on Graph::Directed introduced?  A grep through
> Bio/* in bioperl-live on HEAD reveals several references in the POD to
> Graph.pm, but I don't see it anywhere in the code.
>
> I don't know if Chris Mungall's GO-Perl API removes the dependency on
> Graph::Directed, but it is certainly easier to use than 
> Bio::OntologyIO as
> a means to access the OBO ontologies.  I'm willing to look into 
> converting
> Bio::Annotation::OntologyTerm to use GO::Model::* instead of
> Bio::Ontology::Term, but it may interfere with other projects using the
> class (e.g. bioperl-db).
>
> Hilmar, I know you were looking at the GO-Perl codebase recently, can 
> you
> comment on any of the above?
>
> -Allen
>
>
> On Wed, 22 Jun 2005, Aaron J. Mackey wrote:
>
>>
>> Because AnnotatableI has implementations for add_tag and get_tag that
>> invoke Bio::Annotation::OntologyTerm, and therefore Graph::Directed,
>> which relies on Scalar::Util::weaken(), therefore I cannot even use
>> basic Bio::Seq functionality on any perl that doesn't have weak
>> references (oddly, this cropped up in a 5.8.0 install via an RPM that
>> was evidently compiled without support for weak references, so this
>> isn't just an "ancient perl" problem).
>>
>> This is something of a showstopper for any 1.6; in effect, we'd need
>> to disable Annotation::OntologyTerm use for any Perl without weak
>> reference support.
>>
>> We've said it before, and we need to say it again: the changes made
>> to the feature/annotation object model are seriously impeding our
>> ability to move forward to a release (and frighteningly, the GBrowse
>> distribution now includes those parts of 1.5 that it relies on, so a
>> user's BioPerl install could be a hodge-podge of 1.4/1.5 code).  This
>> seems important to all GMOD projects, so why hasn't there been any
>> work on it?
>>
>> Thanks,
>>
>> -Aaron
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From sdavis2 at mail.nih.gov  Thu Jun 23 07:06:55 2005
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Thu Jun 23 06:57:59 2005
Subject: [Bioperl-l] GEO SOFT format parsing
Message-ID: <b86d93c3355a6d49978fdd4bf6d55817@mail.nih.gov>

I saw a couple of posts about GEO SOFT format parsing from about a year 
ago and wondered if anyone had gone on to complete one (for GDS, as my 
main priority).  If so, is it available somewhere?

Thanks,
Sean

From sm_middha at yahoo.com  Thu Jun 23 13:07:17 2005
From: sm_middha at yahoo.com (sumit middha)
Date: Thu Jun 23 12:58:40 2005
Subject: [Bioperl-l] FASTA.pm issue
In-Reply-To: <BEE05171.2024%brian_osborne@cognia.com>
Message-ID: <20050623170717.41518.qmail@web30702.mail.mud.yahoo.com>


Thanks for the reply Brian.
Changing it to Bio::Index::Fasta helped, but gave
another problem in my script, which I dont have a
clue.

------------- EXCEPTION  -------------
MSG: Can't open 'SDBM_File' dbm file
'../Dyak/dyak_chr_ucsc.fa.rev' : No such file or
directory
STACK Bio::Index::Abstract::open_dbm
/usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/Abstract.pm:392
STACK Bio::Index::Abstract::new
/usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/Abstract.pm:150
STACK Bio::Index::AbstractSeq::new
/usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/AbstractSeq.pm:91
STACK toplevel get_ortho.pl:31

I know that the file exists, and has been formatted as
a database to use BLAST search.

sumit

--- Brian Osborne <brian_osborne@cognia.com> wrote:

> Sumit,
> 
> In perl 5.8 a module that's using a tied hash is
> supposed to have an EXISTS
> method, but it appears that AnyDBM_File doesn't. You
> could try using
> Bio::Index::Fasta instead, or Bio::DB::Flat.
> 
> Brian O.
> 
> 
> On 6/22/05 6:24 PM, "sumit middha"
> <sm_middha@yahoo.com> wrote:
> 
> > 
> > Hello,
> > 
> > I have a trouble with using fasta module
> > 
> > I use the required statements
> > 
> > use Bio::DB::Fasta;
> > use Bio::Seq;
> > 
> > The error was:
> > 
> > AnyDBM_File doesn't define an EXISTS method at
> >
> /usr/local/lib/perl5/site_perl/5.8.5/Bio/DB/Fasta.pm
> > line 577
> > 
> > thanks,
> > sm
> > 
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around
> > http://mail.yahoo.com
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> >
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From khh103 at york.ac.uk  Thu Jun 23 13:30:31 2005
From: khh103 at york.ac.uk (Kat Hull)
Date: Thu Jun 23 13:24:09 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
Message-ID: <42BAF1B7.10109@york.ac.uk>

Hi there,
I was wondering whether anyone has a solution to my problem. I have a 
list of protein assession numbers and want to retrieve the corresponding 
nucleotide sequences automatically.  I thought it would be possible to 
do this by changing the NCBI url, but this doesn't seem to be the case.
Is there a bio-perl module that can do this?

Kind regards,
Kat

From brian_osborne at cognia.com  Thu Jun 23 14:38:06 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Thu Jun 23 14:30:07 2005
Subject: [Bioperl-l] FASTA.pm issue
In-Reply-To: <20050623170717.41518.qmail@web30702.mail.mud.yahoo.com>
Message-ID: <BEE079CE.2043%brian_osborne@cognia.com>

Sumit,

You'll have to show us the code that gives you the error, I think.


Brian O.


On 6/23/05 1:07 PM, "sumit middha" <sm_middha@yahoo.com> wrote:

> 
> Thanks for the reply Brian.
> Changing it to Bio::Index::Fasta helped, but gave
> another problem in my script, which I dont have a
> clue.
> 
> ------------- EXCEPTION  -------------
> MSG: Can't open 'SDBM_File' dbm file
> '../Dyak/dyak_chr_ucsc.fa.rev' : No such file or
> directory
> STACK Bio::Index::Abstract::open_dbm
> /usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/Abstract.pm:392
> STACK Bio::Index::Abstract::new
> /usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/Abstract.pm:150
> STACK Bio::Index::AbstractSeq::new
> /usr/local/lib/perl5/site_perl/5.8.5/Bio/Index/AbstractSeq.pm:91
> STACK toplevel get_ortho.pl:31
> 
> I know that the file exists, and has been formatted as
> a database to use BLAST search.
> 
> sumit
> 
> --- Brian Osborne <brian_osborne@cognia.com> wrote:
> 
>> Sumit,
>> 
>> In perl 5.8 a module that's using a tied hash is
>> supposed to have an EXISTS
>> method, but it appears that AnyDBM_File doesn't. You
>> could try using
>> Bio::Index::Fasta instead, or Bio::DB::Flat.
>> 
>> Brian O.
>> 
>> 
>> On 6/22/05 6:24 PM, "sumit middha"
>> <sm_middha@yahoo.com> wrote:
>> 
>>> 
>>> Hello,
>>> 
>>> I have a trouble with using fasta module
>>> 
>>> I use the required statements
>>> 
>>> use Bio::DB::Fasta;
>>> use Bio::Seq;
>>> 
>>> The error was:
>>> 
>>> AnyDBM_File doesn't define an EXISTS method at
>>> 
>> /usr/local/lib/perl5/site_perl/5.8.5/Bio/DB/Fasta.pm
>>> line 577
>>> 
>>> thanks,
>>> sm
>>> 
>>> __________________________________________________
>>> Do You Yahoo!?
>>> Tired of spam?  Yahoo! Mail has the best spam
>> protection around
>>> http://mail.yahoo.com
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> 
>> 
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> 
> 
> 
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com 


From nandita at uga.edu  Thu Jun 23 15:16:01 2005
From: nandita at uga.edu (Nandita Mullapudi)
Date: Thu Jun 23 15:07:39 2005
Subject: [Bioperl-l] help with parsing meme output
Message-ID: <792dff48.110fccbf.8442900@punts2.cc.uga.edu>

Hi,
I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
I need to extract the values corresponding to length of the
sequence, seq id, and motif id, start and significance/score.
I can get the last three using 

foreach my $instance (@{ $instances }) {
        my $start = $instance -> start;
        my $score = $instance -> score;

But i cannot find out how to get the seq id and seq length.
any ideas?
thanks
-nandita

***************************************************
Graduate Student, Kissinger Lab.
Dept. of Genetics
UGA, Athens GA 30602 USA
lab phone: 706-542-6563
cell phone: 706-254-2444
Lab add: C318 Life Sciences
****************************************************
From james.wasmuth at ed.ac.uk  Thu Jun 23 15:33:04 2005
From: james.wasmuth at ed.ac.uk (James Wasmuth)
Date: Thu Jun 23 15:29:17 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <792dff48.110fccbf.8442900@punts2.cc.uga.edu>
References: <792dff48.110fccbf.8442900@punts2.cc.uga.edu>
Message-ID: <42BB0E70.1030802@ed.ac.uk>

Hi Nandita

does "my $id=$instance->primary_id;" do what you want?


Is it the length from the input sequence that you want?

my %length= $header->length();
Function: Returns the length of the input sequence or motifs as a hash, indexed
by a sequence ID (motif id or accession number)



james


Nandita Mullapudi wrote:

>Hi,
>I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
>I need to extract the values corresponding to length of the
>sequence, seq id, and motif id, start and significance/score.
>I can get the last three using 
>
>foreach my $instance (@{ $instances }) {
>        my $start = $instance -> start;
>        my $score = $instance -> score;
>
>But i cannot find out how to get the seq id and seq length.
>any ideas?
>thanks
>-nandita
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>

-- 
http://www.nematodes.org/~james

"Until man duplicates a blade of grass, nature can laugh at his so-called scientific knowledge...."
            --Thomas Edison 

Blaxter Nematode Genomics Group   |
Institute of Evolutionary Biology |
Ashworth Laboratories, KB         | tel: +44 131 650 7403
University of Edinburgh           | web: www.nematodes.org
Edinburgh                         |
EH9 3JT                           |
UK                                |	
 

From skirov at utk.edu  Thu Jun 23 15:52:58 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 23 15:44:24 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42BAF1B7.10109@york.ac.uk>
References: <42BAF1B7.10109@york.ac.uk>
Message-ID: <42BB131A.2090403@utk.edu>

Kat,
If you are familiar with Bioperl it is kind of easy-
look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on how to 
get the protein record
Go through the dblinks and find the appropriate accession number (where 
the database method returns  GenBank).
Then retrieve this accession number(s) through Bio::DB::GenBank. If you 
are not familiar with Bioperl- read the docs for Bio::DB::GenPept, 
Bio::DB::GenBank, Bio::Annotation and Bio::Annotation::DBLink).
Hope this helps,
Stefan

Kat Hull wrote:

> Hi there,
> I was wondering whether anyone has a solution to my problem. I have a 
> list of protein assession numbers and want to retrieve the 
> corresponding nucleotide sequences automatically.  I thought it would 
> be possible to do this by changing the NCBI url, but this doesn't seem 
> to be the case.
> Is there a bio-perl module that can do this?
>
> Kind regards,
> Kat
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


Stefan
From skirov at utk.edu  Thu Jun 23 15:55:53 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 23 15:47:14 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <792dff48.110fccbf.8442900@punts2.cc.uga.edu>
References: <792dff48.110fccbf.8442900@punts2.cc.uga.edu>
Message-ID: <42BB13C9.8030807@utk.edu>

$instance->accession_number to get the sequence id
and
lenght is given by $instance->length
Stefan

Nandita Mullapudi wrote:

>Hi,
>I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
>I need to extract the values corresponding to length of the
>sequence, seq id, and motif id, start and significance/score.
>I can get the last three using 
>
>foreach my $instance (@{ $instances }) {
>        my $start = $instance -> start;
>        my $score = $instance -> score;
>
>But i cannot find out how to get the seq id and seq length.
>any ideas?
>thanks
>-nandita
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>

From james.wasmuth at ed.ac.uk  Thu Jun 23 15:51:48 2005
From: james.wasmuth at ed.ac.uk (James Wasmuth)
Date: Thu Jun 23 15:47:24 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <e8ca7f63.1112a834.82adb00@punts2.cc.uga.edu>
References: <e8ca7f63.1112a834.82adb00@punts2.cc.uga.edu>
Message-ID: <42BB12D4.5050705@ed.ac.uk>

Nandita

The BioPerl module $header->length() comes from is PSM/PsmHeader.pm

This should be inherited when you "use Bio::Matrix::PSM::IO"

have a look 
http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html

What you want should be covered there. Otherwise shout and someone will 
answer

-james



Nandita Mullapudi wrote:

>thanks James,
>
>  
>
>>Is it the length from the input sequence that you want?
>>
>>my %length= $header->length();
>>Function: Returns the length of the input sequence or motifs
>>    
>>
>as a hash, indexed
>  
>
>>by a sequence ID (motif id or accession number)
>>
>>    
>>
>
>yes, i want the length from the input sequence. I am not sure
>i can use the above without specifying which module / package
>it refers to? 
>
>also , where can i find this info? :)
>thanks,
>-nandita
>
>
>  
>
>>james
>>
>>
>>Nandita Mullapudi wrote:
>>
>>    
>>
>>>Hi,
>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
>>>I need to extract the values corresponding to length of the
>>>sequence, seq id, and motif id, start and significance/score.
>>>I can get the last three using 
>>>
>>>foreach my $instance (@{ $instances }) {
>>>       my $start = $instance -> start;
>>>       my $score = $instance -> score;
>>>
>>>But i cannot find out how to get the seq id and seq length.
>>>any ideas?
>>>thanks
>>>-nandita
>>>
>>>***************************************************
>>>Graduate Student, Kissinger Lab.
>>>Dept. of Genetics
>>>UGA, Athens GA 30602 USA
>>>lab phone: 706-542-6563
>>>cell phone: 706-254-2444
>>>Lab add: C318 Life Sciences
>>>****************************************************
>>>_______________________________________________
>>>Bioperl-l mailing list
>>>Bioperl-l@portal.open-bio.org
>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>>
>>>      
>>>
>>-- 
>>http://www.nematodes.org/~james
>>
>>"Until man duplicates a blade of grass, nature can laugh at
>>    
>>
>his so-called scientific knowledge...."
>  
>
>>           --Thomas Edison 
>>
>>Blaxter Nematode Genomics Group   |
>>Institute of Evolutionary Biology |
>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>University of Edinburgh           | web: www.nematodes.org
>>Edinburgh                         |
>>EH9 3JT                           |
>>UK                                |	
>>
>>
>>    
>>
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>  
>

-- 
http://www.nematodes.org/~james

"Until man duplicates a blade of grass, nature can laugh at his so-called scientific knowledge...."
            --Thomas Edison 

Blaxter Nematode Genomics Group   |
Institute of Evolutionary Biology |
Ashworth Laboratories, KB         | tel: +44 131 650 7403
University of Edinburgh           | web: www.nematodes.org
Edinburgh                         |
EH9 3JT                           |
UK                                |	
 

From skirov at utk.edu  Thu Jun 23 16:14:21 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 23 16:06:06 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <37c6b8a0.1114add7.82dba00@punts2.cc.uga.edu>
References: <37c6b8a0.1114add7.82dba00@punts2.cc.uga.edu>
Message-ID: <42BB181D.7040006@utk.edu>

The error you get is because you did not declare $header prior to usage 
with 'my' (or you can use it as a global, but then you should do 
something like $main::header). Another way is not to use strict, but 
this is not generally recommended if you want to write something reliable.
And yes, $instance->length will give back the hit length, so you may 
need what James suggested.
Stefan

Nandita Mullapudi wrote:

>i should've tried to be clearer, i'm looking for for length of
>the input sequence. i tried James' suggestion of print
>"$header->length"; but the error i get back is 
>
>Global symbol "$header" requires explicit package name at
>parsememe2.pl line 15.
>
>
>altho i am using use Bio::Matrix::PSM::IO;
>
>thanks for your help
>-nandita
>
>---- Original message ----
>  
>
>>Date: Thu, 23 Jun 2005 15:55:53 -0400
>>From: Stefan Kirov <skirov@utk.edu>  
>>Subject: Re: [Bioperl-l] help with parsing meme output  
>>To: Nandita Mullapudi <nandita@uga.edu>
>>Cc: bioperl-l@portal.open-bio.org
>>
>>$instance->accession_number to get the sequence id
>>and
>>lenght is given by $instance->length
>>Stefan
>>
>>Nandita Mullapudi wrote:
>>
>>    
>>
>>>Hi,
>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
>>>I need to extract the values corresponding to length of the
>>>sequence, seq id, and motif id, start and significance/score.
>>>I can get the last three using 
>>>
>>>foreach my $instance (@{ $instances }) {
>>>       my $start = $instance -> start;
>>>       my $score = $instance -> score;
>>>
>>>But i cannot find out how to get the seq id and seq length.
>>>any ideas?
>>>thanks
>>>-nandita
>>>
>>>***************************************************
>>>Graduate Student, Kissinger Lab.
>>>Dept. of Genetics
>>>UGA, Athens GA 30602 USA
>>>lab phone: 706-542-6563
>>>cell phone: 706-254-2444
>>>Lab add: C318 Life Sciences
>>>****************************************************
>>>_______________________________________________
>>>Bioperl-l mailing list
>>>Bioperl-l@portal.open-bio.org
>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>>
>>>      
>>>
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>  
>
From james.wasmuth at ed.ac.uk  Thu Jun 23 16:36:03 2005
From: james.wasmuth at ed.ac.uk (James Wasmuth)
Date: Thu Jun 23 16:31:43 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <5527172c.11156e5d.81a0500@punts2.cc.uga.edu>
References: <5527172c.11156e5d.81a0500@punts2.cc.uga.edu>
Message-ID: <42BB1D33.4070009@ed.ac.uk>

Does this behave itself? 

while    (my %header=$psmIO->header) {
	for (my $i=0; $i<=$#{$header{instances}};$i++)	{
		print $header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
	}
}


I don't use these modules but having looked at the docs this should work. Although the notes in Bio::Matrix::PSM::IO for this method say it should be obsolete.

If you still get no joy then attach a copy of the output file to an email. This should provide people with an example.









Nandita Mullapudi wrote:

>ok i've got to be missing something here.
>
>this is my code:
>
>use strict;
>use warnings;
>use Bio::Matrix::PSM::IO;
>use Bio::Matrix::PSM::InstanceSite;
>
>my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>                                         -format => 'meme');
>
>while    (my %header=$psmIO->header) {
>    foreach my $seqid (@{$header{instances}}) {
> print "$header->length";
>
>}
>}
>
>
>and the error i get is " Global symbol "$header" requires
>explicit package name at parsememe2.pl line 15.
>Execution of parsememe2.pl aborted due to compilation errors.
>
>
>thanks for your help.
>-n
>
>
>
>
>---- Original message ----
>  
>
>>Date: Thu, 23 Jun 2005 20:51:48 +0100
>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  
>>Subject: Re: [Bioperl-l] help with parsing meme output  
>>To: Nandita Mullapudi <nandita@uga.edu>
>>Cc: bioperl-l@bioperl.org
>>
>>Nandita
>>
>>The BioPerl module $header->length() comes from is
>>    
>>
>PSM/PsmHeader.pm
>  
>
>>This should be inherited when you "use Bio::Matrix::PSM::IO"
>>
>>have a look 
>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>
>>What you want should be covered there. Otherwise shout and
>>    
>>
>someone will 
>  
>
>>answer
>>
>>-james
>>
>>
>>
>>Nandita Mullapudi wrote:
>>
>>    
>>
>>>thanks James,
>>>
>>> 
>>>
>>>      
>>>
>>>>Is it the length from the input sequence that you want?
>>>>
>>>>my %length= $header->length();
>>>>Function: Returns the length of the input sequence or motifs
>>>>   
>>>>
>>>>        
>>>>
>>>as a hash, indexed
>>> 
>>>
>>>      
>>>
>>>>by a sequence ID (motif id or accession number)
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>yes, i want the length from the input sequence. I am not sure
>>>i can use the above without specifying which module / package
>>>it refers to? 
>>>
>>>also , where can i find this info? :)
>>>thanks,
>>>-nandita
>>>
>>>
>>> 
>>>
>>>      
>>>
>>>>james
>>>>
>>>>
>>>>Nandita Mullapudi wrote:
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>Hi,
>>>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme output.
>>>>>I need to extract the values corresponding to length of the
>>>>>sequence, seq id, and motif id, start and significance/score.
>>>>>I can get the last three using 
>>>>>
>>>>>foreach my $instance (@{ $instances }) {
>>>>>      my $start = $instance -> start;
>>>>>      my $score = $instance -> score;
>>>>>
>>>>>But i cannot find out how to get the seq id and seq length.
>>>>>any ideas?
>>>>>thanks
>>>>>-nandita
>>>>>
>>>>>***************************************************
>>>>>Graduate Student, Kissinger Lab.
>>>>>Dept. of Genetics
>>>>>UGA, Athens GA 30602 USA
>>>>>lab phone: 706-542-6563
>>>>>cell phone: 706-254-2444
>>>>>Lab add: C318 Life Sciences
>>>>>****************************************************
>>>>>_______________________________________________
>>>>>Bioperl-l mailing list
>>>>>Bioperl-l@portal.open-bio.org
>>>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>-- 
>>>>http://www.nematodes.org/~james
>>>>
>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>   
>>>>
>>>>        
>>>>
>>>his so-called scientific knowledge...."
>>> 
>>>
>>>      
>>>
>>>>          --Thomas Edison 
>>>>
>>>>Blaxter Nematode Genomics Group   |
>>>>Institute of Evolutionary Biology |
>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>University of Edinburgh           | web: www.nematodes.org
>>>>Edinburgh                         |
>>>>EH9 3JT                           |
>>>>UK                                |	
>>>>
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>***************************************************
>>>Graduate Student, Kissinger Lab.
>>>Dept. of Genetics
>>>UGA, Athens GA 30602 USA
>>>lab phone: 706-542-6563
>>>cell phone: 706-254-2444
>>>Lab add: C318 Life Sciences
>>>****************************************************
>>> 
>>>
>>>      
>>>
>>-- 
>>http://www.nematodes.org/~james
>>
>>"Until man duplicates a blade of grass, nature can laugh at
>>    
>>
>his so-called scientific knowledge...."
>  
>
>>           --Thomas Edison 
>>
>>Blaxter Nematode Genomics Group   |
>>Institute of Evolutionary Biology |
>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>University of Edinburgh           | web: www.nematodes.org
>>Edinburgh                         |
>>EH9 3JT                           |
>>UK                                |	
>>
>>
>>    
>>
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>  
>

-- 
http://www.nematodes.org/~james

"Until man duplicates a blade of grass, nature can laugh at his so-called scientific knowledge...."
            --Thomas Edison 

Blaxter Nematode Genomics Group   |
Institute of Evolutionary Biology |
Ashworth Laboratories, KB         | tel: +44 131 650 7403
University of Edinburgh           | web: www.nematodes.org
Edinburgh                         |
EH9 3JT                           |
UK                                |	
 

From james.wasmuth at ed.ac.uk  Thu Jun 23 17:23:15 2005
From: james.wasmuth at ed.ac.uk (James Wasmuth)
Date: Thu Jun 23 17:20:53 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <e1889100.1119065d.822c000@punts2.cc.uga.edu>
References: <e1889100.1119065d.822c000@punts2.cc.uga.edu>
Message-ID: <42BB2843.4020307@ed.ac.uk>

It would appear that $psmIO->header is not implemented in PSM/IO.pm.
Does anyone know if this is to be done?

Nandita Mullapudi wrote:

>thanks James,
>this one gives the error
>
>Can't use an undefined value as an ARRAY reference at
>/usr/lib/perl5/site_perl/5.6.1/Bio/Matrix/PSM/IO/meme.pm line
>159, <GEN0> line 43.
>
>i've attached the text output i am trying to parse
>
>-nandita
>
>
>---- Original message ----
>  
>
>>Date: Thu, 23 Jun 2005 21:36:03 +0100
>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  
>>Subject: Re: [Bioperl-l] help with parsing meme output  
>>To: Nandita Mullapudi <nandita@uga.edu>
>>Cc: bioperl-l@portal.open-bio.org
>>
>>Does this behave itself? 
>>
>>while    (my %header=$psmIO->header) {
>>	for (my $i=0; $i<=$#{$header{instances}};$i++)	{
>>		print
>>    
>>
>$header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
>  
>
>>	}
>>}
>>
>>
>>I don't use these modules but having looked at the docs this
>>    
>>
>should work. Although the notes in Bio::Matrix::PSM::IO for
>this method say it should be obsolete.
>  
>
>>If you still get no joy then attach a copy of the output file
>>    
>>
>to an email. This should provide people with an example.
>  
>
>>
>>
>>
>>
>>
>>
>>
>>Nandita Mullapudi wrote:
>>
>>    
>>
>>>ok i've got to be missing something here.
>>>
>>>this is my code:
>>>
>>>use strict;
>>>use warnings;
>>>use Bio::Matrix::PSM::IO;
>>>use Bio::Matrix::PSM::InstanceSite;
>>>
>>>my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>>>                                        -format => 'meme');
>>>
>>>while    (my %header=$psmIO->header) {
>>>   foreach my $seqid (@{$header{instances}}) {
>>>print "$header->length";
>>>
>>>}
>>>}
>>>
>>>
>>>and the error i get is " Global symbol "$header" requires
>>>explicit package name at parsememe2.pl line 15.
>>>Execution of parsememe2.pl aborted due to compilation errors.
>>>
>>>
>>>thanks for your help.
>>>-n
>>>
>>>
>>>
>>>
>>>---- Original message ----
>>> 
>>>
>>>      
>>>
>>>>Date: Thu, 23 Jun 2005 20:51:48 +0100
>>>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  
>>>>Subject: Re: [Bioperl-l] help with parsing meme output  
>>>>To: Nandita Mullapudi <nandita@uga.edu>
>>>>Cc: bioperl-l@bioperl.org
>>>>
>>>>Nandita
>>>>
>>>>The BioPerl module $header->length() comes from is
>>>>   
>>>>
>>>>        
>>>>
>>>PSM/PsmHeader.pm
>>> 
>>>
>>>      
>>>
>>>>This should be inherited when you "use Bio::Matrix::PSM::IO"
>>>>
>>>>have a look 
>>>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>>>
>>>>What you want should be covered there. Otherwise shout and
>>>>   
>>>>
>>>>        
>>>>
>>>someone will 
>>> 
>>>
>>>      
>>>
>>>>answer
>>>>
>>>>-james
>>>>
>>>>
>>>>
>>>>Nandita Mullapudi wrote:
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>>>thanks James,
>>>>>
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>Is it the length from the input sequence that you want?
>>>>>>
>>>>>>my %length= $header->length();
>>>>>>Function: Returns the length of the input sequence or motifs
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>as a hash, indexed
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>by a sequence ID (motif id or accession number)
>>>>>>
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>yes, i want the length from the input sequence. I am not sure
>>>>>i can use the above without specifying which module / package
>>>>>it refers to? 
>>>>>
>>>>>also , where can i find this info? :)
>>>>>thanks,
>>>>>-nandita
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>james
>>>>>>
>>>>>>
>>>>>>Nandita Mullapudi wrote:
>>>>>>
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>>>Hi,
>>>>>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme
>>>>>>>              
>>>>>>>
>output.
>  
>
>>>>>>>I need to extract the values corresponding to length of the
>>>>>>>sequence, seq id, and motif id, start and
>>>>>>>              
>>>>>>>
>significance/score.
>  
>
>>>>>>>I can get the last three using 
>>>>>>>
>>>>>>>foreach my $instance (@{ $instances }) {
>>>>>>>     my $start = $instance -> start;
>>>>>>>     my $score = $instance -> score;
>>>>>>>
>>>>>>>But i cannot find out how to get the seq id and seq length.
>>>>>>>any ideas?
>>>>>>>thanks
>>>>>>>-nandita
>>>>>>>
>>>>>>>***************************************************
>>>>>>>Graduate Student, Kissinger Lab.
>>>>>>>Dept. of Genetics
>>>>>>>UGA, Athens GA 30602 USA
>>>>>>>lab phone: 706-542-6563
>>>>>>>cell phone: 706-254-2444
>>>>>>>Lab add: C318 Life Sciences
>>>>>>>****************************************************
>>>>>>>_______________________________________________
>>>>>>>Bioperl-l mailing list
>>>>>>>Bioperl-l@portal.open-bio.org
>>>>>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>
>>>>>>>
>>>>>>>    
>>>>>>>
>>>>>>>         
>>>>>>>
>>>>>>>              
>>>>>>>
>>>>>>-- 
>>>>>>http://www.nematodes.org/~james
>>>>>>
>>>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>his so-called scientific knowledge...."
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>>>         --Thomas Edison 
>>>>>>
>>>>>>Blaxter Nematode Genomics Group   |
>>>>>>Institute of Evolutionary Biology |
>>>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>University of Edinburgh           | web: www.nematodes.org
>>>>>>Edinburgh                         |
>>>>>>EH9 3JT                           |
>>>>>>UK                                |	
>>>>>>
>>>>>>
>>>>>>  
>>>>>>
>>>>>>       
>>>>>>
>>>>>>            
>>>>>>
>>>>>***************************************************
>>>>>Graduate Student, Kissinger Lab.
>>>>>Dept. of Genetics
>>>>>UGA, Athens GA 30602 USA
>>>>>lab phone: 706-542-6563
>>>>>cell phone: 706-254-2444
>>>>>Lab add: C318 Life Sciences
>>>>>****************************************************
>>>>>
>>>>>
>>>>>     
>>>>>
>>>>>          
>>>>>
>>>>-- 
>>>>http://www.nematodes.org/~james
>>>>
>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>   
>>>>
>>>>        
>>>>
>>>his so-called scientific knowledge...."
>>> 
>>>
>>>      
>>>
>>>>          --Thomas Edison 
>>>>
>>>>Blaxter Nematode Genomics Group   |
>>>>Institute of Evolutionary Biology |
>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>University of Edinburgh           | web: www.nematodes.org
>>>>Edinburgh                         |
>>>>EH9 3JT                           |
>>>>UK                                |	
>>>>
>>>>
>>>>   
>>>>
>>>>        
>>>>
>>>***************************************************
>>>Graduate Student, Kissinger Lab.
>>>Dept. of Genetics
>>>UGA, Athens GA 30602 USA
>>>lab phone: 706-542-6563
>>>cell phone: 706-254-2444
>>>Lab add: C318 Life Sciences
>>>****************************************************
>>> 
>>>
>>>      
>>>
>>-- 
>>http://www.nematodes.org/~james
>>
>>"Until man duplicates a blade of grass, nature can laugh at
>>    
>>
>his so-called scientific knowledge...."
>  
>
>>           --Thomas Edison 
>>
>>Blaxter Nematode Genomics Group   |
>>Institute of Evolutionary Biology |
>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>University of Edinburgh           | web: www.nematodes.org
>>Edinburgh                         |
>>EH9 3JT                           |
>>UK                                |	
>>
>>
>>    
>>
>
>***************************************************
>Graduate Student, Kissinger Lab.
>Dept. of Genetics
>UGA, Athens GA 30602 USA
>lab phone: 706-542-6563
>cell phone: 706-254-2444
>Lab add: C318 Life Sciences
>****************************************************
>  
>

From skirov at utk.edu  Thu Jun 23 21:12:35 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 23 21:07:59 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <42BB2843.4020307@ed.ac.uk>
References: <e1889100.1119065d.822c000@punts2.cc.uga.edu>
	<42BB2843.4020307@ed.ac.uk>
Message-ID: <42BB5E03.5000206@utk.edu>

James,
while you were correct in your first suggestion (to use $psmIO->length), 
but quite incorrect at your next suggestion:
the code
while    (my %header=$psmIO->header) {
makes no sense.
What you probably want to do is:
while (my $psm=$psmIO->next_psm) {
my %header=$psm->header; #Bio::Matrix::PSM::Psm method
#Do something with the has
}
But header has different purpose- it contains data about particular 
prediction, such as number of sites, width of the motif, etc.
If you need the initial sequences lengths it is precisely as you suggested:
my %lengths=$psmIO->length;
foreach my $id (keys %lengths) {
print "Initial sequence $id length is ",$lengths{$id},"\n";
}
C'est tout!
To get a length of a particular hit (that is the sequence, on which a 
predicted motif is based):
while (my $psm=$psmIO->next_psm) {
my $instances=$psm->instances;
foreach my..... {
print "Hits ... is long", $instance->length....
}
Let me know if there are further questions
Stefan

James Wasmuth wrote:

> It would appear that $psmIO->header is not implemented in PSM/IO.pm.
> Does anyone know if this is to be done?
>
> Nandita Mullapudi wrote:
>
>> thanks James,
>> this one gives the error
>>
>> Can't use an undefined value as an ARRAY reference at
>> /usr/lib/perl5/site_perl/5.6.1/Bio/Matrix/PSM/IO/meme.pm line
>> 159, <GEN0> line 43.
>>
>> i've attached the text output i am trying to parse
>>
>> -nandita
>>
>>
>> ---- Original message ----
>>  
>>
>>> Date: Thu, 23 Jun 2005 21:36:03 +0100
>>> From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>> [Bioperl-l] help with parsing meme output  To: Nandita Mullapudi 
>>> <nandita@uga.edu>
>>> Cc: bioperl-l@portal.open-bio.org
>>>
>>> Does this behave itself?
>>> while    (my %header=$psmIO->header) {
>>>     for (my $i=0; $i<=$#{$header{instances}};$i++)    {
>>>         print
>>>   
>>
>> $header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
>>  
>>
>>>     }
>>> }
>>>
>>>
>>> I don't use these modules but having looked at the docs this
>>>   
>>
>> should work. Although the notes in Bio::Matrix::PSM::IO for
>> this method say it should be obsolete.
>>  
>>
>>> If you still get no joy then attach a copy of the output file
>>>   
>>
>> to an email. This should provide people with an example.
>>  
>>
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>> Nandita Mullapudi wrote:
>>>
>>>   
>>>
>>>> ok i've got to be missing something here.
>>>>
>>>> this is my code:
>>>>
>>>> use strict;
>>>> use warnings;
>>>> use Bio::Matrix::PSM::IO;
>>>> use Bio::Matrix::PSM::InstanceSite;
>>>>
>>>> my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>>>>                                        -format => 'meme');
>>>>
>>>> while    (my %header=$psmIO->header) {
>>>>   foreach my $seqid (@{$header{instances}}) {
>>>> print "$header->length";
>>>>
>>>> }
>>>> }
>>>>
>>>>
>>>> and the error i get is " Global symbol "$header" requires
>>>> explicit package name at parsememe2.pl line 15.
>>>> Execution of parsememe2.pl aborted due to compilation errors.
>>>>
>>>>
>>>> thanks for your help.
>>>> -n
>>>>
>>>>
>>>>
>>>>
>>>> ---- Original message ----
>>>>
>>>>
>>>>     
>>>>
>>>>> Date: Thu, 23 Jun 2005 20:51:48 +0100
>>>>> From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>>>> [Bioperl-l] help with parsing meme output  To: Nandita Mullapudi 
>>>>> <nandita@uga.edu>
>>>>> Cc: bioperl-l@bioperl.org
>>>>>
>>>>> Nandita
>>>>>
>>>>> The BioPerl module $header->length() comes from is
>>>>>  
>>>>>       
>>>>
>>>> PSM/PsmHeader.pm
>>>>
>>>>
>>>>     
>>>>
>>>>> This should be inherited when you "use Bio::Matrix::PSM::IO"
>>>>>
>>>>> have a look 
>>>>> http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>>>>
>>>>> What you want should be covered there. Otherwise shout and
>>>>>  
>>>>>       
>>>>
>>>> someone will
>>>>
>>>>     
>>>>
>>>>> answer
>>>>>
>>>>> -james
>>>>>
>>>>>
>>>>>
>>>>> Nandita Mullapudi wrote:
>>>>>
>>>>>  
>>>>>       
>>>>>
>>>>>> thanks James,
>>>>>>
>>>>>>
>>>>>>
>>>>>>    
>>>>>>         
>>>>>>
>>>>>>> Is it the length from the input sequence that you want?
>>>>>>>
>>>>>>> my %length= $header->length();
>>>>>>> Function: Returns the length of the input sequence or motifs
>>>>>>>  
>>>>>>>
>>>>>>>      
>>>>>>>           
>>>>>>
>>>>>> as a hash, indexed
>>>>>>
>>>>>>
>>>>>>    
>>>>>>         
>>>>>>
>>>>>>> by a sequence ID (motif id or accession number)
>>>>>>>
>>>>>>>  
>>>>>>>
>>>>>>>      
>>>>>>>           
>>>>>>
>>>>>> yes, i want the length from the input sequence. I am not sure
>>>>>> i can use the above without specifying which module / package
>>>>>> it refers to?
>>>>>> also , where can i find this info? :)
>>>>>> thanks,
>>>>>> -nandita
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>    
>>>>>>         
>>>>>>
>>>>>>> james
>>>>>>>
>>>>>>>
>>>>>>> Nandita Mullapudi wrote:
>>>>>>>
>>>>>>>  
>>>>>>>
>>>>>>>      
>>>>>>>           
>>>>>>>
>>>>>>>> Hi,
>>>>>>>> I am trying to use  Bio::Matrix::PSM::IO to parse meme
>>>>>>>>             
>>>>>>>
>> output.
>>  
>>
>>>>>>>> I need to extract the values corresponding to length of the
>>>>>>>> sequence, seq id, and motif id, start and
>>>>>>>>             
>>>>>>>
>> significance/score.
>>  
>>
>>>>>>>> I can get the last three using
>>>>>>>> foreach my $instance (@{ $instances }) {
>>>>>>>>     my $start = $instance -> start;
>>>>>>>>     my $score = $instance -> score;
>>>>>>>>
>>>>>>>> But i cannot find out how to get the seq id and seq length.
>>>>>>>> any ideas?
>>>>>>>> thanks
>>>>>>>> -nandita
>>>>>>>>
>>>>>>>> ***************************************************
>>>>>>>> Graduate Student, Kissinger Lab.
>>>>>>>> Dept. of Genetics
>>>>>>>> UGA, Athens GA 30602 USA
>>>>>>>> lab phone: 706-542-6563
>>>>>>>> cell phone: 706-254-2444
>>>>>>>> Lab add: C318 Life Sciences
>>>>>>>> ****************************************************
>>>>>>>> _______________________________________________
>>>>>>>> Bioperl-l mailing list
>>>>>>>> Bioperl-l@portal.open-bio.org
>>>>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>
>>>>>>>>
>>>>>>>>   
>>>>>>>>        
>>>>>>>>             
>>>>>>>
>>>>>>> -- 
>>>>>>> http://www.nematodes.org/~james
>>>>>>>
>>>>>>> "Until man duplicates a blade of grass, nature can laugh at
>>>>>>>  
>>>>>>>
>>>>>>>      
>>>>>>>           
>>>>>>
>>>>>> his so-called scientific knowledge...."
>>>>>>
>>>>>>
>>>>>>    
>>>>>>         
>>>>>>
>>>>>>>         --Thomas Edison
>>>>>>> Blaxter Nematode Genomics Group   |
>>>>>>> Institute of Evolutionary Biology |
>>>>>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>> University of Edinburgh           | web: www.nematodes.org
>>>>>>> Edinburgh                         |
>>>>>>> EH9 3JT                           |
>>>>>>> UK                                |   
>>>>>>>
>>>>>>>
>>>>>>>  
>>>>>>>
>>>>>>>      
>>>>>>>           
>>>>>>
>>>>>> ***************************************************
>>>>>> Graduate Student, Kissinger Lab.
>>>>>> Dept. of Genetics
>>>>>> UGA, Athens GA 30602 USA
>>>>>> lab phone: 706-542-6563
>>>>>> cell phone: 706-254-2444
>>>>>> Lab add: C318 Life Sciences
>>>>>> ****************************************************
>>>>>>
>>>>>>
>>>>>>    
>>>>>>         
>>>>>
>>>>> -- 
>>>>> http://www.nematodes.org/~james
>>>>>
>>>>> "Until man duplicates a blade of grass, nature can laugh at
>>>>>  
>>>>>       
>>>>
>>>> his so-called scientific knowledge...."
>>>>
>>>>
>>>>     
>>>>
>>>>>          --Thomas Edison
>>>>> Blaxter Nematode Genomics Group   |
>>>>> Institute of Evolutionary Biology |
>>>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>> University of Edinburgh           | web: www.nematodes.org
>>>>> Edinburgh                         |
>>>>> EH9 3JT                           |
>>>>> UK                                |   
>>>>>
>>>>>
>>>>>  
>>>>>       
>>>>
>>>> ***************************************************
>>>> Graduate Student, Kissinger Lab.
>>>> Dept. of Genetics
>>>> UGA, Athens GA 30602 USA
>>>> lab phone: 706-542-6563
>>>> cell phone: 706-254-2444
>>>> Lab add: C318 Life Sciences
>>>> ****************************************************
>>>>
>>>>
>>>>     
>>>
>>> -- 
>>> http://www.nematodes.org/~james
>>>
>>> "Until man duplicates a blade of grass, nature can laugh at
>>>   
>>
>> his so-called scientific knowledge...."
>>  
>>
>>>           --Thomas Edison
>>> Blaxter Nematode Genomics Group   |
>>> Institute of Evolutionary Biology |
>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>> University of Edinburgh           | web: www.nematodes.org
>>> Edinburgh                         |
>>> EH9 3JT                           |
>>> UK                                |   
>>>
>>>
>>>   
>>
>>
>> ***************************************************
>> Graduate Student, Kissinger Lab.
>> Dept. of Genetics
>> UGA, Athens GA 30602 USA
>> lab phone: 706-542-6563
>> cell phone: 706-254-2444
>> Lab add: C318 Life Sciences
>> ****************************************************
>>  
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From nandita at uga.edu  Thu Jun 23 22:40:44 2005
From: nandita at uga.edu (Nandita Mullapudi)
Date: Thu Jun 23 22:32:18 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <42BB5E03.5000206@utk.edu>
References: <e1889100.1119065d.822c000@punts2.cc.uga.edu>
	<42BB2843.4020307@ed.ac.uk> <42BB5E03.5000206@utk.edu>
Message-ID: <a06110402bee122dd6121@[128.192.158.93]>

Thanks Stefan,
the line  that didn't make sense was mine, not James'. :p
but i see what was wrong. i'll try this now.
-nandita

>James,
>while you were correct in your first suggestion (to use 
>$psmIO->length), but quite incorrect at your next suggestion:
>the code
>while    (my %header=$psmIO->header) {
>makes no sense.
>What you probably want to do is:
>while (my $psm=$psmIO->next_psm) {
>my %header=$psm->header; #Bio::Matrix::PSM::Psm method
>#Do something with the has
>}
>But header has different purpose- it contains data about particular 
>prediction, such as number of sites, width of the motif, etc.
>If you need the initial sequences lengths it is precisely as you suggested:
>my %lengths=$psmIO->length;
>foreach my $id (keys %lengths) {
>print "Initial sequence $id length is ",$lengths{$id},"\n";
>}
>C'est tout!
>To get a length of a particular hit (that is the sequence, on which 
>a predicted motif is based):
>while (my $psm=$psmIO->next_psm) {
>my $instances=$psm->instances;
>foreach my..... {
>print "Hits ... is long", $instance->length....
>}
>Let me know if there are further questions
>Stefan
>
>James Wasmuth wrote:
>
>>It would appear that $psmIO->header is not implemented in PSM/IO.pm.
>>Does anyone know if this is to be done?
>>
>>Nandita Mullapudi wrote:
>>
>>>thanks James,
>>>this one gives the error
>>>
>>>Can't use an undefined value as an ARRAY reference at
>>>/usr/lib/perl5/site_perl/5.6.1/Bio/Matrix/PSM/IO/meme.pm line
>>>159, <GEN0> line 43.
>>>
>>>i've attached the text output i am trying to parse
>>>
>>>-nandita
>>>
>>>
>>>---- Original message ----
>>>
>>>>Date: Thu, 23 Jun 2005 21:36:03 +0100
>>>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>>>[Bioperl-l] help with parsing meme output  To: Nandita Mullapudi 
>>>><nandita@uga.edu>
>>>>Cc: bioperl-l@portal.open-bio.org
>>>>
>>>>Does this behave itself?
>>>>while    (my %header=$psmIO->header) {
>>>>     for (my $i=0; $i<=$#{$header{instances}};$i++)    {
>>>>         print
>>>>
>>>
>>>$header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
>>>
>>>>     }
>>>>}
>>>>
>>>>
>>>>I don't use these modules but having looked at the docs this
>>>>
>>>
>>>should work. Although the notes in Bio::Matrix::PSM::IO for
>>>this method say it should be obsolete.
>>>
>>>>If you still get no joy then attach a copy of the output file
>>>>
>>>
>>>to an email. This should provide people with an example.
>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>Nandita Mullapudi wrote:
>>>>
>>>>
>>>>>ok i've got to be missing something here.
>>>>>
>>>>>this is my code:
>>>>>
>>>>>use strict;
>>>>>use warnings;
>>>>>use Bio::Matrix::PSM::IO;
>>>>>use Bio::Matrix::PSM::InstanceSite;
>>>>>
>>>>>my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>>>>>                                        -format => 'meme');
>>>>>
>>>>>while    (my %header=$psmIO->header) {
>>>>>   foreach my $seqid (@{$header{instances}}) {
>>>>>print "$header->length";
>>>>>
>>>>>}
>>>>>}
>>>>>
>>>>>
>>>>>and the error i get is " Global symbol "$header" requires
>>>>>explicit package name at parsememe2.pl line 15.
>>>>>Execution of parsememe2.pl aborted due to compilation errors.
>>>>>
>>>>>
>>>>>thanks for your help.
>>>>>-n
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>---- Original message ----
>>>>>
>>>>>
>>>>>    
>>>>>
>>>>>>Date: Thu, 23 Jun 2005 20:51:48 +0100
>>>>>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>>>>>[Bioperl-l] help with parsing meme output  To: Nandita 
>>>>>>Mullapudi <nandita@uga.edu>
>>>>>>Cc: bioperl-l@bioperl.org
>>>>>>
>>>>>>Nandita
>>>>>>
>>>>>>The BioPerl module $header->length() comes from is
>>>>>>
>>>>>
>>>>>PSM/PsmHeader.pm
>>>>>
>>>>>
>>>>>    
>>>>>
>>>>>>This should be inherited when you "use Bio::Matrix::PSM::IO"
>>>>>>
>>>>>>have a look 
>>>>>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>>>>>
>>>>>>What you want should be covered there. Otherwise shout and
>>>>>>
>>>>>
>>>>>someone will
>>>>>
>>>>>    
>>>>>
>>>>>>answer
>>>>>>
>>>>>>-james
>>>>>>
>>>>>>
>>>>>>
>>>>>>Nandita Mullapudi wrote:
>>>>>>
>>>>>>       
>>>>>>
>>>>>>>thanks James,
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>   
>>>>>>>        
>>>>>>>
>>>>>>>>Is it the length from the input sequence that you want?
>>>>>>>>
>>>>>>>>my %length= $header->length();
>>>>>>>>Function: Returns the length of the input sequence or motifs
>>>>>>>>
>>>>>>>>     
>>>>>>>>
>>>>>>>
>>>>>>>as a hash, indexed
>>>>>>>
>>>>>>>
>>>>>>>   
>>>>>>>        
>>>>>>>
>>>>>>>>by a sequence ID (motif id or accession number)
>>>>>>>>
>>>>>>>>
>>>>>>>>     
>>>>>>>>
>>>>>>>
>>>>>>>yes, i want the length from the input sequence. I am not sure
>>>>>>>i can use the above without specifying which module / package
>>>>>>>it refers to?
>>>>>>>also , where can i find this info? :)
>>>>>>>thanks,
>>>>>>>-nandita
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>   
>>>>>>>        
>>>>>>>
>>>>>>>>james
>>>>>>>>
>>>>>>>>
>>>>>>>>Nandita Mullapudi wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>>     
>>>>>>>>          
>>>>>>>>
>>>>>>>>>Hi,
>>>>>>>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme
>>>>>>>>>
>>>>>>>>
>>>output.
>>>
>>>>>>>>>I need to extract the values corresponding to length of the
>>>>>>>>>sequence, seq id, and motif id, start and
>>>>>>>>>
>>>>>>>>
>>>significance/score.
>>>
>>>>>>>>>I can get the last three using
>>>>>>>>>foreach my $instance (@{ $instances }) {
>>>>>>>>>     my $start = $instance -> start;
>>>>>>>>>     my $score = $instance -> score;
>>>>>>>>>
>>>>>>>>>But i cannot find out how to get the seq id and seq length.
>>>>>>>>>any ideas?
>>>>>>>>>thanks
>>>>>>>>>-nandita
>>>>>>>>>
>>>>>>>>>***************************************************
>>>>>>>>>Graduate Student, Kissinger Lab.
>>>>>>>>>Dept. of Genetics
>>>>>>>>>UGA, Athens GA 30602 USA
>>>>>>>>>lab phone: 706-542-6563
>>>>>>>>>cell phone: 706-254-2444
>>>>>>>>>Lab add: C318 Life Sciences
>>>>>>>>>****************************************************
>>>>>>>>>_______________________________________________
>>>>>>>>>Bioperl-l mailing list
>>>>>>>>>Bioperl-l@portal.open-bio.org
>>>>>>>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>         
>>>>>>>>>
>>>>>>>>
>>>>>>>>--
>>>>>>>>http://www.nematodes.org/~james
>>>>>>>>
>>>>>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>>>>>
>>>>>>>>     
>>>>>>>>
>>>>>>>
>>>>>>>his so-called scientific knowledge...."
>>>>>>>
>>>>>>>
>>>>>>>   
>>>>>>>        
>>>>>>>
>>>>>>>>         --Thomas Edison
>>>>>>>>Blaxter Nematode Genomics Group   |
>>>>>>>>Institute of Evolutionary Biology |
>>>>>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>>>University of Edinburgh           | web: www.nematodes.org
>>>>>>>>Edinburgh                         |
>>>>>>>>EH9 3JT                           |
>>>>>>>>UK                                |  
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>     
>>>>>>>>
>>>>>>>
>>>>>>>***************************************************
>>>>>>>Graduate Student, Kissinger Lab.
>>>>>>>Dept. of Genetics
>>>>>>>UGA, Athens GA 30602 USA
>>>>>>>lab phone: 706-542-6563
>>>>>>>cell phone: 706-254-2444
>>>>>>>Lab add: C318 Life Sciences
>>>>>>>****************************************************
>>>>>>>
>>>>>>>
>>>>>>>   
>>>>>>>
>>>>>>
>>>>>>--
>>>>>>http://www.nematodes.org/~james
>>>>>>
>>>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>>>
>>>>>
>>>>>his so-called scientific knowledge...."
>>>>>
>>>>>
>>>>>    
>>>>>
>>>>>>          --Thomas Edison
>>>>>>Blaxter Nematode Genomics Group   |
>>>>>>Institute of Evolutionary Biology |
>>>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>University of Edinburgh           | web: www.nematodes.org
>>>>>>Edinburgh                         |
>>>>>>EH9 3JT                           |
>>>>>>UK                                |  
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>>***************************************************
>>>>>Graduate Student, Kissinger Lab.
>>>>>Dept. of Genetics
>>>>>UGA, Athens GA 30602 USA
>>>>>lab phone: 706-542-6563
>>>>>cell phone: 706-254-2444
>>>>>Lab add: C318 Life Sciences
>>>>>****************************************************
>>>>>
>>>>>
>>>>>
>>>>
>>>>--
>>>>http://www.nematodes.org/~james
>>>>
>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>
>>>
>>>his so-called scientific knowledge...."
>>>
>>>>           --Thomas Edison
>>>>Blaxter Nematode Genomics Group   |
>>>>Institute of Evolutionary Biology |
>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>University of Edinburgh           | web: www.nematodes.org
>>>>Edinburgh                         |
>>>>EH9 3JT                           |
>>>>UK                                |  
>>>>
>>>>
>>>
>>>
>>>***************************************************
>>>Graduate Student, Kissinger Lab.
>>>Dept. of Genetics
>>>UGA, Athens GA 30602 USA
>>>lab phone: 706-542-6563
>>>cell phone: 706-254-2444
>>>Lab add: C318 Life Sciences
>>>****************************************************
>>>
>>
>>_______________________________________________
>>Bioperl-l mailing list
>>Bioperl-l@portal.open-bio.org
>>http://portal.open-bio.org/mailman/listinfo/bioperl-l


-- 

****************************************************
Nandita Mullapudi
Graduate student, Kissinger Lab.
Dept. of Genetics. UGA Athens GA 30602
Lab Address: C-318 Life Sciences.
Lab phone: 706-542-6563 Cell phone: 706-254-2444

****************************************************

From skirov at utk.edu  Thu Jun 23 23:13:58 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 23 23:06:23 2005
Subject: [Bioperl-l] help with parsing meme output
In-Reply-To: <a06110402bee122dd6121@[128.192.158.93]>
References: <e1889100.1119065d.822c000@punts2.cc.uga.edu>
	<42BB2843.4020307@ed.ac.uk> <42BB5E03.5000206@utk.edu>
	<a06110402bee122dd6121@[128.192.158.93]>
Message-ID: <42BB7A76.1000408@utk.edu>

Sorry James  :-[ ... I thought it was your suggestion...
Nandita let me know if you have more questions.
Stefan

Nandita Mullapudi wrote:

> Thanks Stefan,
> the line  that didn't make sense was mine, not James'. :p
> but i see what was wrong. i'll try this now.
> -nandita
>
>> James,
>> while you were correct in your first suggestion (to use 
>> $psmIO->length), but quite incorrect at your next suggestion:
>> the code
>> while    (my %header=$psmIO->header) {
>> makes no sense.
>> What you probably want to do is:
>> while (my $psm=$psmIO->next_psm) {
>> my %header=$psm->header; #Bio::Matrix::PSM::Psm method
>> #Do something with the has
>> }
>> But header has different purpose- it contains data about particular 
>> prediction, such as number of sites, width of the motif, etc.
>> If you need the initial sequences lengths it is precisely as you 
>> suggested:
>> my %lengths=$psmIO->length;
>> foreach my $id (keys %lengths) {
>> print "Initial sequence $id length is ",$lengths{$id},"\n";
>> }
>> C'est tout!
>> To get a length of a particular hit (that is the sequence, on which a 
>> predicted motif is based):
>> while (my $psm=$psmIO->next_psm) {
>> my $instances=$psm->instances;
>> foreach my..... {
>> print "Hits ... is long", $instance->length....
>> }
>> Let me know if there are further questions
>> Stefan
>>
>> James Wasmuth wrote:
>>
>>> It would appear that $psmIO->header is not implemented in PSM/IO.pm.
>>> Does anyone know if this is to be done?
>>>
>>> Nandita Mullapudi wrote:
>>>
>>>> thanks James,
>>>> this one gives the error
>>>>
>>>> Can't use an undefined value as an ARRAY reference at
>>>> /usr/lib/perl5/site_perl/5.6.1/Bio/Matrix/PSM/IO/meme.pm line
>>>> 159, <GEN0> line 43.
>>>>
>>>> i've attached the text output i am trying to parse
>>>>
>>>> -nandita
>>>>
>>>>
>>>> ---- Original message ----
>>>>
>>>>> Date: Thu, 23 Jun 2005 21:36:03 +0100
>>>>> From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>>>> [Bioperl-l] help with parsing meme output  To: Nandita Mullapudi 
>>>>> <nandita@uga.edu>
>>>>> Cc: bioperl-l@portal.open-bio.org
>>>>>
>>>>> Does this behave itself?
>>>>> while    (my %header=$psmIO->header) {
>>>>>     for (my $i=0; $i<=$#{$header{instances}};$i++)    {
>>>>>         print
>>>>>
>>>>
>>>> $header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
>>>>
>>>>>     }
>>>>> }
>>>>>
>>>>>
>>>>> I don't use these modules but having looked at the docs this
>>>>>
>>>>
>>>> should work. Although the notes in Bio::Matrix::PSM::IO for
>>>> this method say it should be obsolete.
>>>>
>>>>> If you still get no joy then attach a copy of the output file
>>>>>
>>>>
>>>> to an email. This should provide people with an example.
>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> Nandita Mullapudi wrote:
>>>>>
>>>>>
>>>>>> ok i've got to be missing something here.
>>>>>>
>>>>>> this is my code:
>>>>>>
>>>>>> use strict;
>>>>>> use warnings;
>>>>>> use Bio::Matrix::PSM::IO;
>>>>>> use Bio::Matrix::PSM::InstanceSite;
>>>>>>
>>>>>> my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>>>>>>                                        -format => 'meme');
>>>>>>
>>>>>> while    (my %header=$psmIO->header) {
>>>>>>   foreach my $seqid (@{$header{instances}}) {
>>>>>> print "$header->length";
>>>>>>
>>>>>> }
>>>>>> }
>>>>>>
>>>>>>
>>>>>> and the error i get is " Global symbol "$header" requires
>>>>>> explicit package name at parsememe2.pl line 15.
>>>>>> Execution of parsememe2.pl aborted due to compilation errors.
>>>>>>
>>>>>>
>>>>>> thanks for your help.
>>>>>> -n
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>> ---- Original message ----
>>>>>>
>>>>>>
>>>>>>   
>>>>>>
>>>>>>> Date: Thu, 23 Jun 2005 20:51:48 +0100
>>>>>>> From: James Wasmuth <james.wasmuth@ed.ac.uk>  Subject: Re: 
>>>>>>> [Bioperl-l] help with parsing meme output  To: Nandita Mullapudi 
>>>>>>> <nandita@uga.edu>
>>>>>>> Cc: bioperl-l@bioperl.org
>>>>>>>
>>>>>>> Nandita
>>>>>>>
>>>>>>> The BioPerl module $header->length() comes from is
>>>>>>>
>>>>>>
>>>>>> PSM/PsmHeader.pm
>>>>>>
>>>>>>
>>>>>>   
>>>>>>
>>>>>>> This should be inherited when you "use Bio::Matrix::PSM::IO"
>>>>>>>
>>>>>>> have a look 
>>>>>>> http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>>>>>>
>>>>>>> What you want should be covered there. Otherwise shout and
>>>>>>>
>>>>>>
>>>>>> someone will
>>>>>>
>>>>>>   
>>>>>>
>>>>>>> answer
>>>>>>>
>>>>>>> -james
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Nandita Mullapudi wrote:
>>>>>>>
>>>>>>>      
>>>>>>>
>>>>>>>> thanks James,
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>         
>>>>>>>>
>>>>>>>>> Is it the length from the input sequence that you want?
>>>>>>>>>
>>>>>>>>> my %length= $header->length();
>>>>>>>>> Function: Returns the length of the input sequence or motifs
>>>>>>>>>
>>>>>>>>>    
>>>>>>>>
>>>>>>>>
>>>>>>>> as a hash, indexed
>>>>>>>>
>>>>>>>>
>>>>>>>>         
>>>>>>>>
>>>>>>>>> by a sequence ID (motif id or accession number)
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>    
>>>>>>>>
>>>>>>>>
>>>>>>>> yes, i want the length from the input sequence. I am not sure
>>>>>>>> i can use the above without specifying which module / package
>>>>>>>> it refers to?
>>>>>>>> also , where can i find this info? :)
>>>>>>>> thanks,
>>>>>>>> -nandita
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>         
>>>>>>>>
>>>>>>>>> james
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Nandita Mullapudi wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>             
>>>>>>>>>
>>>>>>>>>> Hi,
>>>>>>>>>> I am trying to use  Bio::Matrix::PSM::IO to parse meme
>>>>>>>>>>
>>>>>>>>>
>>>> output.
>>>>
>>>>>>>>>> I need to extract the values corresponding to length of the
>>>>>>>>>> sequence, seq id, and motif id, start and
>>>>>>>>>>
>>>>>>>>>
>>>> significance/score.
>>>>
>>>>>>>>>> I can get the last three using
>>>>>>>>>> foreach my $instance (@{ $instances }) {
>>>>>>>>>>     my $start = $instance -> start;
>>>>>>>>>>     my $score = $instance -> score;
>>>>>>>>>>
>>>>>>>>>> But i cannot find out how to get the seq id and seq length.
>>>>>>>>>> any ideas?
>>>>>>>>>> thanks
>>>>>>>>>> -nandita
>>>>>>>>>>
>>>>>>>>>> ***************************************************
>>>>>>>>>> Graduate Student, Kissinger Lab.
>>>>>>>>>> Dept. of Genetics
>>>>>>>>>> UGA, Athens GA 30602 USA
>>>>>>>>>> lab phone: 706-542-6563
>>>>>>>>>> cell phone: 706-254-2444
>>>>>>>>>> Lab add: C318 Life Sciences
>>>>>>>>>> ****************************************************
>>>>>>>>>> _______________________________________________
>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>> Bioperl-l@portal.open-bio.org
>>>>>>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>        
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> -- 
>>>>>>>>> http://www.nematodes.org/~james
>>>>>>>>>
>>>>>>>>> "Until man duplicates a blade of grass, nature can laugh at
>>>>>>>>>
>>>>>>>>>    
>>>>>>>>
>>>>>>>>
>>>>>>>> his so-called scientific knowledge...."
>>>>>>>>
>>>>>>>>
>>>>>>>>         
>>>>>>>>
>>>>>>>>>         --Thomas Edison
>>>>>>>>> Blaxter Nematode Genomics Group   |
>>>>>>>>> Institute of Evolutionary Biology |
>>>>>>>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>>>> University of Edinburgh           | web: www.nematodes.org
>>>>>>>>> Edinburgh                         |
>>>>>>>>> EH9 3JT                           |
>>>>>>>>> UK                                | 
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>    
>>>>>>>>
>>>>>>>>
>>>>>>>> ***************************************************
>>>>>>>> Graduate Student, Kissinger Lab.
>>>>>>>> Dept. of Genetics
>>>>>>>> UGA, Athens GA 30602 USA
>>>>>>>> lab phone: 706-542-6563
>>>>>>>> cell phone: 706-254-2444
>>>>>>>> Lab add: C318 Life Sciences
>>>>>>>> ****************************************************
>>>>>>>>
>>>>>>>>
>>>>>>>>  
>>>>>>>
>>>>>>>
>>>>>>> -- 
>>>>>>> http://www.nematodes.org/~james
>>>>>>>
>>>>>>> "Until man duplicates a blade of grass, nature can laugh at
>>>>>>>
>>>>>>
>>>>>> his so-called scientific knowledge...."
>>>>>>
>>>>>>
>>>>>>   
>>>>>>
>>>>>>>          --Thomas Edison
>>>>>>> Blaxter Nematode Genomics Group   |
>>>>>>> Institute of Evolutionary Biology |
>>>>>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>>> University of Edinburgh           | web: www.nematodes.org
>>>>>>> Edinburgh                         |
>>>>>>> EH9 3JT                           |
>>>>>>> UK                                | 
>>>>>>>
>>>>>>>
>>>>>>
>>>>>> ***************************************************
>>>>>> Graduate Student, Kissinger Lab.
>>>>>> Dept. of Genetics
>>>>>> UGA, Athens GA 30602 USA
>>>>>> lab phone: 706-542-6563
>>>>>> cell phone: 706-254-2444
>>>>>> Lab add: C318 Life Sciences
>>>>>> ****************************************************
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>> -- 
>>>>> http://www.nematodes.org/~james
>>>>>
>>>>> "Until man duplicates a blade of grass, nature can laugh at
>>>>>
>>>>
>>>> his so-called scientific knowledge...."
>>>>
>>>>>           --Thomas Edison
>>>>> Blaxter Nematode Genomics Group   |
>>>>> Institute of Evolutionary Biology |
>>>>> Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>> University of Edinburgh           | web: www.nematodes.org
>>>>> Edinburgh                         |
>>>>> EH9 3JT                           |
>>>>> UK                                | 
>>>>>
>>>>
>>>>
>>>> ***************************************************
>>>> Graduate Student, Kissinger Lab.
>>>> Dept. of Genetics
>>>> UGA, Athens GA 30602 USA
>>>> lab phone: 706-542-6563
>>>> cell phone: 706-254-2444
>>>> Lab add: C318 Life Sciences
>>>> ****************************************************
>>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>

From heikki at ebi.ac.uk  Fri Jun 24 02:49:11 2005
From: heikki at ebi.ac.uk (Heikki Lehvaslaiho)
Date: Fri Jun 24 02:40:32 2005
Subject: [Bioperl-l] Fwd: Bio::DB::BioDB
Message-ID: <200506240749.11341.heikki@ebi.ac.uk>



----------  Forwarded Message  ----------

Subject: Bio::DB::BioDB
Date: Thursday 23 June 2005 19:47
From: madhuri battu <madhuri_battu@yahoo.co.in>
To: jason@bioperl.org, brian_osborne@cognia.com, heikki@ebi.ac.uk

Hi,
  My name is Madhuri Battu. I am working at UT
Southwestern in US as an intern. I have a problem with
installing Bio::DB::BioDB. It was saying it is 5 years
old on downloads page and recently updated on View cvs
page. Can you please tell whether the module is being
used and how can i install it. If this module is not
being used what module can be used in place of that.
Thanks,
Madhuri.






__________________________________________________________
Free antispam, antivirus and 1GB to save all your messages
Only in Yahoo! Mail: http://in.mail.yahoo.com

-------------------------------------------------------

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________
From Richard.Adams at ed.ac.uk  Fri Jun 24 06:38:22 2005
From: Richard.Adams at ed.ac.uk (Richard Adams)
Date: Fri Jun 24 06:31:23 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
Message-ID: <42BBE29E.109@ed.ac.uk>

Kat,
You can try Ensmart at www.ensembl.org as well, it's very useful for 
this sort of thing.

Richard

-- 
Dr Richard Adams
Psychiatric Genetics Group,
Medical Genetics,
Molecular Medicine Centre,
Western General Hospital,
Crewe Rd West,
Edinburgh UK
EH4 2XU

Tel: 44 131 651 1084
richard.adams@ed.ac.uk


From michael.spitzer at uni-muenster.de  Fri Jun 24 08:03:38 2005
From: michael.spitzer at uni-muenster.de (Michael Spitzer)
Date: Fri Jun 24 07:56:57 2005
Subject: [Bioperl-l] NCBI Genbank ID to TaxonID via Bioperl?
In-Reply-To: <1003840011d840032395bf3ed408185b@salmonella.org>
References: <42B815CC.3090009@uni-muenster.de>
	<1003840011d840032395bf3ed408185b@salmonella.org>
Message-ID: <42BBF69A.2030602@uni-muenster.de>

Rob Edwards wrote:
> Possibly the easiest way to do this is using the eutils facilities.
> [...]

Thanks, this looks exactly what I'm in need for. The API seems to be 
very simple and easy from what I got from a quick glance at the example 
Perlscripts there. I think I'll go for the EUtils approach.

Thank you very much,

Michael
From skirov at utk.edu  Fri Jun 24 12:06:54 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Fri Jun 24 11:58:22 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42BC298F.8000100@york.ac.uk>
References: <42BAF1B7.10109@york.ac.uk> <42BB131A.2090403@utk.edu>
	<42BC298F.8000100@york.ac.uk>
Message-ID: <42BC2F9E.20607@utk.edu>

   my $seqio = $gb->get_Stream_by_id(['13474692']);
   while( my $seq = $seqio->next_seq ) {
       print "seq is  ", $seq->display_id, "\n";
       my $ann=$seq->annotation; #This gives you the annotation of the 
retrieved sequence object
      foreach my $dblink ($ann->get_Annotations('DBLink')) {
          if ($dblink->database =~/refseq/i) {
             print $database->primary_id, " is the mRNA accession number\n";
          }
       }
   }
However, the gene you are looking at is not associated with any NM_ 
sequence, but rather comes from NC_. Therefore the above will not work 
for you. You will have to descend through the sequence features and find 
teh feature that says 'coded_by':
use Bio::DB::GenPept;
my $gb=new Bio::DB::GenPept;
  my $seqio = $gb->get_Stream_by_id(['13474692']);
   while( my $seq = $seqio->next_seq ) {
       print "seq is  ", $seq->display_id, "\n";
       my @f=$seq->get_SeqFeatures; #This gives you the annotation of 
the retrieved sequence object
      foreach my $feat (@f) {
        my $ann=$feat->annotation;
        next unless ($ann->get_Annotations('coded_by'));
        my @coded=$ann->get_Annotations('coded_by');
        foreach my $location (@coded) {
          print $location->value, " is the location that codes this 
protein\n";
        }
       }
   }
No guarantees the code is typo free :-)
Stefan

Kat Hull wrote:

> Hi Stefan,
> Thanks for your advice but i'm still struggling!   I have used 
> Bio::DB::GenPept to get the protein accession number given the protein 
> gi number.  However, I don't understand how Bio::Annotation::DBLink 
> works.  Does it fetch the url of a link on the web-site?   Basically, 
> if I could use this (or something else) to get the url of the CDS link 
> for my protein of interest, I can get the corresponding nucleotide 
> accession from this, as it is encoded in the url.
> Do you know how to use this module?  Is this what you were suggesting 
> I try yesterday (I didn't really understand what you were getting at).
> Many thanks,
>
> Kat
>
> ps. Here's where i'm at so far:
>                                                                                                                                                                                    
>
> use Bio::Annotation::DBLink;
> use Bio::DB::GenBank;
> use Bio::DB::GenPept;
>   $gb = new Bio::DB::GenPept;
>                                                                                                                                                                                                                                                                                                                                                                                                                                                  
>
>    # given the gi number, this returns the accession
>    my $seqio = $gb->get_Stream_by_id(['13474692']);
>    while( my $seq = $seqio->next_seq ) {
>        print "seq is  ", $seq->display_id, "\n";
>    }
>     # not sure what i'm doing here 
>                                                                                                                                                                                                                                                                                                                                                               
>
>   $link2 = new Bio::Annotation::DBLink();
>   $link2->database('dbSNP');
>   $link2->primary_id('2367');
>
>
>
>
>
> Stefan Kirov wrote:
>
>> Kat,
>> If you are familiar with Bioperl it is kind of easy-
>> look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on how 
>> to get the protein record
>> Go through the dblinks and find the appropriate accession number 
>> (where the database method returns  GenBank).
>> Then retrieve this accession number(s) through Bio::DB::GenBank. If 
>> you are not familiar with Bioperl- read the docs for 
>> Bio::DB::GenPept, Bio::DB::GenBank, Bio::Annotation and 
>> Bio::Annotation::DBLink).
>> Hope this helps,
>> Stefan
>>
>> Kat Hull wrote:
>>
>>> Hi there,
>>> I was wondering whether anyone has a solution to my problem. I have 
>>> a list of protein assession numbers and want to retrieve the 
>>> corresponding nucleotide sequences automatically.  I thought it 
>>> would be possible to do this by changing the NCBI url, but this 
>>> doesn't seem to be the case.
>>> Is there a bio-perl module that can do this?
>>>
>>> Kind regards,
>>> Kat
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>>
>>
>> Stefan
>
>
>
>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From skirov at utk.edu  Fri Jun 24 14:54:46 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Fri Jun 24 14:46:13 2005
Subject: [Bioperl-l] Bio::DB::CUTG behaving weird
Message-ID: <42BC56F6.7070302@utk.edu>

Guys,
This very simple code gives a nasty warning and actually does not 
retrieve anything:
  my $db = Bio::DB::CUTG->new(-sp =>'Homo sapiens');
  my $cdtable = $db->get_request();
It does not run properly under SUSE 9.3, but it does just fine under 
Ubuntu 5. The code and the bioperl versions are the same (bioperl-live, 
updated today, even though CUTG goes back quite a while).

-------------------- WARNING ---------------------
MSG: probable parsing error - should be 21 entries for 20aa + stop codon
---------------------------------------------------
 If you go to 
http://www.kazusa.or.jp/codon/cgi-bin/spsearch.cgi?species=Homo+sapiens&c=s, 
you will see where the problem is. However, my Ubuntu machine goves 
warning that there are multiple choices and selects Homo sapiens. It may 
be the LWP::UserAgent. I am obviously missing something. Any ideas?


Stefan

From hlapp at gmx.net  Sat Jun 25 00:17:54 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat Jun 25 00:09:48 2005
Subject: [Bioperl-l] Fwd: Bio::DB::BioDB
In-Reply-To: <200506240749.11341.heikki@ebi.ac.uk>
References: <200506240749.11341.heikki@ebi.ac.uk>
Message-ID: <c39521e7486a29a5052ece2e6dc04b9c@gmx.net>

The module is being used, and in fact in quite extensive ways in 
certain projects. You need to get to download the latest revision from 
CVS, not CPAN or any tarball out there that says it is version 0.10.

Also, you will need the latest version of the BioSQL schema, also 
downloadable from CVS. There are installation documents that should 
explain the necessary steps, depending on your choice of RDBMS (we 
support Mysql, PostgreSQL, HSQLDB, and Oracle).

	-hilmar

On Jun 24, 2005, at 2:49 AM, Heikki Lehvaslaiho wrote:

>
>
> ----------  Forwarded Message  ----------
>
> Subject: Bio::DB::BioDB
> Date: Thursday 23 June 2005 19:47
> From: madhuri battu <madhuri_battu@yahoo.co.in>
> To: jason@bioperl.org, brian_osborne@cognia.com, heikki@ebi.ac.uk
>
> Hi,
>   My name is Madhuri Battu. I am working at UT
> Southwestern in US as an intern. I have a problem with
> installing Bio::DB::BioDB. It was saying it is 5 years
> old on downloads page and recently updated on View cvs
> page. Can you please tell whether the module is being
> used and how can i install it. If this module is not
> being used what module can be used in place of that.
> Thanks,
> Madhuri.
>
>
>
>
>
>
> __________________________________________________________
> Free antispam, antivirus and 1GB to save all your messages
> Only in Yahoo! Mail: http://in.mail.yahoo.com
>
> -------------------------------------------------------
>
> -- 
> ______ _/      _/_____________________________________________________
>       _/      _/                      http://www.ebi.ac.uk/mutations/
>      _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
>     _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
>    _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
>   _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
>      _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
> ___ _/_/_/_/_/________________________________________________________
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From lehvasla at ebi.ac.uk  Sat Jun 25 02:41:37 2005
From: lehvasla at ebi.ac.uk (lehvasla@ebi.ac.uk)
Date: Sat Jun 25 20:50:55 2005
Subject: [Bioperl-l] Fwd: Re: Bio::DB::BioDB
Message-ID: <37588.83.151.196.59.1119681697.squirrel@webmail.ebi.ac.uk>


-------------- next part --------------
An embedded message was scrubbed...
From: madhuri battu <madhuri_battu@yahoo.co.in>
Subject: Re: Bio::DB::BioDB
Date: Fri, 24 Jun 2005 21:33:46 +0100 (BST)
Size: 4402
Url: http://portal.open-bio.org/pipermail/bioperl-l/attachments/20050625/a06256e9/BioDB.eml
From nandita at uga.edu  Thu Jun 23 16:56:47 2005
From: nandita at uga.edu (Nandita Mullapudi)
Date: Sat Jun 25 20:51:24 2005
Subject: [Bioperl-l] help with parsing meme output
Message-ID: <e1889100.1119065d.822c000@punts2.cc.uga.edu>

thanks James,
this one gives the error

Can't use an undefined value as an ARRAY reference at
/usr/lib/perl5/site_perl/5.6.1/Bio/Matrix/PSM/IO/meme.pm line
159, <GEN0> line 43.

i've attached the text output i am trying to parse

-nandita


---- Original message ----
>Date: Thu, 23 Jun 2005 21:36:03 +0100
>From: James Wasmuth <james.wasmuth@ed.ac.uk>  
>Subject: Re: [Bioperl-l] help with parsing meme output  
>To: Nandita Mullapudi <nandita@uga.edu>
>Cc: bioperl-l@portal.open-bio.org
>
>Does this behave itself? 
>
>while    (my %header=$psmIO->header) {
>	for (my $i=0; $i<=$#{$header{instances}};$i++)	{
>		print
$header{instances}->[$i],"\t",$header{lengths}->[$i],"\n";
>	}
>}
>
>
>I don't use these modules but having looked at the docs this
should work. Although the notes in Bio::Matrix::PSM::IO for
this method say it should be obsolete.
>
>If you still get no joy then attach a copy of the output file
to an email. This should provide people with an example.
>
>
>
>
>
>
>
>
>
>Nandita Mullapudi wrote:
>
>>ok i've got to be missing something here.
>>
>>this is my code:
>>
>>use strict;
>>use warnings;
>>use Bio::Matrix::PSM::IO;
>>use Bio::Matrix::PSM::InstanceSite;
>>
>>my $psmIO = new Bio::Matrix::PSM::IO(    -file => 'memeout.txt',
>>                                         -format => 'meme');
>>
>>while    (my %header=$psmIO->header) {
>>    foreach my $seqid (@{$header{instances}}) {
>> print "$header->length";
>>
>>}
>>}
>>
>>
>>and the error i get is " Global symbol "$header" requires
>>explicit package name at parsememe2.pl line 15.
>>Execution of parsememe2.pl aborted due to compilation errors.
>>
>>
>>thanks for your help.
>>-n
>>
>>
>>
>>
>>---- Original message ----
>>  
>>
>>>Date: Thu, 23 Jun 2005 20:51:48 +0100
>>>From: James Wasmuth <james.wasmuth@ed.ac.uk>  
>>>Subject: Re: [Bioperl-l] help with parsing meme output  
>>>To: Nandita Mullapudi <nandita@uga.edu>
>>>Cc: bioperl-l@bioperl.org
>>>
>>>Nandita
>>>
>>>The BioPerl module $header->length() comes from is
>>>    
>>>
>>PSM/PsmHeader.pm
>>  
>>
>>>This should be inherited when you "use Bio::Matrix::PSM::IO"
>>>
>>>have a look 
>>>http://doc.bioperl.org/releases/bioperl-1.4/Bio/Matrix/PSM/IO.html
>>>
>>>What you want should be covered there. Otherwise shout and
>>>    
>>>
>>someone will 
>>  
>>
>>>answer
>>>
>>>-james
>>>
>>>
>>>
>>>Nandita Mullapudi wrote:
>>>
>>>    
>>>
>>>>thanks James,
>>>>
>>>> 
>>>>
>>>>      
>>>>
>>>>>Is it the length from the input sequence that you want?
>>>>>
>>>>>my %length= $header->length();
>>>>>Function: Returns the length of the input sequence or motifs
>>>>>   
>>>>>
>>>>>        
>>>>>
>>>>as a hash, indexed
>>>> 
>>>>
>>>>      
>>>>
>>>>>by a sequence ID (motif id or accession number)
>>>>>
>>>>>   
>>>>>
>>>>>        
>>>>>
>>>>yes, i want the length from the input sequence. I am not sure
>>>>i can use the above without specifying which module / package
>>>>it refers to? 
>>>>
>>>>also , where can i find this info? :)
>>>>thanks,
>>>>-nandita
>>>>
>>>>
>>>> 
>>>>
>>>>      
>>>>
>>>>>james
>>>>>
>>>>>
>>>>>Nandita Mullapudi wrote:
>>>>>
>>>>>   
>>>>>
>>>>>        
>>>>>
>>>>>>Hi,
>>>>>>I am trying to use  Bio::Matrix::PSM::IO to parse meme
output.
>>>>>>I need to extract the values corresponding to length of the
>>>>>>sequence, seq id, and motif id, start and
significance/score.
>>>>>>I can get the last three using 
>>>>>>
>>>>>>foreach my $instance (@{ $instances }) {
>>>>>>      my $start = $instance -> start;
>>>>>>      my $score = $instance -> score;
>>>>>>
>>>>>>But i cannot find out how to get the seq id and seq length.
>>>>>>any ideas?
>>>>>>thanks
>>>>>>-nandita
>>>>>>
>>>>>>***************************************************
>>>>>>Graduate Student, Kissinger Lab.
>>>>>>Dept. of Genetics
>>>>>>UGA, Athens GA 30602 USA
>>>>>>lab phone: 706-542-6563
>>>>>>cell phone: 706-254-2444
>>>>>>Lab add: C318 Life Sciences
>>>>>>****************************************************
>>>>>>_______________________________________________
>>>>>>Bioperl-l mailing list
>>>>>>Bioperl-l@portal.open-bio.org
>>>>>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>
>>>>>>
>>>>>>     
>>>>>>
>>>>>>          
>>>>>>
>>>>>-- 
>>>>>http://www.nematodes.org/~james
>>>>>
>>>>>"Until man duplicates a blade of grass, nature can laugh at
>>>>>   
>>>>>
>>>>>        
>>>>>
>>>>his so-called scientific knowledge...."
>>>> 
>>>>
>>>>      
>>>>
>>>>>          --Thomas Edison 
>>>>>
>>>>>Blaxter Nematode Genomics Group   |
>>>>>Institute of Evolutionary Biology |
>>>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>>>University of Edinburgh           | web: www.nematodes.org
>>>>>Edinburgh                         |
>>>>>EH9 3JT                           |
>>>>>UK                                |	
>>>>>
>>>>>
>>>>>   
>>>>>
>>>>>        
>>>>>
>>>>***************************************************
>>>>Graduate Student, Kissinger Lab.
>>>>Dept. of Genetics
>>>>UGA, Athens GA 30602 USA
>>>>lab phone: 706-542-6563
>>>>cell phone: 706-254-2444
>>>>Lab add: C318 Life Sciences
>>>>****************************************************
>>>> 
>>>>
>>>>      
>>>>
>>>-- 
>>>http://www.nematodes.org/~james
>>>
>>>"Until man duplicates a blade of grass, nature can laugh at
>>>    
>>>
>>his so-called scientific knowledge...."
>>  
>>
>>>           --Thomas Edison 
>>>
>>>Blaxter Nematode Genomics Group   |
>>>Institute of Evolutionary Biology |
>>>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>>>University of Edinburgh           | web: www.nematodes.org
>>>Edinburgh                         |
>>>EH9 3JT                           |
>>>UK                                |	
>>>
>>>
>>>    
>>>
>>
>>***************************************************
>>Graduate Student, Kissinger Lab.
>>Dept. of Genetics
>>UGA, Athens GA 30602 USA
>>lab phone: 706-542-6563
>>cell phone: 706-254-2444
>>Lab add: C318 Life Sciences
>>****************************************************
>>  
>>
>
>-- 
>http://www.nematodes.org/~james
>
>"Until man duplicates a blade of grass, nature can laugh at
his so-called scientific knowledge...."
>            --Thomas Edison 
>
>Blaxter Nematode Genomics Group   |
>Institute of Evolutionary Biology |
>Ashworth Laboratories, KB         | tel: +44 131 650 7403
>University of Edinburgh           | web: www.nematodes.org
>Edinburgh                         |
>EH9 3JT                           |
>UK                                |	
> 
>

***************************************************
Graduate Student, Kissinger Lab.
Dept. of Genetics
UGA, Athens GA 30602 USA
lab phone: 706-542-6563
cell phone: 706-254-2444
Lab add: C318 Life Sciences
****************************************************
-------------- next part --------------
********************************************************************************
MEME - Motif discovery tool
********************************************************************************
MEME version 3.0 (Release date: 2002/04/02 00:11:59)

For further information on how to interpret these results or to get
a copy of the MEME software please access http://meme.sdsc.edu.

This file may be used as input to the MAST algorithm for searching
sequence databases for matches to groups of motifs.  MAST is available
for interactive use and downloading at http://meme.sdsc.edu.
********************************************************************************


********************************************************************************
REFERENCE
********************************************************************************
If you use this program in your research, please cite:

Timothy L. Bailey and Charles Elkan,
"Fitting a mixture model by expectation maximization to discover
motifs in biopolymers", Proceedings of the Second International
Conference on Intelligent Systems for Molecular Biology, pp. 28-36,
AAAI Press, Menlo Park, California, 1994.
********************************************************************************


********************************************************************************
TRAINING SET
********************************************************************************
DATAFILE= /scratch/nandita/Sullivan/all14-trunc-uw
ALPHABET= ACGT
Sequence name            Weight Length  Sequence name            Weight Length  
-------------            ------ ------  -------------            ------ ------  
G6PD_TRUNC               1.0000   1500  GAPDH_TRUNC              1.0000   1500  
PDIpro-trunc             1.0000   1500  Camp-kin-cat-trunc       1.0000   1450  
cAMP_kinase_reg-trunc    1.0000   1500  PK4-TRUNC                1.0000   1500  
Calmodulin-TRUNC         1.0000   1500  MIC2-TRUNC               1.0000   1500  
MIC4-TRUNC               1.0000   1500  MIC5-TRUNC               1.0000   1500  
MIC6-TRUNC               1.0000   1500  ROP9-TRUNC               1.0000   1500  
GRA7-TRUNC               1.0000   1500  GRA2pre-TRUNC            1.0000   1500  
RiboP-TRUNCATED          1.0000   1501  MIC11-PRO-TRUNC          1.0000   1500  
********************************************************************************

********************************************************************************
COMMAND LINE SUMMARY
********************************************************************************
This information can also be useful in the event you wish to report a
problem with the MEME software.

command: meme /scratch/nandita/Sullivan/all14-trunc-uw -dna -minw 6 -maxw 20 -mod oops -nmotifs 20 

model:  mod=          oops    nmotifs=        20    evt=           inf
object function=  E-value of product of p-values
width:  minw=            6    maxw=           20    minic=        0.00
width:  wg=             11    ws=              1    endgaps=       yes
nsites: minsites=       16    maxsites=       16    wnsites=       0.8
theta:  prob=            1    spmap=         uni    spfuzz=        0.5
em:     prior=   dirichlet    b=            0.01    maxiter=        50
        distance=    1e-05
data:   n=           23951    N=              16
strands: +
sample: seed=            0    seqfrac=         1
Letter frequencies in dataset:
A 0.218 C 0.269 G 0.246 T 0.267 
Background letter frequencies (from dataset with add-one prior applied):
A 0.218 C 0.269 G 0.246 T 0.267 
********************************************************************************


********************************************************************************
MOTIF  1	width =   11   sites =  16   llr = 159   E-value = 5.1e+001
********************************************************************************
--------------------------------------------------------------------------------
	Motif 1 Description
--------------------------------------------------------------------------------
Simplified        A  2:::9:8:611
pos.-specific     C  1:381:1::9:
probability       G  1131:a1a::8
matrix            T  6951::::4:1

         bits    2.2            
                 2.0      * *   
                 1.8     ** *   
                 1.5     ** * * 
Information      1.3  *  **** * 
content          1.1  * ********
(14.4 bits)      0.9  * ********
                 0.7  * ********
                 0.4 ***********
                 0.2 ***********
                 0.0 -----------

Multilevel           TTTCAGAGACG
consensus              C     T  
sequence               G        
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 1 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
GRA7-TRUNC                 1203  2.13e-07 CTCACCGGGT TTTCAGAGACG CGCGAGATCC
MIC2-TRUNC                 1282  2.13e-07 GCGACGTCGA TTTCAGAGACG ACGCCGCATG
ROP9-TRUNC                 1092  1.06e-06 TCAGCGACGC ATTCAGAGACG AGTTTGTTGC
G6PD_TRUNC                  908  1.30e-06 TGTCCAAAAG TTGCAGAGTCG ACTTCCATCT
PDIpro-trunc                357  1.56e-06 CCAGCAGTAG TTCCAGAGTCG TACAGCCGTA
MIC5-TRUNC                  880  3.56e-06 GTCGCGGAAG GTTCAGAGACG CCCCAGTCGT
MIC4-TRUNC                  445  4.81e-06 CCGCTTTCCG TTGGAGAGACG CCGGCTAGGG
PK4-TRUNC                    36  4.81e-06 GCATCGCTAG ATCCAGAGTCG CTCTTTAACT
GAPDH_TRUNC                 994  1.31e-05 CACTGTGTTT TTGCAGAGACT TGTTTCCACT
cAMP_kinase_reg-trunc      1211  1.65e-05 TCGCTCTCAT TTCCAGCGTCG ATCGCGCCTG
MIC6-TRUNC                 1196  2.16e-05 CGCTAGTGTG TGTCAGCGACG CGGCAGTCGA
Calmodulin-TRUNC            368  2.55e-05 GGTCCCCCGT ATGCAGAGTCA AATAGCCAAC
GRA2pre-TRUNC              1324  2.74e-05 ACAGAGACGA CGCCAGAGACG CAAAATGAAC
RiboP-TRUNCATED            1042  5.17e-05 CAGGCGGTTT CTTCAGGGTCG AATGGGAGTC
MIC11-PRO-TRUNC            1068  7.72e-05 TGTTTTCCTT TTTTCGAGACG TCTGTCGAGA
Camp-kin-cat-trunc          237  1.11e-04 GCGGCGTTTC TTTGAGAGAAA CTTAAACAGG
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 1 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
GRA7-TRUNC                        2.1e-07  1202_[1]_287
MIC2-TRUNC                        2.1e-07  1281_[1]_208
ROP9-TRUNC                        1.1e-06  1091_[1]_398
G6PD_TRUNC                        1.3e-06  907_[1]_582
PDIpro-trunc                      1.6e-06  356_[1]_1133
MIC5-TRUNC                        3.6e-06  879_[1]_610
MIC4-TRUNC                        4.8e-06  444_[1]_1045
PK4-TRUNC                         4.8e-06  35_[1]_1454
GAPDH_TRUNC                       1.3e-05  993_[1]_496
cAMP_kinase_reg-trunc             1.6e-05  1210_[1]_279
MIC6-TRUNC                        2.2e-05  1195_[1]_294
Calmodulin-TRUNC                  2.6e-05  367_[1]_1122
GRA2pre-TRUNC                     2.7e-05  1323_[1]_166
RiboP-TRUNCATED                   5.2e-05  1041_[1]_449
MIC11-PRO-TRUNC                   7.7e-05  1067_[1]_422
Camp-kin-cat-trunc                0.00011  236_[1]_1203
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 1 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 1 width=11 seqs=16
GRA7-TRUNC               ( 1203) TTTCAGAGACG  1 
MIC2-TRUNC               ( 1282) TTTCAGAGACG  1 
ROP9-TRUNC               ( 1092) ATTCAGAGACG  1 
G6PD_TRUNC               (  908) TTGCAGAGTCG  1 
PDIpro-trunc             (  357) TTCCAGAGTCG  1 
MIC5-TRUNC               (  880) GTTCAGAGACG  1 
MIC4-TRUNC               (  445) TTGGAGAGACG  1 
PK4-TRUNC                (   36) ATCCAGAGTCG  1 
GAPDH_TRUNC              (  994) TTGCAGAGACT  1 
cAMP_kinase_reg-trunc    ( 1211) TTCCAGCGTCG  1 
MIC6-TRUNC               ( 1196) TGTCAGCGACG  1 
Calmodulin-TRUNC         (  368) ATGCAGAGTCA  1 
GRA2pre-TRUNC            ( 1324) CGCCAGAGACG  1 
RiboP-TRUNCATED          ( 1042) CTTCAGGGTCG  1 
MIC11-PRO-TRUNC          ( 1068) TTTTCGAGACG  1 
Camp-kin-cat-trunc       (  237) TTTGAGAGAAA  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 1 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 5.1e+001 
   -22   -110   -198    123 
 -1064  -1064    -98    171 
 -1064    -10      2     91 
 -1064    160    -98   -209 
   210   -210  -1064  -1064 
 -1064  -1064    202  -1064 
   189   -110   -198  -1064 
 -1064  -1064    202  -1064 
   152  -1064  -1064     49 
  -180    180  -1064  -1064 
   -80  -1064    172   -209 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 1 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 5.1e+001 
 0.187519  0.125090  0.062615  0.624776 
 0.000136  0.000168  0.125076  0.874620 
 0.000136  0.250012  0.249998  0.499854 
 0.000136  0.812160  0.125076  0.062628 
 0.937051  0.062629  0.000154  0.000167 
 0.000136  0.000168  0.999529  0.000167 
 0.812129  0.125090  0.062615  0.000167 
 0.000136  0.000168  0.999529  0.000167 
 0.624746  0.000168  0.000154  0.374932 
 0.062597  0.937082  0.000154  0.000167 
 0.125058  0.000168  0.812146  0.062628 
--------------------------------------------------------------------------------





Time 41.39 secs.

********************************************************************************


********************************************************************************
MOTIF  2	width =    8   sites =  16   llr = 143   E-value = 9.3e+001
********************************************************************************
--------------------------------------------------------------------------------
	Motif 2 Description
--------------------------------------------------------------------------------
Simplified        A  869a9a81
pos.-specific     C  :4::::1:
probability       G  211:1::9
matrix            T  ::::::1:

         bits    2.2    * *  
                 2.0    * *  
                 1.8   ** *  
                 1.5 * **** *
Information      1.3 * ******
content          1.1 * ******
(12.9 bits)      0.9 ********
                 0.7 ********
                 0.4 ********
                 0.2 ********
                 0.0 --------

Multilevel           AAAAAAAG
consensus             C      
sequence                     
                             
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 2 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value              Site
-------------             ----- ---------            --------
GRA2pre-TRUNC               251  5.84e-06 GTGGAAACGA AAAAAAAG GGTTTCAGGA
MIC2-TRUNC                  126  5.84e-06 GTACATGGTC AAAAAAAG CCGTAATGCA
PK4-TRUNC                   476  5.84e-06 AGACGTTGGG AAAAAAAG TTATCGGCGT
cAMP_kinase_reg-trunc       429  5.84e-06 TATTCGTGTG AAAAAAAG TGGAAGTCCC
GRA7-TRUNC                  490  1.30e-05 TAGGAGATTC ACAAAAAG TTCAGGAAAA
PDIpro-trunc                728  1.96e-05 GCTCGTCCAC GAAAAAAG TGTTTCGTGA
MIC5-TRUNC                  813  3.85e-05 GATTCAAGGA AAAAAATG CATTGAACAA
G6PD_TRUNC                   58  3.85e-05 AGGACCTCCG AAAAAATG TCACTCTTCG
MIC11-PRO-TRUNC             660  4.66e-05 ATCACCAAAT GCAAAAAG CGAGCCTTCA
GAPDH_TRUNC                 783  5.32e-05 TTAGGAATGG AGAAAAAG GTAGTTTACA
RiboP-TRUNCATED            1117  5.96e-05 CAGGAGTCTG ACAAAAAA GTGAAGTTTT
Calmodulin-TRUNC            454  5.96e-05 CATCTACCAT ACAAAAAA ATCATGTGGG
ROP9-TRUNC                  425  6.76e-05 GGAACAGCAA ACAAGAAG ACGGGCAATA
MIC6-TRUNC                 1089  6.76e-05 AAACGCTGCA ACAAGAAG CACAGTCCAG
Camp-kin-cat-trunc          315  9.02e-05 TGGCGAGTGG AAGAAAAG CTGTTTCTCT
MIC4-TRUNC                  881  2.11e-04 CACTAAAACC GAAAAACG GAAGTCAGTA
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 2 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
GRA2pre-TRUNC                     5.8e-06  250_[2]_1242
MIC2-TRUNC                        5.8e-06  125_[2]_1367
PK4-TRUNC                         5.8e-06  475_[2]_1017
cAMP_kinase_reg-trunc             5.8e-06  428_[2]_1064
GRA7-TRUNC                        1.3e-05  489_[2]_1003
PDIpro-trunc                        2e-05  727_[2]_765
MIC5-TRUNC                        3.8e-05  812_[2]_680
G6PD_TRUNC                        3.8e-05  57_[2]_1435
MIC11-PRO-TRUNC                   4.7e-05  659_[2]_833
GAPDH_TRUNC                       5.3e-05  782_[2]_710
RiboP-TRUNCATED                     6e-05  1116_[2]_377
Calmodulin-TRUNC                    6e-05  453_[2]_1039
ROP9-TRUNC                        6.8e-05  424_[2]_1068
MIC6-TRUNC                        6.8e-05  1088_[2]_404
Camp-kin-cat-trunc                  9e-05  314_[2]_1128
MIC4-TRUNC                        0.00021  880_[2]_612
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 2 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 2 width=8 seqs=16
GRA2pre-TRUNC            (  251) AAAAAAAG  1 
MIC2-TRUNC               (  126) AAAAAAAG  1 
PK4-TRUNC                (  476) AAAAAAAG  1 
cAMP_kinase_reg-trunc    (  429) AAAAAAAG  1 
GRA7-TRUNC               (  490) ACAAAAAG  1 
PDIpro-trunc             (  728) GAAAAAAG  1 
MIC5-TRUNC               (  813) AAAAAATG  1 
G6PD_TRUNC               (   58) AAAAAATG  1 
MIC11-PRO-TRUNC          (  660) GCAAAAAG  1 
GAPDH_TRUNC              (  783) AGAAAAAG  1 
RiboP-TRUNCATED          ( 1117) ACAAAAAA  1 
Calmodulin-TRUNC         (  454) ACAAAAAA  1 
ROP9-TRUNC               (  425) ACAAGAAG  1 
MIC6-TRUNC               ( 1089) ACAAGAAG  1 
Camp-kin-cat-trunc       (  315) AAGAAAAG  1 
MIC4-TRUNC               (  881) GAAAAACG  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 2 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 8 n= 23839 bayes= 10.5401 E= 9.3e+001 
   189  -1064    -39  -1064 
   136     48   -198  -1064 
   210  -1064   -198  -1064 
   219  -1064  -1064  -1064 
   200  -1064    -98  -1064 
   219  -1064  -1064  -1064 
   189   -210  -1064   -109 
   -80  -1064    183  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 2 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 8 n= 23839 E= 9.3e+001 
 0.812129  0.000168  0.187537  0.000167 
 0.562285  0.374934  0.062615  0.000167 
 0.937051  0.000168  0.062615  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.874590  0.000168  0.125076  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.812129  0.062629  0.000154  0.125088 
 0.125058  0.000168  0.874607  0.000167 
--------------------------------------------------------------------------------





Time 82.95 secs.

********************************************************************************


********************************************************************************
MOTIF  3	width =   11   sites =  16   llr = 157   E-value = 2.2e+002
********************************************************************************
--------------------------------------------------------------------------------
	Motif 3 Description
--------------------------------------------------------------------------------
Simplified        A  ::1:1:::::8
pos.-specific     C  3::31241:a:
probability       G  ::::4:4:a::
matrix            T  8a974829::3

         bits    2.2            
                 2.0  *      ** 
                 1.8  *      ** 
                 1.5  **     ** 
Information      1.3  **  * ****
content          1.1 **** * ****
(14.1 bits)      0.9 **** * ****
                 0.7 **** * ****
                 0.4 **** ******
                 0.2 ***********
                 0.0 -----------

Multilevel           TTTTTTCTGCA
consensus            C  CG G   T
sequence                        
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 3 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
GRA7-TRUNC                  347  3.72e-07 CTCTGCTCTG TTTTTTCTGCA CTGCACCGCC
MIC5-TRUNC                   47  1.37e-06 GTGCAATTGC TTTTGTGTGCA ACCGACAGGC
PDIpro-trunc                100  3.47e-06 ATATTGTCGC TTTTGTTTGCA CTCCTGTACA
GAPDH_TRUNC                 662  3.47e-06 CGTCTCTCTT TTTCGTGTGCA TCTCATTCTT
Camp-kin-cat-trunc          723  3.77e-06 GACGCGATTT TTTTATCTGCA CCACTCGCCG
RiboP-TRUNCATED            1344  8.86e-06 TCTTCTTGTT TTTTGCGTGCA GGTTAAAGTG
GRA2pre-TRUNC              1404  8.86e-06 CATTAAACGA TTTCTTTTGCA ATTCGCGTCG
MIC4-TRUNC                 1157  1.44e-05 ACATCGACCA TTTTCTGTGCA TCTGTGCTGC
MIC6-TRUNC                  924  1.64e-05 ATTAAACGGG TTTCGTCTGCT TTAGATGTTT
MIC2-TRUNC                 1225  1.64e-05 GACCGTCCAG CTTTATCTGCA AGCAACGCCA
cAMP_kinase_reg-trunc      1451  2.10e-05 GGCGTGTCCC CTTTTTCTGCT TCTTTTTGCC
G6PD_TRUNC                   11  2.10e-05 CCAGACCCCT CTTTTTCTGCT GCTTACACGG
Calmodulin-TRUNC            418  2.27e-05 ACAAGATCGG TTATTTGTGCA CCCATTTCTA
PK4-TRUNC                   640  4.79e-05 AGGCCTTCCT CTTCGCCTGCA ACCTTCAGAG
ROP9-TRUNC                 1470  5.09e-05 TTCAAACACG TTTTTCGCGCA GTGCTTCCCT
MIC11-PRO-TRUNC             759  1.06e-04 CAATAGCGGG TTTCTTTCGCT AGTTCGCGAC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 3 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
GRA7-TRUNC                        3.7e-07  346_[3]_1143
MIC5-TRUNC                        1.4e-06  46_[3]_1443
PDIpro-trunc                      3.5e-06  99_[3]_1390
GAPDH_TRUNC                       3.5e-06  661_[3]_828
Camp-kin-cat-trunc                3.8e-06  722_[3]_717
RiboP-TRUNCATED                   8.9e-06  1343_[3]_147
GRA2pre-TRUNC                     8.9e-06  1403_[3]_86
MIC4-TRUNC                        1.4e-05  1156_[3]_333
MIC6-TRUNC                        1.6e-05  923_[3]_566
MIC2-TRUNC                        1.6e-05  1224_[3]_265
cAMP_kinase_reg-trunc             2.1e-05  1450_[3]_39
G6PD_TRUNC                        2.1e-05  10_[3]_1479
Calmodulin-TRUNC                  2.3e-05  417_[3]_1072
PK4-TRUNC                         4.8e-05  639_[3]_850
ROP9-TRUNC                        5.1e-05  1469_[3]_20
MIC11-PRO-TRUNC                   0.00011  758_[3]_731
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 3 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 3 width=11 seqs=16
GRA7-TRUNC               (  347) TTTTTTCTGCA  1 
MIC5-TRUNC               (   47) TTTTGTGTGCA  1 
PDIpro-trunc             (  100) TTTTGTTTGCA  1 
GAPDH_TRUNC              (  662) TTTCGTGTGCA  1 
Camp-kin-cat-trunc       (  723) TTTTATCTGCA  1 
RiboP-TRUNCATED          ( 1344) TTTTGCGTGCA  1 
GRA2pre-TRUNC            ( 1404) TTTCTTTTGCA  1 
MIC4-TRUNC               ( 1157) TTTTCTGTGCA  1 
MIC6-TRUNC               (  924) TTTCGTCTGCT  1 
MIC2-TRUNC               ( 1225) CTTTATCTGCA  1 
cAMP_kinase_reg-trunc    ( 1451) CTTTTTCTGCT  1 
G6PD_TRUNC               (   11) CTTTTTCTGCT  1 
Calmodulin-TRUNC         (  418) TTATTTGTGCA  1 
PK4-TRUNC                (  640) CTTCGCCTGCA  1 
ROP9-TRUNC               ( 1470) TTTTTCGCGCA  1 
MIC11-PRO-TRUNC          (  759) TTTCTTTCGCT  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 3 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 2.2e+002 
 -1064    -10  -1064    149 
 -1064  -1064  -1064    191 
  -180  -1064  -1064    181 
 -1064     22  -1064    137 
   -80   -210     61     71 
 -1064    -52  -1064    161 
 -1064     70     61    -51 
 -1064   -110  -1064    171 
 -1064  -1064    202  -1064 
 -1064    190  -1064  -1064 
   178  -1064  -1064     -9 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 3 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 2.2e+002 
 0.000136  0.250012  0.000154  0.749698 
 0.000136  0.000168  0.000154  0.999542 
 0.062597  0.000168  0.000154  0.937081 
 0.000136  0.312473  0.000154  0.687237 
 0.125058  0.062629  0.374920  0.437393 
 0.000136  0.187551  0.000154  0.812159 
 0.000136  0.437395  0.374920  0.187549 
 0.000136  0.125090  0.000154  0.874620 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.999543  0.000154  0.000167 
 0.749668  0.000168  0.000154  0.250010 
--------------------------------------------------------------------------------





Time 123.42 secs.

********************************************************************************


********************************************************************************
MOTIF  4	width =   11   sites =  16   llr = 158   E-value = 7.7e+001
********************************************************************************
--------------------------------------------------------------------------------
	Motif 4 Description
--------------------------------------------------------------------------------
Simplified        A  ::::::1::2:
pos.-specific     C  :::::634::8
probability       G  1a::::1:511
matrix            T  9:aaa456582

         bits    2.2            
                 2.0  ****      
                 1.8  ****      
                 1.5 *****      
Information      1.3 *****      
content          1.1 *****      
(14.3 bits)      0.9 ****** ****
                 0.7 ****** ****
                 0.4 ****** ****
                 0.2 ***********
                 0.0 -----------

Multilevel           TGTTTCTTGTC
consensus                 TCCT  
sequence                        
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 4 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
Calmodulin-TRUNC           1392  4.20e-07 TCACATTCGG TGTTTCTTGTC CGGGGGTGTT
MIC6-TRUNC                 1443  1.74e-06 ATATATGATG TGTTTTTTTTC GATTGGATGA
GRA2pre-TRUNC              1436  3.05e-06 TATCGCACGT TGTTTCTCGTC CCACGAATAG
GAPDH_TRUNC                 319  3.92e-06 TTGCCCTCTG TGTTTTCTGTC GCTGAGTGCA
cAMP_kinase_reg-trunc      1310  4.80e-06 AGCTCGCGTT TGTTTTCTTTC TGACAGTCCT
G6PD_TRUNC                 1275  6.14e-06 TTTCGTTTCC TGTTTCCCTTC GATGACCGCT
MIC2-TRUNC                  921  1.07e-05 ACGTCACAGT TGTTTTTTTAC GGGAAAATTC
PK4-TRUNC                  1086  1.34e-05 CGTACGTCTC TGTTTCTCGAC CTTTTTCGAT
ROP9-TRUNC                 1280  1.68e-05 GCCGGACTCT TGTTTCTCGTT AGCGCGTAGG
MIC4-TRUNC                 1462  1.98e-05 GTTGTGGATG TGTTTTCTTTT GTGACCGCTC
Camp-kin-cat-trunc          133  1.98e-05 TGGCAGTTCC TGTTTCGTTTC AACGTCACTT
PDIpro-trunc                913  3.00e-05 TAAGCGAGCT TGTTTTATTAC CTGGCTTTCG
MIC11-PRO-TRUNC            1172  3.39e-05 CTTTTCGTAC GGTTTTTTGTC TAGCATAAAC
RiboP-TRUNCATED             658  3.76e-05 GACAGCGCGT TGTTTCCTTGC GGCTGCGCCT
MIC5-TRUNC                 1410  3.76e-05 ATGTAGTTTC TGTTTCTCGTG AGACCGTGAA
GRA7-TRUNC                 1273  4.06e-05 CTTTGGAACG TGTTTCACGTT TGAGTTGCAC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 4 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
Calmodulin-TRUNC                  4.2e-07  1391_[4]_98
MIC6-TRUNC                        1.7e-06  1442_[4]_47
GRA2pre-TRUNC                       3e-06  1435_[4]_54
GAPDH_TRUNC                       3.9e-06  318_[4]_1171
cAMP_kinase_reg-trunc             4.8e-06  1309_[4]_180
G6PD_TRUNC                        6.1e-06  1274_[4]_215
MIC2-TRUNC                        1.1e-05  920_[4]_569
PK4-TRUNC                         1.3e-05  1085_[4]_404
ROP9-TRUNC                        1.7e-05  1279_[4]_210
MIC4-TRUNC                          2e-05  1461_[4]_28
Camp-kin-cat-trunc                  2e-05  132_[4]_1307
PDIpro-trunc                        3e-05  912_[4]_577
MIC11-PRO-TRUNC                   3.4e-05  1171_[4]_318
RiboP-TRUNCATED                   3.8e-05  657_[4]_833
MIC5-TRUNC                        3.8e-05  1409_[4]_80
GRA7-TRUNC                        4.1e-05  1272_[4]_217
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 4 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 4 width=11 seqs=16
Calmodulin-TRUNC         ( 1392) TGTTTCTTGTC  1 
MIC6-TRUNC               ( 1443) TGTTTTTTTTC  1 
GRA2pre-TRUNC            ( 1436) TGTTTCTCGTC  1 
GAPDH_TRUNC              (  319) TGTTTTCTGTC  1 
cAMP_kinase_reg-trunc    ( 1310) TGTTTTCTTTC  1 
G6PD_TRUNC               ( 1275) TGTTTCCCTTC  1 
MIC2-TRUNC               (  921) TGTTTTTTTAC  1 
PK4-TRUNC                ( 1086) TGTTTCTCGAC  1 
ROP9-TRUNC               ( 1280) TGTTTCTCGTT  1 
MIC4-TRUNC               ( 1462) TGTTTTCTTTT  1 
Camp-kin-cat-trunc       (  133) TGTTTCGTTTC  1 
PDIpro-trunc             (  913) TGTTTTATTAC  1 
MIC11-PRO-TRUNC          ( 1172) GGTTTTTTGTC  1 
RiboP-TRUNCATED          (  658) TGTTTCCTTGC  1 
MIC5-TRUNC               ( 1410) TGTTTCTCGTG  1 
GRA7-TRUNC               ( 1273) TGTTTCACGTT  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 4 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 7.7e+001 
 -1064  -1064   -198    181 
 -1064  -1064    202  -1064 
 -1064  -1064  -1064    191 
 -1064  -1064  -1064    191 
 -1064  -1064  -1064    191 
 -1064    107  -1064     71 
   -80     22   -198     91 
 -1064     48  -1064    123 
 -1064  -1064    102     91 
   -22  -1064   -198    149 
 -1064    148   -198    -51 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 4 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 7.7e+001 
 0.000136  0.000168  0.062615  0.937081 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.562316  0.000154  0.437393 
 0.125058  0.312473  0.062615  0.499854 
 0.000136  0.374934  0.000154  0.624776 
 0.000136  0.000168  0.499842  0.499854 
 0.187519  0.000168  0.062615  0.749698 
 0.000136  0.749699  0.062615  0.187549 
--------------------------------------------------------------------------------





Time 163.67 secs.

********************************************************************************


********************************************************************************
MOTIF  5	width =    8   sites =  16   llr = 142   E-value = 4.8e+002
********************************************************************************
--------------------------------------------------------------------------------
	Motif 5 Description
--------------------------------------------------------------------------------
Simplified        A  3:8:aaa3
pos.-specific     C  :9:1:::7
probability       G  81:9::::
matrix            T  :12::::1

         bits    2.2     *** 
                 2.0     *** 
                 1.8     *** 
                 1.5   ***** 
Information      1.3 ******* 
content          1.1 ******* 
(12.8 bits)      0.9 ********
                 0.7 ********
                 0.4 ********
                 0.2 ********
                 0.0 --------

Multilevel           GCAGAAAC
consensus            A      A
sequence                     
                             
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 5 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value              Site
-------------             ----- ---------            --------
RiboP-TRUNCATED               1  9.96e-06          . GCAGAAAC TGCGGGGAAT
GRA7-TRUNC                  949  9.96e-06 GTTCGCGCCT GCAGAAAC CCACGAGCCC
ROP9-TRUNC                  449  9.96e-06 AATATATCTG GCAGAAAC ATCTAAGCAC
MIC5-TRUNC                 1112  9.96e-06 CTGGAGAGAC GCAGAAAC TTAGATCCAG
MIC2-TRUNC                  613  9.96e-06 CCTTTGTAAC GCAGAAAC TGAAAATAAC
Camp-kin-cat-trunc         1397  1.81e-05 TTGTTCGACG GCAGAAAA GGCTTCTTGT
G6PD_TRUNC                  376  2.69e-05 TCGCCGACTT ACAGAAAC CATTGACGAC
GRA2pre-TRUNC               315  3.91e-05 GACAGATCCC GCTGAAAC CTCTAAACAC
cAMP_kinase_reg-trunc       123  3.91e-05 AGATGCTTCC GCTGAAAC CTACGAATCT
PDIpro-trunc                453  4.62e-05 ACCGCAATCC ACAGAAAA CCACACAACA
MIC11-PRO-TRUNC            1140  5.71e-05 GGGCAACGTG GCACAAAC GCAGTCGTTA
MIC4-TRUNC                  993  6.70e-05 ATCCTGACTA GCAGAAAT TCGTTCACCC
PK4-TRUNC                  1469  8.60e-05 GTTGTTTGTT GGAGAAAC AGCTTTTCTA
GAPDH_TRUNC                1018  8.60e-05 TTCCACTGTC GCTGAAAA GGGAGAGTAT
Calmodulin-TRUNC           1097  1.25e-04 TTGTTGTAAC ACACAAAC CGCTAGTGCT
MIC6-TRUNC                  549  2.56e-04 ATTGTTTTCC ATAGAAAA CACTACTGGA
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 5 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
RiboP-TRUNCATED                     1e-05  [5]_1493
GRA7-TRUNC                          1e-05  948_[5]_544
ROP9-TRUNC                          1e-05  448_[5]_1044
MIC5-TRUNC                          1e-05  1111_[5]_381
MIC2-TRUNC                          1e-05  612_[5]_880
Camp-kin-cat-trunc                1.8e-05  1396_[5]_46
G6PD_TRUNC                        2.7e-05  375_[5]_1117
GRA2pre-TRUNC                     3.9e-05  314_[5]_1178
cAMP_kinase_reg-trunc             3.9e-05  122_[5]_1370
PDIpro-trunc                      4.6e-05  452_[5]_1040
MIC11-PRO-TRUNC                   5.7e-05  1139_[5]_353
MIC4-TRUNC                        6.7e-05  992_[5]_500
PK4-TRUNC                         8.6e-05  1468_[5]_24
GAPDH_TRUNC                       8.6e-05  1017_[5]_475
Calmodulin-TRUNC                  0.00013  1096_[5]_396
MIC6-TRUNC                        0.00026  548_[5]_944
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 5 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 5 width=8 seqs=16
RiboP-TRUNCATED          (    1) GCAGAAAC  1 
GRA7-TRUNC               (  949) GCAGAAAC  1 
ROP9-TRUNC               (  449) GCAGAAAC  1 
MIC5-TRUNC               ( 1112) GCAGAAAC  1 
MIC2-TRUNC               (  613) GCAGAAAC  1 
Camp-kin-cat-trunc       ( 1397) GCAGAAAA  1 
G6PD_TRUNC               (  376) ACAGAAAC  1 
GRA2pre-TRUNC            (  315) GCTGAAAC  1 
cAMP_kinase_reg-trunc    (  123) GCTGAAAC  1 
PDIpro-trunc             (  453) ACAGAAAA  1 
MIC11-PRO-TRUNC          ( 1140) GCACAAAC  1 
MIC4-TRUNC               (  993) GCAGAAAT  1 
PK4-TRUNC                ( 1469) GGAGAAAC  1 
GAPDH_TRUNC              ( 1018) GCTGAAAA  1 
Calmodulin-TRUNC         ( 1097) ACACAAAC  1 
MIC6-TRUNC               (  549) ATAGAAAA  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 5 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 8 n= 23839 bayes= 10.5401 E= 4.8e+002 
    19  -1064    161  -1064 
 -1064    170   -198   -209 
   189  -1064  -1064    -51 
 -1064   -110    183  -1064 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
    19    136  -1064   -209 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 5 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 8 n= 23839 E= 4.8e+002 
 0.249980  0.000168  0.749685  0.000167 
 0.000136  0.874621  0.062615  0.062628 
 0.812129  0.000168  0.000154  0.187549 
 0.000136  0.125090  0.874607  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.249980  0.687238  0.000154  0.062628 
--------------------------------------------------------------------------------





Time 204.07 secs.

********************************************************************************


********************************************************************************
MOTIF  6	width =   11   sites =  16   llr = 152   E-value = 8.1e+004
********************************************************************************
--------------------------------------------------------------------------------
	Motif 6 Description
--------------------------------------------------------------------------------
Simplified        A  ::::::::::1
pos.-specific     C  33:8::a2a:2
probability       G  65a:81:1:17
matrix            T  12:239:7:91

         bits    2.2            
                 2.0   *   * *  
                 1.8   *   * *  
                 1.5   *   * ** 
Information      1.3   *  ** ** 
content          1.1   ***** ** 
(13.7 bits)      0.9   ***** ** 
                 0.7 * *********
                 0.4 ***********
                 0.2 ***********
                 0.0 -----------

Multilevel           GGGCGTCTCTG
consensus            CC  T      
sequence                        
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 6 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
MIC11-PRO-TRUNC            1307  3.33e-07 CAGCGCACAA GGGCGTCTCTG GTTGCCAGAC
MIC6-TRUNC                 1488  6.97e-07 GCTTCCTGCC GCGCGTCTCTG CT        
GAPDH_TRUNC                 220  1.78e-06 CGCGACAACT GGGCTTCTCTG TAAGCCAAGT
MIC5-TRUNC                 1042  1.01e-05 ACGCCGATCC GGGCGTCTCTT TGTTTTCCTT
RiboP-TRUNCATED            1408  1.12e-05 AGCTTCCCCT CGGTGTCTCTG CGTTTTCCTG
PDIpro-trunc               1128  1.19e-05 AGTGTCGAGC GGGCGTCTCGG TGTCGCCGTC
GRA7-TRUNC                 1129  1.48e-05 ACGAGGAGAC GCGCGTCTCTA GAGAGACCCG
MIC4-TRUNC                  633  1.77e-05 TCCATTGACG GTGCGGCTCTG CAGAATATGT
MIC2-TRUNC                 1414  2.10e-05 GCCCGCCCTT TGGCGTCTCTC ATTTTGGGTG
Calmodulin-TRUNC            597  2.46e-05 GAGCAATAAA GCGTGTCCCTG TTTCTCCGTT
PK4-TRUNC                   546  3.46e-05 CCGACGCGCA CGGCTTCTCTC CGCAATCGCT
cAMP_kinase_reg-trunc       292  3.46e-05 GAATTTCCAT GCGCTGCTCTG CGAGGTGCCT
GRA2pre-TRUNC              1353  3.80e-05 ACAGCGGAAC CTGCGTCGCTG TCTGTCCTGC
Camp-kin-cat-trunc          472  3.97e-05 GACCGCGAGA CGGTGTCCCTG AATAGTTCGC
G6PD_TRUNC                  538  4.33e-05 CCCACATGTG TCGCGTCGCTG TTGCTTGACA
ROP9-TRUNC                 1481  9.32e-05 TTTTCGCGCA GTGCTTCCCTC GTTTCTCGG 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 6 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   3.3e-07  1306_[6]_183
MIC6-TRUNC                          7e-07  1487_[6]_2
GAPDH_TRUNC                       1.8e-06  219_[6]_1270
MIC5-TRUNC                          1e-05  1041_[6]_448
RiboP-TRUNCATED                   1.1e-05  1407_[6]_83
PDIpro-trunc                      1.2e-05  1127_[6]_362
GRA7-TRUNC                        1.5e-05  1128_[6]_361
MIC4-TRUNC                        1.8e-05  632_[6]_857
MIC2-TRUNC                        2.1e-05  1413_[6]_76
Calmodulin-TRUNC                  2.5e-05  596_[6]_893
PK4-TRUNC                         3.5e-05  545_[6]_944
cAMP_kinase_reg-trunc             3.5e-05  291_[6]_1198
GRA2pre-TRUNC                     3.8e-05  1352_[6]_137
Camp-kin-cat-trunc                  4e-05  471_[6]_968
G6PD_TRUNC                        4.3e-05  537_[6]_952
ROP9-TRUNC                        9.3e-05  1480_[6]_9
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 6 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 6 width=11 seqs=16
MIC11-PRO-TRUNC          ( 1307) GGGCGTCTCTG  1 
MIC6-TRUNC               ( 1488) GCGCGTCTCTG  1 
GAPDH_TRUNC              (  220) GGGCTTCTCTG  1 
MIC5-TRUNC               ( 1042) GGGCGTCTCTT  1 
RiboP-TRUNCATED          ( 1408) CGGTGTCTCTG  1 
PDIpro-trunc             ( 1128) GGGCGTCTCGG  1 
GRA7-TRUNC               ( 1129) GCGCGTCTCTA  1 
MIC4-TRUNC               (  633) GTGCGGCTCTG  1 
MIC2-TRUNC               ( 1414) TGGCGTCTCTC  1 
Calmodulin-TRUNC         (  597) GCGTGTCCCTG  1 
PK4-TRUNC                (  546) CGGCTTCTCTC  1 
cAMP_kinase_reg-trunc    (  292) GCGCTGCTCTG  1 
GRA2pre-TRUNC            ( 1353) CTGCGTCGCTG  1 
Camp-kin-cat-trunc       (  472) CGGTGTCCCTG  1 
G6PD_TRUNC               (  538) TCGCGTCGCTG  1 
ROP9-TRUNC               ( 1481) GTGCTTCCCTC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 6 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 8.1e+004 
 -1064    -10    134   -109 
 -1064     22    102    -51 
 -1064  -1064    202  -1064 
 -1064    160  -1064    -51 
 -1064  -1064    161     -9 
 -1064  -1064    -98    171 
 -1064    190  -1064  -1064 
 -1064    -52    -98    137 
 -1064    190  -1064  -1064 
 -1064  -1064   -198    181 
  -180    -52    148   -209 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 6 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 8.1e+004 
 0.000136  0.250012  0.624763  0.125088 
 0.000136  0.312473  0.499842  0.187549 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.812160  0.000154  0.187549 
 0.000136  0.000168  0.749685  0.250010 
 0.000136  0.000168  0.125076  0.874620 
 0.000136  0.999543  0.000154  0.000167 
 0.000136  0.187551  0.125076  0.687237 
 0.000136  0.999543  0.000154  0.000167 
 0.000136  0.000168  0.062615  0.937081 
 0.062597  0.187551  0.687224  0.062628 
--------------------------------------------------------------------------------





Time 244.55 secs.

********************************************************************************


********************************************************************************
MOTIF  7	width =   11   sites =  16   llr = 157   E-value = 3.5e+002
********************************************************************************
--------------------------------------------------------------------------------
	Motif 7 Description
--------------------------------------------------------------------------------
Simplified        A  6889:49::::
pos.-specific     C  1::1a118::4
probability       G  332::3:3:36
matrix            T  :::::31:a7:

         bits    2.2            
                 2.0     *   *  
                 1.8    **   *  
                 1.5   *** * *  
Information      1.3  **** * *  
content          1.1  **** **** 
(14.2 bits)      0.9 ***** *****
                 0.7 ***** *****
                 0.4 ***** *****
                 0.2 ***********
                 0.0 -----------

Multilevel           AAAACAACTTG
consensus            GG   G G GC
sequence                  T     
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 7 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
MIC6-TRUNC                  485  7.36e-07 CAGCCGATCC AAAACTACTTG CCCACTTCCG
PDIpro-trunc                 75  1.18e-06 CACAGGAGGC AAAACGACTTC CACAATATTG
GRA2pre-TRUNC              1075  2.11e-06 AGGCTTGCGA AAAACAAGTTC GTCGCAAAAG
G6PD_TRUNC                  502  3.66e-06 GATCTGTGTA GAAACAACTGG TGAATAGCTG
PK4-TRUNC                   116  5.16e-06 CGTTGGTGAA AAAACGAGTTC CACCCGGCGG
ROP9-TRUNC                  781  7.99e-06 CCTGCTCGAA GAAACGACTGG ATTTTACTTC
MIC11-PRO-TRUNC             429  1.04e-05 TACACATTAC AGAACTACTGG AATGCTCCAG
MIC2-TRUNC                  318  1.14e-05 GACATGCAGA AAGACAACTGC TGAAGGAATC
GRA7-TRUNC                 1393  1.44e-05 TTGCAGCGGC AAAACATCTTG TGTAAAATTC
MIC5-TRUNC                  156  1.44e-05 CGGAAAATAT GGAACTACTTG GAACAAAATG
Camp-kin-cat-trunc          651  1.56e-05 GCGCTCCAGA AAGACAAGTTC AACTGCTGTA
GAPDH_TRUNC                1043  1.56e-05 TATGCAAAAT AGAACTACTGC GCTTATCGGA
Calmodulin-TRUNC            890  2.18e-05 GCTGCGATGG CAGACAACTTG GTTTTGATCC
MIC4-TRUNC                  471  2.62e-05 TAGGGATTGT CGAACGACTTG CGAAGCGACC
cAMP_kinase_reg-trunc       731  6.40e-05 TTCCTCGGCC GAAACACGTTG AGGCGGCTTG
RiboP-TRUNCATED             625  9.30e-05 TAATCGCTGG AAACCCACTTC TGAAGCTGCA
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 7 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC6-TRUNC                        7.4e-07  484_[7]_1005
PDIpro-trunc                      1.2e-06  74_[7]_1415
GRA2pre-TRUNC                     2.1e-06  1074_[7]_415
G6PD_TRUNC                        3.7e-06  501_[7]_988
PK4-TRUNC                         5.2e-06  115_[7]_1374
ROP9-TRUNC                          8e-06  780_[7]_709
MIC11-PRO-TRUNC                     1e-05  428_[7]_1061
MIC2-TRUNC                        1.1e-05  317_[7]_1172
GRA7-TRUNC                        1.4e-05  1392_[7]_97
MIC5-TRUNC                        1.4e-05  155_[7]_1334
Camp-kin-cat-trunc                1.6e-05  650_[7]_789
GAPDH_TRUNC                       1.6e-05  1042_[7]_447
Calmodulin-TRUNC                  2.2e-05  889_[7]_600
MIC4-TRUNC                        2.6e-05  470_[7]_1019
cAMP_kinase_reg-trunc             6.4e-05  730_[7]_759
RiboP-TRUNCATED                   9.3e-05  624_[7]_866
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 7 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 7 width=11 seqs=16
MIC6-TRUNC               (  485) AAAACTACTTG  1 
PDIpro-trunc             (   75) AAAACGACTTC  1 
GRA2pre-TRUNC            ( 1075) AAAACAAGTTC  1 
G6PD_TRUNC               (  502) GAAACAACTGG  1 
PK4-TRUNC                (  116) AAAACGAGTTC  1 
ROP9-TRUNC               (  781) GAAACGACTGG  1 
MIC11-PRO-TRUNC          (  429) AGAACTACTGG  1 
MIC2-TRUNC               (  318) AAGACAACTGC  1 
GRA7-TRUNC               ( 1393) AAAACATCTTG  1 
MIC5-TRUNC               (  156) GGAACTACTTG  1 
Camp-kin-cat-trunc       (  651) AAGACAAGTTC  1 
GAPDH_TRUNC              ( 1043) AGAACTACTGC  1 
Calmodulin-TRUNC         (  890) CAGACAACTTG  1 
MIC4-TRUNC               (  471) CGAACGACTTG  1 
cAMP_kinase_reg-trunc    (  731) GAAACACGTTG  1 
RiboP-TRUNCATED          (  625) AAACCCACTTC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 7 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 3.5e+002 
   152   -110      2  -1064 
   178  -1064      2  -1064 
   189  -1064    -39  -1064 
   210   -210  -1064  -1064 
 -1064    190  -1064  -1064 
   100   -210      2     -9 
   200   -210  -1064   -209 
 -1064    148      2  -1064 
 -1064  -1064  -1064    191 
 -1064  -1064     34    137 
 -1064     70    119  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 7 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 3.5e+002 
 0.624746  0.125090  0.249998  0.000167 
 0.749668  0.000168  0.249998  0.000167 
 0.812129  0.000168  0.187537  0.000167 
 0.937051  0.062629  0.000154  0.000167 
 0.000136  0.999543  0.000154  0.000167 
 0.437363  0.062629  0.249998  0.250010 
 0.874590  0.062629  0.000154  0.062628 
 0.000136  0.749699  0.249998  0.000167 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.000168  0.312459  0.687237 
 0.000136  0.437395  0.562302  0.000167 
--------------------------------------------------------------------------------





Time 284.02 secs.

********************************************************************************


********************************************************************************
MOTIF  8	width =   19   sites =  16   llr = 191   E-value = 3.7e+001
********************************************************************************
--------------------------------------------------------------------------------
	Motif 8 Description
--------------------------------------------------------------------------------
Simplified        A  39:51:::1::32312:33
pos.-specific     C  718::11a:13432:3117
probability       G  1:21934:918:537184:
matrix            T  :::4:65::9:3:324211

         bits    2.2                    
                 2.0        *           
                 1.8  *  *  *           
                 1.5  *  *  **          
Information      1.3  ** *  ***         
content          1.1  ** *  ****        
(17.2 bits)      0.9 *** *  ****   * * *
                 0.7 ****** ****   * * *
                 0.4 ************* * * *
                 0.2 ************* * ***
                 0.0 -------------------

Multilevel           CACAGTTCGTGCGTGTGGC
consensus            A  T GG   CACA C AA
sequence                        T G     
                                        
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 8 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value                   Site      
-------------             ----- ---------            -------------------
Calmodulin-TRUNC           1279  1.16e-09 GCGGTATACC CACTGTGCGTGCGTGCGGC TCTTTTCTGA
MIC5-TRUNC                  573  1.03e-08 GCTATAATCA CACAGTTCGTCCCTGTGAC GCATTTGCTA
GAPDH_TRUNC                 821  4.22e-08 AGTCCCCATG CACAGTGCGTGAGTACGGA CTCTAGCGTC
MIC2-TRUNC                  157  1.97e-07 TTACACCAGG AACGGGTCGTGTGGGAGGC CGTCAGCGCT
RiboP-TRUNCATED             712  3.46e-07 AGGAGACAGA CACAGCTCGTCCGGGAGAA GAATCTACCT
PK4-TRUNC                   503  5.23e-07 TAGTTCTCCA CACAGGCCGTGCGGGGGTC CTCAAGCGTC
G6PD_TRUNC                  610  7.05e-07 CCGACCGTGC CAGAGGGCGTCAGAGTGTC GCAACGCGAC
MIC4-TRUNC                  329  1.13e-06 ACGAGAAGCT CAGTGTTCGTGTACATGAC CAATGCCGAC
ROP9-TRUNC                   81  1.47e-06 CCTGCAGACG AACTGTTCGTGACTTGTGC TGCTTATGTG
GRA7-TRUNC                  522  2.64e-06 GTTTCCGAAC AACGGTTCGTCCCCGCTGC ACTGGCCGGC
GRA2pre-TRUNC               815  2.85e-06 CGAGTACGAC CACTGTGCGTGTACTTCGC CAAAAGGAAA
Camp-kin-cat-trunc          213  4.50e-06 CTGAACGGGC AACAGTCCACGAGAGCGGC GTTTCTTTGA
MIC11-PRO-TRUNC            1087  4.84e-06 CGTCTGTCGA GAGAGTTCGTGTCAGTTAA ACTTGAAGCT
cAMP_kinase_reg-trunc       604  5.98e-06 GGCTCCTTCC CACAAGGCGTGAAGGAGCA GAGAAACACC
PDIpro-trunc                168  1.15e-05 CTTCTCGGCA CACTGCTCGGGCCTGCGAT CTCACGTGCC
MIC6-TRUNC                   17  1.46e-05 GACCGGGGTG CCCTGTGCATGTGATTGCC GTTTCCAGTT
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 8 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
Calmodulin-TRUNC                  1.2e-09  1278_[8]_203
MIC5-TRUNC                          1e-08  572_[8]_909
GAPDH_TRUNC                       4.2e-08  820_[8]_661
MIC2-TRUNC                          2e-07  156_[8]_1325
RiboP-TRUNCATED                   3.5e-07  711_[8]_771
PK4-TRUNC                         5.2e-07  502_[8]_979
G6PD_TRUNC                          7e-07  609_[8]_872
MIC4-TRUNC                        1.1e-06  328_[8]_1153
ROP9-TRUNC                        1.5e-06  80_[8]_1401
GRA7-TRUNC                        2.6e-06  521_[8]_960
GRA2pre-TRUNC                     2.9e-06  814_[8]_667
Camp-kin-cat-trunc                4.5e-06  212_[8]_1219
MIC11-PRO-TRUNC                   4.8e-06  1086_[8]_395
cAMP_kinase_reg-trunc               6e-06  603_[8]_878
PDIpro-trunc                      1.1e-05  167_[8]_1314
MIC6-TRUNC                        1.5e-05  16_[8]_1465
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 8 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 8 width=19 seqs=16
Calmodulin-TRUNC         ( 1279) CACTGTGCGTGCGTGCGGC  1 
MIC5-TRUNC               (  573) CACAGTTCGTCCCTGTGAC  1 
GAPDH_TRUNC              (  821) CACAGTGCGTGAGTACGGA  1 
MIC2-TRUNC               (  157) AACGGGTCGTGTGGGAGGC  1 
RiboP-TRUNCATED          (  712) CACAGCTCGTCCGGGAGAA  1 
PK4-TRUNC                (  503) CACAGGCCGTGCGGGGGTC  1 
G6PD_TRUNC               (  610) CAGAGGGCGTCAGAGTGTC  1 
MIC4-TRUNC               (  329) CAGTGTTCGTGTACATGAC  1 
ROP9-TRUNC               (   81) AACTGTTCGTGACTTGTGC  1 
GRA7-TRUNC               (  522) AACGGTTCGTCCCCGCTGC  1 
GRA2pre-TRUNC            (  815) CACTGTGCGTGTACTTCGC  1 
Camp-kin-cat-trunc       (  213) AACAGTCCACGAGAGCGGC  1 
MIC11-PRO-TRUNC          ( 1087) GAGAGTTCGTGTCAGTTAA  1 
cAMP_kinase_reg-trunc    (  604) CACAAGGCGTGAAGGAGCA  1 
PDIpro-trunc             (  168) CACTGCTCGGGCCTGCGAT  1 
MIC6-TRUNC               (   17) CCCTGTGCATGTGATTGCC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 8 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 19 n= 23663 bayes= 10.5294 E= 3.7e+001 
    19    136   -198  -1064 
   210   -210  -1064  -1064 
 -1064    160    -39  -1064 
   119  -1064    -98     49 
  -180  -1064    193  -1064 
 -1064   -110      2    123 
 -1064   -110     61     91 
 -1064    190  -1064  -1064 
   -80  -1064    183  -1064 
 -1064   -210   -198    171 
 -1064    -10    161  -1064 
    52     48  -1064     23 
   -22     22    102  -1064 
    19    -52      2     23 
   -80  -1064    148    -51 
   -22     22    -98     49 
 -1064   -210    161    -51 
    52   -110     83   -109 
    19    136  -1064   -209 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 8 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 19 n= 23663 E= 3.7e+001 
 0.249980  0.687238  0.062615  0.000167 
 0.937051  0.062629  0.000154  0.000167 
 0.000136  0.812160  0.187537  0.000167 
 0.499824  0.000168  0.125076  0.374932 
 0.062597  0.000168  0.937068  0.000167 
 0.000136  0.125090  0.249998  0.624776 
 0.000136  0.125090  0.374920  0.499854 
 0.000136  0.999543  0.000154  0.000167 
 0.125058  0.000168  0.874607  0.000167 
 0.000136  0.062629  0.062615  0.874620 
 0.000136  0.250012  0.749685  0.000167 
 0.312441  0.374934  0.000154  0.312471 
 0.187519  0.312473  0.499842  0.000167 
 0.249980  0.187551  0.249998  0.312471 
 0.125058  0.000168  0.687224  0.187549 
 0.187519  0.312473  0.125076  0.374932 
 0.000136  0.062629  0.749685  0.187549 
 0.312441  0.125090  0.437381  0.125088 
 0.249980  0.687238  0.000154  0.062628 
--------------------------------------------------------------------------------





Time 323.49 secs.

********************************************************************************


********************************************************************************
MOTIF  9	width =   11   sites =  16   llr = 158   E-value = 1.2e+002
********************************************************************************
--------------------------------------------------------------------------------
	Motif 9 Description
--------------------------------------------------------------------------------
Simplified        A  58136a8a:3:
pos.-specific     C  5:7:3:1:a35
probability       G  :238::1::45
matrix            T  ::::1::::1:

         bits    2.2      * *   
                 2.0      * **  
                 1.8      * **  
                 1.5  *   * **  
Information      1.3  * * ****  
content          1.1 ** * ****  
(14.3 bits)      0.9 ********* *
                 0.7 ********* *
                 0.4 ********* *
                 0.2 ***********
                 0.0 -----------

Multilevel           AACGAAAACGC
consensus            C GAC    AG
sequence                      C 
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 9 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
MIC6-TRUNC                  883  5.46e-07 AGTATTCCGC CACGAAAACGC GCACCGCAAG
GRA2pre-TRUNC              1117  2.25e-06 ACGCACCACG AAGGAAAACGC GTATCACGTC
ROP9-TRUNC                 1125  2.25e-06 CGTAGCAGGC AACGCAAACGC CAGGCATTGT
MIC5-TRUNC                  681  3.14e-06 CTGTAGCAAG CACGCAAACGC AGCCCCGTTT
GRA7-TRUNC                  500  4.49e-06 ACAAAAAGTT CAGGAAAACAG TGTTTCCGAA
PK4-TRUNC                   432  5.44e-06 GTCCACTTCC AGCGAAAACGG AGTTCACCCT
MIC2-TRUNC                  878  6.97e-06 CATCGCACCC CACAAAAACCG TTGCCAAGAA
RiboP-TRUNCATED             962  7.67e-06 GAAGAAGCGA AAGAAAAACGG AGTAGAGAGG
MIC11-PRO-TRUNC            1026  1.25e-05 CACAAACTAA AACACAAACAC TTCCATTTAT
cAMP_kinase_reg-trunc       266  1.69e-05 ACAACACTCC AAAGAAAACAC AACTCGAATT
GAPDH_TRUNC                1276  1.69e-05 GGACAGGGTG CACACAAACCG CACACGCGTG
MIC4-TRUNC                 1482  2.34e-05 TGTGACCGCT CACGAACACCC CACGCAAA  
Camp-kin-cat-trunc         1146  3.21e-05 CAGCCACATC AACGAAGACCC CTTTTCGGTC
Calmodulin-TRUNC           1199  4.17e-05 CTACGCTGCT CGCGAAAACTG TGGTGGTTTT
G6PD_TRUNC                  935  4.44e-05 ATCTCTGGAT AAGGTAAACAG CAGCACTGTG
PDIpro-trunc               1174  8.13e-05 CCACACCATT CGCGCACACGG CACACAACAG
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 9 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC6-TRUNC                        5.5e-07  882_[9]_607
GRA2pre-TRUNC                     2.3e-06  1116_[9]_373
ROP9-TRUNC                        2.3e-06  1124_[9]_365
MIC5-TRUNC                        3.1e-06  680_[9]_809
GRA7-TRUNC                        4.5e-06  499_[9]_990
PK4-TRUNC                         5.4e-06  431_[9]_1058
MIC2-TRUNC                          7e-06  877_[9]_612
RiboP-TRUNCATED                   7.7e-06  961_[9]_529
MIC11-PRO-TRUNC                   1.2e-05  1025_[9]_464
cAMP_kinase_reg-trunc             1.7e-05  265_[9]_1224
GAPDH_TRUNC                       1.7e-05  1275_[9]_214
MIC4-TRUNC                        2.3e-05  1481_[9]_8
Camp-kin-cat-trunc                3.2e-05  1145_[9]_294
Calmodulin-TRUNC                  4.2e-05  1198_[9]_291
G6PD_TRUNC                        4.4e-05  934_[9]_555
PDIpro-trunc                      8.1e-05  1173_[9]_316
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 9 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 9 width=11 seqs=16
MIC6-TRUNC               (  883) CACGAAAACGC  1 
GRA2pre-TRUNC            ( 1117) AAGGAAAACGC  1 
ROP9-TRUNC               ( 1125) AACGCAAACGC  1 
MIC5-TRUNC               (  681) CACGCAAACGC  1 
GRA7-TRUNC               (  500) CAGGAAAACAG  1 
PK4-TRUNC                (  432) AGCGAAAACGG  1 
MIC2-TRUNC               (  878) CACAAAAACCG  1 
RiboP-TRUNCATED          (  962) AAGAAAAACGG  1 
MIC11-PRO-TRUNC          ( 1026) AACACAAACAC  1 
cAMP_kinase_reg-trunc    (  266) AAAGAAAACAC  1 
GAPDH_TRUNC              ( 1276) CACACAAACCG  1 
MIC4-TRUNC               ( 1482) CACGAACACCC  1 
Camp-kin-cat-trunc       ( 1146) AACGAAGACCC  1 
Calmodulin-TRUNC         ( 1199) CGCGAAAACTG  1 
G6PD_TRUNC               (  935) AAGGTAAACAG  1 
PDIpro-trunc             ( 1174) CGCGCACACGG  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 9 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 1.2e+002 
   119     90  -1064  -1064 
   189  -1064    -39  -1064 
  -180    136      2  -1064 
    19  -1064    161  -1064 
   152     22  -1064   -209 
   219  -1064  -1064  -1064 
   189   -110   -198  -1064 
   219  -1064  -1064  -1064 
 -1064    190  -1064  -1064 
    19    -10     83   -209 
 -1064     90    102  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 9 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 1.2e+002 
 0.499824  0.499855  0.000154  0.000167 
 0.812129  0.000168  0.187537  0.000167 
 0.062597  0.687238  0.249998  0.000167 
 0.249980  0.000168  0.749685  0.000167 
 0.624746  0.312473  0.000154  0.062628 
 0.999512  0.000168  0.000154  0.000167 
 0.812129  0.125090  0.062615  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.999543  0.000154  0.000167 
 0.249980  0.250012  0.437381  0.062628 
 0.000136  0.499855  0.499842  0.000167 
--------------------------------------------------------------------------------





Time 362.92 secs.

********************************************************************************


********************************************************************************
MOTIF 10	width =   11   sites =  16   llr = 151   E-value = 5.8e+004
********************************************************************************
--------------------------------------------------------------------------------
	Motif 10 Description
--------------------------------------------------------------------------------
Simplified        A  21:1:a2246:
pos.-specific     C  19:2a::8:12
probability       G  1:13::8:638
matrix            T  6:94:::::::

         bits    2.2      *     
                 2.0     **     
                 1.8     **     
                 1.5  *  **     
Information      1.3  ** ****  *
content          1.1  ** ***** *
(13.6 bits)      0.9  ** *******
                 0.7  ** *******
                 0.4 *** *******
                 0.2 ***********
                 0.0 -----------

Multilevel           TCTTCAGCGAG
consensus               G    AG 
sequence                        
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 10 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
cAMP_kinase_reg-trunc      1127  2.62e-07 TTTTCGACTC TCTTCAGCGAG CGAGAAAAGG
G6PD_TRUNC                  726  4.94e-07 CGAGATTATA TCTTCAGCAAG TCACTAAGCC
GRA2pre-TRUNC               798  1.51e-06 GTGGAACAGA TCTCCAGCGAG TACGACCACT
MIC5-TRUNC                  312  1.51e-06 GGTACTACCT TCTGCAGCAAG TGTTCCGTTC
RiboP-TRUNCATED             942  2.92e-06 TCGACTTCAT TCTGCAGCGGG AAGAAGCGAA
Calmodulin-TRUNC             26  1.74e-05 CGTTCTCCCC ACTTCAGAAAG TTCACAGTAT
PK4-TRUNC                   680  1.92e-05 GCGAACGTGT TCGCCAGCGAG GAGCTGCGAA
Camp-kin-cat-trunc          107  1.92e-05 GTCAAACTGT TCTTCAGCAGC AGGATTGGCA
MIC11-PRO-TRUNC             736  2.06e-05 CCCCTCTAGA ACTACAGCGGG GTCAATAGCG
GRA7-TRUNC                 1032  3.80e-05 CGCGGTTCCA TCGTCAGCGAC GAGGTTCGAC
PDIpro-trunc                942  4.16e-05 CGGTTTTCTC GCTTCAACGAG TCTGGCAGCG
ROP9-TRUNC                   38  5.15e-05 ACAGGTGATC TCTTCAAAAGG GAGCGAAATT
GAPDH_TRUNC                 493  5.91e-05 AATGACGGAT AATGCAGCGAG TCTGACAGCT
MIC4-TRUNC                  513  6.75e-05 AAGGGAGGAA CCTACAGCGAC TACCACAAAT
MIC6-TRUNC                 1223  9.17e-05 TCGATCCGAT CCTGCAACAGG CAGAGGTGTG
MIC2-TRUNC                 1068  9.17e-05 ATTAGTGTCC TCTCCAGAGCG ACCTTAAATC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 10 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
cAMP_kinase_reg-trunc             2.6e-07  1126_[10]_363
G6PD_TRUNC                        4.9e-07  725_[10]_764
GRA2pre-TRUNC                     1.5e-06  797_[10]_692
MIC5-TRUNC                        1.5e-06  311_[10]_1178
RiboP-TRUNCATED                   2.9e-06  941_[10]_549
Calmodulin-TRUNC                  1.7e-05  25_[10]_1464
PK4-TRUNC                         1.9e-05  679_[10]_810
Camp-kin-cat-trunc                1.9e-05  106_[10]_1333
MIC11-PRO-TRUNC                   2.1e-05  735_[10]_754
GRA7-TRUNC                        3.8e-05  1031_[10]_458
PDIpro-trunc                      4.2e-05  941_[10]_548
ROP9-TRUNC                        5.1e-05  37_[10]_1452
GAPDH_TRUNC                       5.9e-05  492_[10]_997
MIC4-TRUNC                        6.7e-05  512_[10]_977
MIC6-TRUNC                        9.2e-05  1222_[10]_267
MIC2-TRUNC                        9.2e-05  1067_[10]_422
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 10 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 10 width=11 seqs=16
cAMP_kinase_reg-trunc    ( 1127) TCTTCAGCGAG  1 
G6PD_TRUNC               (  726) TCTTCAGCAAG  1 
GRA2pre-TRUNC            (  798) TCTCCAGCGAG  1 
MIC5-TRUNC               (  312) TCTGCAGCAAG  1 
RiboP-TRUNCATED          (  942) TCTGCAGCGGG  1 
Calmodulin-TRUNC         (   26) ACTTCAGAAAG  1 
PK4-TRUNC                (  680) TCGCCAGCGAG  1 
Camp-kin-cat-trunc       (  107) TCTTCAGCAGC  1 
MIC11-PRO-TRUNC          (  736) ACTACAGCGGG  1 
GRA7-TRUNC               ( 1032) TCGTCAGCGAC  1 
PDIpro-trunc             (  942) GCTTCAACGAG  1 
ROP9-TRUNC               (   38) TCTTCAAAAGG  1 
GAPDH_TRUNC              (  493) AATGCAGCGAG  1 
MIC4-TRUNC               (  513) CCTACAGCGAC  1 
MIC6-TRUNC               ( 1223) CCTGCAACAGG  1 
MIC2-TRUNC               ( 1068) TCTCCAGAGCG  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 10 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 5.8e+004 
   -22   -110   -198    123 
  -180    180  -1064  -1064 
 -1064  -1064    -98    171 
   -80    -52      2     71 
 -1064    190  -1064  -1064 
   219  -1064  -1064  -1064 
   -22  -1064    172  -1064 
   -22    160  -1064  -1064 
    78  -1064    134  -1064 
   152   -210     34  -1064 
 -1064    -52    172  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 10 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 5.8e+004 
 0.187519  0.125090  0.062615  0.624776 
 0.062597  0.937082  0.000154  0.000167 
 0.000136  0.000168  0.125076  0.874620 
 0.125058  0.187551  0.249998  0.437393 
 0.000136  0.999543  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.187519  0.000168  0.812146  0.000167 
 0.187519  0.812160  0.000154  0.000167 
 0.374902  0.000168  0.624763  0.000167 
 0.624746  0.062629  0.312459  0.000167 
 0.000136  0.187551  0.812146  0.000167 
--------------------------------------------------------------------------------





Time 401.80 secs.

********************************************************************************


********************************************************************************
MOTIF 11	width =    8   sites =  16   llr = 133   E-value = 1.0e+007
********************************************************************************
--------------------------------------------------------------------------------
	Motif 11 Description
--------------------------------------------------------------------------------
Simplified        A  ::::::::
pos.-specific     C  2:1:1:98
probability       G  :9::::::
matrix            T  819a9a12

         bits    2.2         
                 2.0    * *  
                 1.8    * *  
                 1.5  * ***  
Information      1.3 ******* 
content          1.1 ********
(12.0 bits)      0.9 ********
                 0.7 ********
                 0.4 ********
                 0.2 ********
                 0.0 --------

Multilevel           TGTTTTCC
consensus                    
sequence                     
                             
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 11 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value              Site
-------------             ----- ---------            --------
MIC11-PRO-TRUNC            1058  2.40e-05 TATCATATTA TGTTTTCC TTTTTTCGAG
RiboP-TRUNCATED             372  2.40e-05 ATTTCTGGTT TGTTTTCC GGGTGTTGAA
MIC6-TRUNC                  541  2.40e-05 AGGCATTCAT TGTTTTCC ATAGAAAACA
MIC5-TRUNC                 1053  2.40e-05 GGCGTCTCTT TGTTTTCC TTGGAGTTCC
G6PD_TRUNC                  873  2.40e-05 TGAGGAACCG TGTTTTCC CCACATTTTC
GRA7-TRUNC                  136  7.19e-05 TCTTTCGATT TGTTTTCT ATTCCTTCCG
ROP9-TRUNC                 1315  7.19e-05 GTTGTGCGAC TGTTTTCT TCCGCCTCTT
cAMP_kinase_reg-trunc      1005  7.19e-05 TTCAGTCGCG CGTTTTCC ACCCTCCGGT
PDIpro-trunc               1224  7.19e-05 GCTAGCGATG CGTTTTCC CAAGAAAATT
PK4-TRUNC                   783  1.20e-04 CCCAGGGGTC TGTTTTTC CGGCTCTGTG
Camp-kin-cat-trunc          424  1.20e-04 CGAGGTAGGG TGCTTTCC GTCCAAGGTG
GRA2pre-TRUNC               131  1.46e-04 GTCGAAAACA TTTTTTCC GTTAAGCGTA
MIC2-TRUNC                 1395  1.46e-04 TTATCATTTG TTTTTTCC GGCCCGCCCT
Calmodulin-TRUNC           1409  1.70e-04 TGTCCGGGGG TGTTCTCC TGGCCCCGAT
MIC4-TRUNC                  436  2.90e-04 CAGATAGACC CGCTTTCC GTTGGAGAGA
GAPDH_TRUNC                1357  2.90e-04 CCTCGGCGTT TGTTTTTT AGTTATTTTT
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 11 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   2.4e-05  1057_[11]_435
RiboP-TRUNCATED                   2.4e-05  371_[11]_1122
MIC6-TRUNC                        2.4e-05  540_[11]_952
MIC5-TRUNC                        2.4e-05  1052_[11]_440
G6PD_TRUNC                        2.4e-05  872_[11]_620
GRA7-TRUNC                        7.2e-05  135_[11]_1357
ROP9-TRUNC                        7.2e-05  1314_[11]_178
cAMP_kinase_reg-trunc             7.2e-05  1004_[11]_488
PDIpro-trunc                      7.2e-05  1223_[11]_269
PK4-TRUNC                         0.00012  782_[11]_710
Camp-kin-cat-trunc                0.00012  423_[11]_1019
GRA2pre-TRUNC                     0.00015  130_[11]_1362
MIC2-TRUNC                        0.00015  1394_[11]_98
Calmodulin-TRUNC                  0.00017  1408_[11]_84
MIC4-TRUNC                        0.00029  435_[11]_1057
GAPDH_TRUNC                       0.00029  1356_[11]_136
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 11 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 11 width=8 seqs=16
MIC11-PRO-TRUNC          ( 1058) TGTTTTCC  1 
RiboP-TRUNCATED          (  372) TGTTTTCC  1 
MIC6-TRUNC               (  541) TGTTTTCC  1 
MIC5-TRUNC               ( 1053) TGTTTTCC  1 
G6PD_TRUNC               (  873) TGTTTTCC  1 
GRA7-TRUNC               (  136) TGTTTTCT  1 
ROP9-TRUNC               ( 1315) TGTTTTCT  1 
cAMP_kinase_reg-trunc    ( 1005) CGTTTTCC  1 
PDIpro-trunc             ( 1224) CGTTTTCC  1 
PK4-TRUNC                (  783) TGTTTTTC  1 
Camp-kin-cat-trunc       (  424) TGCTTTCC  1 
GRA2pre-TRUNC            (  131) TTTTTTCC  1 
MIC2-TRUNC               ( 1395) TTTTTTCC  1 
Calmodulin-TRUNC         ( 1409) TGTTCTCC  1 
MIC4-TRUNC               (  436) CGCTTTCC  1 
GAPDH_TRUNC              ( 1357) TGTTTTTT  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 11 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 8 n= 23839 bayes= 10.5401 E= 1.0e+007 
 -1064    -52  -1064    161 
 -1064  -1064    183   -109 
 -1064   -110  -1064    171 
 -1064  -1064  -1064    191 
 -1064   -210  -1064    181 
 -1064  -1064  -1064    191 
 -1064    170  -1064   -109 
 -1064    160  -1064    -51 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 11 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 8 n= 23839 E= 1.0e+007 
 0.000136  0.187551  0.000154  0.812159 
 0.000136  0.000168  0.874607  0.125088 
 0.000136  0.125090  0.000154  0.874620 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.062629  0.000154  0.937081 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.874621  0.000154  0.125088 
 0.000136  0.812160  0.000154  0.187549 
--------------------------------------------------------------------------------





Time 440.66 secs.

********************************************************************************


********************************************************************************
MOTIF 12	width =    8   sites =  16   llr = 135   E-value = 1.6e+006
********************************************************************************
--------------------------------------------------------------------------------
	Motif 12 Description
--------------------------------------------------------------------------------
Simplified        A  :::::::1
pos.-specific     C  :38:1::6
probability       G  :::a:::3
matrix            T  a83:9aa:

         bits    2.2         
                 2.0 *  * ** 
                 1.8 *  * ** 
                 1.5 *  **** 
Information      1.3 *  **** 
content          1.1 ******* 
(12.2 bits)      0.9 ******* 
                 0.7 ********
                 0.4 ********
                 0.2 ********
                 0.0 --------

Multilevel           TTCGTTTC
consensus             CT    G
sequence                     
                             
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 12 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value              Site
-------------             ----- ---------            --------
RiboP-TRUNCATED            1181  2.40e-05 GAAGACCTCG TTCGTTTC TCCCCCCCAC
MIC5-TRUNC                 1151  2.40e-05 GTGATTGCAG TTCGTTTC CTCAATTTAC
PK4-TRUNC                   731  2.40e-05 CCTGCTACGC TTCGTTTC CCGAGAGTCG
cAMP_kinase_reg-trunc      1069  2.40e-05 AGTTCTTCGC TTCGTTTC GCCCGGCAGC
G6PD_TRUNC                 1266  2.40e-05 TTTTAAGATT TTCGTTTC CTGTTTCCCT
MIC2-TRUNC                 1344  4.59e-05 GCTCATGAGT TTCGTTTG TCAGGTGCAA
PDIpro-trunc                874  4.59e-05 TAGAGGCTTC TTCGTTTG TCGCGAGAGA
MIC11-PRO-TRUNC             631  9.39e-05 GCCTTTTTCT TCCGTTTC GCAAAACTTG
MIC6-TRUNC                  693  9.39e-05 GTAAGCATCC TTTGTTTC CGTTTAAAAT
Calmodulin-TRUNC            612  9.39e-05 TCCCTGTTTC TCCGTTTC ATAGTCAATT
GRA7-TRUNC                 1229  1.13e-04 GATCCCTGAT TTCGTTTA CCATTGACGC
GRA2pre-TRUNC               201  1.57e-04 GAATACATCT TTTGTTTG CGTCCTGCAC
Camp-kin-cat-trunc           82  1.57e-04 CCGTAACGCA TCCGTTTG TGCCCGCGTC
GAPDH_TRUNC                 622  1.81e-04 GAAGCTCGTG TCTGTTTC CTATGGTTTT
ROP9-TRUNC                 1197  2.20e-04 ATGTCAAATG TTTGTTTA ATTTATTGTC
MIC4-TRUNC                 1283  2.44e-04 AGTACAATCA TTCGCTTC TGACAATCGC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 12 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
RiboP-TRUNCATED                   2.4e-05  1180_[12]_313
MIC5-TRUNC                        2.4e-05  1150_[12]_342
PK4-TRUNC                         2.4e-05  730_[12]_762
cAMP_kinase_reg-trunc             2.4e-05  1068_[12]_424
G6PD_TRUNC                        2.4e-05  1265_[12]_227
MIC2-TRUNC                        4.6e-05  1343_[12]_149
PDIpro-trunc                      4.6e-05  873_[12]_619
MIC11-PRO-TRUNC                   9.4e-05  630_[12]_862
MIC6-TRUNC                        9.4e-05  692_[12]_800
Calmodulin-TRUNC                  9.4e-05  611_[12]_881
GRA7-TRUNC                        0.00011  1228_[12]_264
GRA2pre-TRUNC                     0.00016  200_[12]_1292
Camp-kin-cat-trunc                0.00016  81_[12]_1361
GAPDH_TRUNC                       0.00018  621_[12]_871
ROP9-TRUNC                        0.00022  1196_[12]_296
MIC4-TRUNC                        0.00024  1282_[12]_210
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 12 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 12 width=8 seqs=16
RiboP-TRUNCATED          ( 1181) TTCGTTTC  1 
MIC5-TRUNC               ( 1151) TTCGTTTC  1 
PK4-TRUNC                (  731) TTCGTTTC  1 
cAMP_kinase_reg-trunc    ( 1069) TTCGTTTC  1 
G6PD_TRUNC               ( 1266) TTCGTTTC  1 
MIC2-TRUNC               ( 1344) TTCGTTTG  1 
PDIpro-trunc             (  874) TTCGTTTG  1 
MIC11-PRO-TRUNC          (  631) TCCGTTTC  1 
MIC6-TRUNC               (  693) TTTGTTTC  1 
Calmodulin-TRUNC         (  612) TCCGTTTC  1 
GRA7-TRUNC               ( 1229) TTCGTTTA  1 
GRA2pre-TRUNC            (  201) TTTGTTTG  1 
Camp-kin-cat-trunc       (   82) TCCGTTTG  1 
GAPDH_TRUNC              (  622) TCTGTTTC  1 
ROP9-TRUNC               ( 1197) TTTGTTTA  1 
MIC4-TRUNC               ( 1283) TTCGCTTC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 12 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 8 n= 23839 bayes= 10.5401 E= 1.6e+006 
 -1064  -1064  -1064    191 
 -1064    -10  -1064    149 
 -1064    148  -1064     -9 
 -1064  -1064    202  -1064 
 -1064   -210  -1064    181 
 -1064  -1064  -1064    191 
 -1064  -1064  -1064    191 
   -80    122      2  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 12 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 8 n= 23839 E= 1.6e+006 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.250012  0.000154  0.749698 
 0.000136  0.749699  0.000154  0.250010 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.062629  0.000154  0.937081 
 0.000136  0.000168  0.000154  0.999542 
 0.000136  0.000168  0.000154  0.999542 
 0.125058  0.624777  0.249998  0.000167 
--------------------------------------------------------------------------------





Time 479.31 secs.

********************************************************************************


********************************************************************************
MOTIF 13	width =    6   sites =  16   llr = 123   E-value = 1.4e+007
********************************************************************************
--------------------------------------------------------------------------------
	Motif 13 Description
--------------------------------------------------------------------------------
Simplified        A  :1a:::
pos.-specific     C  a::a:9
probability       G  :9::a1
matrix            T  ::::::

         bits    2.2   *   
                 2.0 * *** 
                 1.8 * *** 
                 1.5 ******
Information      1.3 ******
content          1.1 ******
(11.1 bits)      0.9 ******
                 0.7 ******
                 0.4 ******
                 0.2 ******
                 0.0 ------

Multilevel           CGACGC
consensus                  
sequence                   
                           
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 13 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value             Site 
-------------             ----- ---------            ------
MIC11-PRO-TRUNC             776  2.57e-04 CGCTAGTTCG CGACGC TCAACCGAGT
RiboP-TRUNCATED              19  2.57e-04 TGCGGGGAAT CGACGC TGAGACTCCG
GRA7-TRUNC                  784  2.57e-04 CGGTGTCACT CGACGC GTTGAGAACG
ROP9-TRUNC                 1086  2.57e-04 CAGCAGTCAG CGACGC ATTCAGAGAC
MIC6-TRUNC                  726  2.57e-04 CCAGATGGCA CGACGC CGTCTGGTTT
MIC5-TRUNC                  947  2.57e-04 ACGTGTTATT CGACGC AGTCTGTTGA
MIC4-TRUNC                 1311  2.57e-04 ATCGACTGAG CGACGC GTTGATCGTC
MIC2-TRUNC                  284  2.57e-04 TGGTGAATAA CGACGC AGCCAGCACG
PK4-TRUNC                   537  2.57e-04 GCGTCCGAGC CGACGC GCACGGCTTC
Camp-kin-cat-trunc         1068  2.57e-04 GTAAGGACTG CGACGC CGCTCTCACG
PDIpro-trunc               1063  2.57e-04 GGTCCAAAAG CGACGC CGTTATTCTC
GAPDH_TRUNC                 540  2.57e-04 GATTCTCAAC CGACGC TTCTTAGGGA
G6PD_TRUNC                  595  2.57e-04 CTGAGAGTCG CGACGC CGACCGTGCC
GRA2pre-TRUNC                55  4.85e-04 GCAGAATGCT CAACGC GGGCAGCACT
cAMP_kinase_reg-trunc      1046  4.85e-04 GTAGCAGCTG CAACGC GAGTCCAAGT
Calmodulin-TRUNC            200  7.20e-04 TGCGTTCCCA CGACGG GGATACGGAC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 13 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   0.00026  775_[13]_719
RiboP-TRUNCATED                   0.00026  18_[13]_1477
GRA7-TRUNC                        0.00026  783_[13]_711
ROP9-TRUNC                        0.00026  1085_[13]_409
MIC6-TRUNC                        0.00026  725_[13]_769
MIC5-TRUNC                        0.00026  946_[13]_548
MIC4-TRUNC                        0.00026  1310_[13]_184
MIC2-TRUNC                        0.00026  283_[13]_1211
PK4-TRUNC                         0.00026  536_[13]_958
Camp-kin-cat-trunc                0.00026  1067_[13]_377
PDIpro-trunc                      0.00026  1062_[13]_432
GAPDH_TRUNC                       0.00026  539_[13]_955
G6PD_TRUNC                        0.00026  594_[13]_900
GRA2pre-TRUNC                     0.00048  54_[13]_1440
cAMP_kinase_reg-trunc             0.00048  1045_[13]_449
Calmodulin-TRUNC                  0.00072  199_[13]_1295
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 13 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 13 width=6 seqs=16
MIC11-PRO-TRUNC          (  776) CGACGC  1 
RiboP-TRUNCATED          (   19) CGACGC  1 
GRA7-TRUNC               (  784) CGACGC  1 
ROP9-TRUNC               ( 1086) CGACGC  1 
MIC6-TRUNC               (  726) CGACGC  1 
MIC5-TRUNC               (  947) CGACGC  1 
MIC4-TRUNC               ( 1311) CGACGC  1 
MIC2-TRUNC               (  284) CGACGC  1 
PK4-TRUNC                (  537) CGACGC  1 
Camp-kin-cat-trunc       ( 1068) CGACGC  1 
PDIpro-trunc             ( 1063) CGACGC  1 
GAPDH_TRUNC              (  540) CGACGC  1 
G6PD_TRUNC               (  595) CGACGC  1 
GRA2pre-TRUNC            (   55) CAACGC  1 
cAMP_kinase_reg-trunc    ( 1046) CAACGC  1 
Calmodulin-TRUNC         (  200) CGACGG  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 13 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 6 n= 23871 bayes= 10.542 E= 1.4e+007 
 -1064    190  -1064  -1064 
   -80  -1064    183  -1064 
   219  -1064  -1064  -1064 
 -1064    190  -1064  -1064 
 -1064  -1064    202  -1064 
 -1064    180   -198  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 13 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 6 n= 23871 E= 1.4e+007 
 0.000136  0.999543  0.000154  0.000167 
 0.125058  0.000168  0.874607  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.999543  0.000154  0.000167 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.937082  0.062615  0.000167 
--------------------------------------------------------------------------------





Time 517.63 secs.

********************************************************************************


********************************************************************************
MOTIF 14	width =   11   sites =  16   llr = 155   E-value = 4.4e+003
********************************************************************************
--------------------------------------------------------------------------------
	Motif 14 Description
--------------------------------------------------------------------------------
Simplified        A  :9:::1494:1
pos.-specific     C  9:::1:6::a:
probability       G  :16749:13:9
matrix            T  114351::3::

         bits    2.2            
                 2.0          * 
                 1.8        * **
                 1.5  *     * **
Information      1.3 **   * * **
content          1.1 **** *** **
(14.0 bits)      0.9 **** *** **
                 0.7 ******** **
                 0.4 ***********
                 0.2 ***********
                 0.0 -----------

Multilevel           CAGGTGCAACG
consensus              TTG A G  
sequence                     T  
                                
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 14 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value               Site  
-------------             ----- ---------            -----------
MIC2-TRUNC                 1353  1.98e-07 TTTCGTTTGT CAGGTGCAACG TCGTCTACTC
ROP9-TRUNC                 1338  5.42e-07 CTCTTCAGCG CAGGTGAAACG AGCACGCTGT
cAMP_kinase_reg-trunc       794  9.15e-07 GCTTCTTTTT CAGGTGCAGCG CCCGGAATGT
MIC4-TRUNC                  370  1.69e-06 CTTTAGACGT CAGGGGAAGCG AGCGTTCTGT
MIC11-PRO-TRUNC            1127  2.30e-06 TCGATGATCT CATGGGCAACG TGGCACAAAC
G6PD_TRUNC                  216  2.30e-06 GGTGAGGTCA CATGTGAAACG AGGCGAACGG
GRA2pre-TRUNC               239  4.05e-06 GAGGCGGCTA CAGTGGAAACG AAAAAAAAGG
MIC5-TRUNC                  974  1.04e-05 CGGTCGAGCG CATTTGCATCG ACGTCCGCTC
PDIpro-trunc                995  1.13e-05 ATCTTCTGTG CATTGGAATCG ACATGTTGAG
GAPDH_TRUNC                 643  1.25e-05 TGGTTTTTCA CAGGCGCAGCG TCTCTCTTTT
PK4-TRUNC                   144  2.98e-05 CGGGCGACGA CAGGGGCGGCG AGCGCACGAA
RiboP-TRUNCATED             644  5.38e-05 TCTGAAGCTG CAGTGACAGCG CGTTGTTTCC
Camp-kin-cat-trunc          865  5.38e-05 TGCCAACGCC CATGTGCATCA GGGACAGGCC
GRA7-TRUNC                   57  7.48e-05 TTGCTTACTA CAGTGTCATCG AGATCCATAT
Calmodulin-TRUNC            468  8.56e-05 AAAAATCATG TGGGTGAAACG AAACAGTACA
MIC6-TRUNC                  399  1.21e-04 TACGTGTCAT TTTGTGAAACG ACACAGCACA
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 14 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC2-TRUNC                          2e-07  1352_[14]_137
ROP9-TRUNC                        5.4e-07  1337_[14]_152
cAMP_kinase_reg-trunc             9.1e-07  793_[14]_696
MIC4-TRUNC                        1.7e-06  369_[14]_1120
MIC11-PRO-TRUNC                   2.3e-06  1126_[14]_363
G6PD_TRUNC                        2.3e-06  215_[14]_1274
GRA2pre-TRUNC                     4.1e-06  238_[14]_1251
MIC5-TRUNC                          1e-05  973_[14]_516
PDIpro-trunc                      1.1e-05  994_[14]_495
GAPDH_TRUNC                       1.2e-05  642_[14]_847
PK4-TRUNC                           3e-05  143_[14]_1346
RiboP-TRUNCATED                   5.4e-05  643_[14]_847
Camp-kin-cat-trunc                5.4e-05  864_[14]_575
GRA7-TRUNC                        7.5e-05  56_[14]_1433
Calmodulin-TRUNC                  8.6e-05  467_[14]_1022
MIC6-TRUNC                        0.00012  398_[14]_1091
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 14 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 14 width=11 seqs=16
MIC2-TRUNC               ( 1353) CAGGTGCAACG  1 
ROP9-TRUNC               ( 1338) CAGGTGAAACG  1 
cAMP_kinase_reg-trunc    (  794) CAGGTGCAGCG  1 
MIC4-TRUNC               (  370) CAGGGGAAGCG  1 
MIC11-PRO-TRUNC          ( 1127) CATGGGCAACG  1 
G6PD_TRUNC               (  216) CATGTGAAACG  1 
GRA2pre-TRUNC            (  239) CAGTGGAAACG  1 
MIC5-TRUNC               (  974) CATTTGCATCG  1 
PDIpro-trunc             (  995) CATTGGAATCG  1 
GAPDH_TRUNC              (  643) CAGGCGCAGCG  1 
PK4-TRUNC                (  144) CAGGGGCGGCG  1 
RiboP-TRUNCATED          (  644) CAGTGACAGCG  1 
Camp-kin-cat-trunc       (  865) CATGTGCATCA  1 
GRA7-TRUNC               (   57) CAGTGTCATCG  1 
Calmodulin-TRUNC         (  468) TGGGTGAAACG  1 
MIC6-TRUNC               (  399) TTTGTGAAACG  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 14 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 11 n= 23791 bayes= 10.5372 E= 4.4e+003 
 -1064    170  -1064   -109 
   200  -1064   -198   -209 
 -1064  -1064    134     49 
 -1064  -1064    148     23 
 -1064   -210     83     91 
  -180  -1064    183   -209 
   100    107  -1064  -1064 
   210  -1064   -198  -1064 
   100  -1064     34     -9 
 -1064    190  -1064  -1064 
  -180  -1064    193  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 14 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 11 n= 23791 E= 4.4e+003 
 0.000136  0.874621  0.000154  0.125088 
 0.874590  0.000168  0.062615  0.062628 
 0.000136  0.000168  0.624763  0.374932 
 0.000136  0.000168  0.687224  0.312471 
 0.000136  0.062629  0.437381  0.499854 
 0.062597  0.000168  0.874607  0.062628 
 0.437363  0.562316  0.000154  0.000167 
 0.937051  0.000168  0.062615  0.000167 
 0.437363  0.000168  0.312459  0.250010 
 0.000136  0.999543  0.000154  0.000167 
 0.062597  0.000168  0.937068  0.000167 
--------------------------------------------------------------------------------





Time 556.43 secs.

********************************************************************************


********************************************************************************
MOTIF 15	width =    6   sites =  16   llr = 127   E-value = 1.5e+005
********************************************************************************
--------------------------------------------------------------------------------
	Motif 15 Description
--------------------------------------------------------------------------------
Simplified        A  :a:2a:
pos.-specific     C  a::8:a
probability       G  ::a:::
matrix            T  ::::::

         bits    2.2  *  * 
                 2.0 *** **
                 1.8 *** **
                 1.5 *** **
Information      1.3 ******
content          1.1 ******
(11.5 bits)      0.9 ******
                 0.7 ******
                 0.4 ******
                 0.2 ******
                 0.0 ------

Multilevel           CAGCAC
consensus                  
sequence                   
                           
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 15 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value             Site 
-------------             ----- ---------            ------
MIC11-PRO-TRUNC             174  2.28e-04 CAAGCGCCTC CAGCAC GGTTTCAAGC
RiboP-TRUNCATED            1459  2.28e-04 CCCTCCGTTC CAGCAC CTTTCTGCTC
GRA2pre-TRUNC                64  2.28e-04 TCAACGCGGG CAGCAC TTTTCCTCCC
ROP9-TRUNC                 1264  2.28e-04 ATGGCACTGG CAGCAC GCCGGACTCT
MIC6-TRUNC                  413  2.28e-04 TGAAACGACA CAGCAC ATAACCACTC
MIC4-TRUNC                 1143  2.28e-04 CTGATGTTTG CAGCAC ATCGACCATT
MIC2-TRUNC                  293  2.28e-04 ACGACGCAGC CAGCAC GGTTATTGCG
Calmodulin-TRUNC            526  2.28e-04 GACGGGCAGC CAGCAC CGTCGCATAC
PK4-TRUNC                   354  2.28e-04 AAGGAGCGAA CAGCAC ACAGCCAAGC
cAMP_kinase_reg-trunc        23  2.28e-04 AGACCGTCAG CAGCAC GGGTGCTAGC
PDIpro-trunc                797  2.28e-04 CAAACTTAGA CAGCAC TTCAATTACT
GAPDH_TRUNC                   1  2.28e-04          . CAGCAC GTTCTCATGG
G6PD_TRUNC                  946  2.28e-04 AGGTAAACAG CAGCAC TGTGGGCAGC
GRA7-TRUNC                  217  4.13e-04 TTCGTGCATC CAGAAC CTTCTGTCCT
MIC5-TRUNC                 1127  4.13e-04 AACTTAGATC CAGAAC ATCACATAGT
Camp-kin-cat-trunc          634  4.13e-04 GGTTTTTGTA CAGAAC GGCGCTCCAG
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 15 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   0.00023  173_[15]_1321
RiboP-TRUNCATED                   0.00023  1458_[15]_37
GRA2pre-TRUNC                     0.00023  63_[15]_1431
ROP9-TRUNC                        0.00023  1263_[15]_231
MIC6-TRUNC                        0.00023  412_[15]_1082
MIC4-TRUNC                        0.00023  1142_[15]_352
MIC2-TRUNC                        0.00023  292_[15]_1202
Calmodulin-TRUNC                  0.00023  525_[15]_969
PK4-TRUNC                         0.00023  353_[15]_1141
cAMP_kinase_reg-trunc             0.00023  22_[15]_1472
PDIpro-trunc                      0.00023  796_[15]_698
GAPDH_TRUNC                       0.00023  [15]_1494
G6PD_TRUNC                        0.00023  945_[15]_549
GRA7-TRUNC                        0.00041  216_[15]_1278
MIC5-TRUNC                        0.00041  1126_[15]_368
Camp-kin-cat-trunc                0.00041  633_[15]_811
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 15 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 15 width=6 seqs=16
MIC11-PRO-TRUNC          (  174) CAGCAC  1 
RiboP-TRUNCATED          ( 1459) CAGCAC  1 
GRA2pre-TRUNC            (   64) CAGCAC  1 
ROP9-TRUNC               ( 1264) CAGCAC  1 
MIC6-TRUNC               (  413) CAGCAC  1 
MIC4-TRUNC               ( 1143) CAGCAC  1 
MIC2-TRUNC               (  293) CAGCAC  1 
Calmodulin-TRUNC         (  526) CAGCAC  1 
PK4-TRUNC                (  354) CAGCAC  1 
cAMP_kinase_reg-trunc    (   23) CAGCAC  1 
PDIpro-trunc             (  797) CAGCAC  1 
GAPDH_TRUNC              (    1) CAGCAC  1 
G6PD_TRUNC               (  946) CAGCAC  1 
GRA7-TRUNC               (  217) CAGAAC  1 
MIC5-TRUNC               ( 1127) CAGAAC  1 
Camp-kin-cat-trunc       (  634) CAGAAC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 15 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 6 n= 23871 bayes= 10.542 E= 1.5e+005 
 -1064    190  -1064  -1064 
   219  -1064  -1064  -1064 
 -1064  -1064    202  -1064 
   -22    160  -1064  -1064 
   219  -1064  -1064  -1064 
 -1064    190  -1064  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 15 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 6 n= 23871 E= 1.5e+005 
 0.000136  0.999543  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.000168  0.999529  0.000167 
 0.187519  0.812160  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.999543  0.000154  0.000167 
--------------------------------------------------------------------------------





Time 594.62 secs.

********************************************************************************


********************************************************************************
MOTIF 16	width =   15   sites =  16   llr = 165   E-value = 2.5e+006
********************************************************************************
--------------------------------------------------------------------------------
	Motif 16 Description
--------------------------------------------------------------------------------
Simplified        A  3::321:::13::::
pos.-specific     C  ::61::::21412:7
probability       G  18:5:41983::1a1
matrix            T  63418591:5397:2

         bits    2.2                
                 2.0              * 
                 1.8              * 
                 1.5        *   * * 
Information      1.3     * ***  * * 
content          1.1  *  * ***  * * 
(14.9 bits)      0.9  ** * ***  * * 
                 0.7 *** *****  ****
                 0.4 *** ***** *****
                 0.2 ***************
                 0.0 ---------------

Multilevel           TGCGTTTGGTCTTGC
consensus            ATTA G   GA    
sequence                       T    
                                    
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 16 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value                 Site    
-------------             ----- ---------            ---------------
GAPDH_TRUNC                 858  2.79e-08 TCAGTTGTTG TGTGTTTGGTATTGC GAGTCTGGAG
PDIpro-trunc                680  4.93e-07 CAAGCCCTAA TGCGTTTGGTTTTGG CACTCTGATT
MIC5-TRUNC                   32  1.19e-06 TCTGTGTAAA TGCGTGTGCAATTGC TTTTGTGTGC
MIC2-TRUNC                  199  1.34e-06 CGAGTCCTGC TGTGAGTGGACTTGC ATCCGCAGTT
cAMP_kinase_reg-trunc       898  1.91e-06 AGCAGCCCGC TTTTTTTGGTCTTGC TGTCGCGCTT
MIC11-PRO-TRUNC            1440  2.99e-06 AAACGTATGC ATCGTGTGGGCTTGT GGTTTGCAGA
GRA2pre-TRUNC               704  2.99e-06 CACCTGCCAG TGCATATGGGTTTGC ATATTTTTGC
GRA7-TRUNC                 1440  2.99e-06 TGAAGTACCC TGTATTGGGGCTTGC TAACGTTTTG
RiboP-TRUNCATED             782  3.31e-06 GGTAGCTGGT GGTCTGTGGTATTGC TCACGTCTTC
Camp-kin-cat-trunc          541  1.10e-05 GGAAAGCGGT AGCGAGTGGCCTGGC GGTTGGTTTG
MIC6-TRUNC                 1397  1.19e-05 GACATCTGTG GGCGTTTGGGATCGT GATGACATCG
ROP9-TRUNC                  746  2.36e-05 GACCAAGCTG TGCCATTGCTCTCGC GAAGCAAGCT
G6PD_TRUNC                  812  2.70e-05 GCAGACATAC ATCGTGGGGTTTTGG CCCGCTAGGT
Calmodulin-TRUNC            754  2.89e-05 CAAATTCTGG AGCATTTGGCTTGGT GAGTGGGAGA
MIC4-TRUNC                  179  5.99e-05 GTGCGTGAAC ATTTTGTTGTCTCGC TTTGAGTGGC
PK4-TRUNC                   178  5.99e-05 GCTCTGTTCT TGCATTTTCTACTGC TCTTGTGGTC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 16 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
GAPDH_TRUNC                       2.8e-08  857_[16]_628
PDIpro-trunc                      4.9e-07  679_[16]_806
MIC5-TRUNC                        1.2e-06  31_[16]_1454
MIC2-TRUNC                        1.3e-06  198_[16]_1287
cAMP_kinase_reg-trunc             1.9e-06  897_[16]_588
MIC11-PRO-TRUNC                     3e-06  1439_[16]_46
GRA2pre-TRUNC                       3e-06  703_[16]_782
GRA7-TRUNC                          3e-06  1439_[16]_46
RiboP-TRUNCATED                   3.3e-06  781_[16]_705
Camp-kin-cat-trunc                1.1e-05  540_[16]_895
MIC6-TRUNC                        1.2e-05  1396_[16]_89
ROP9-TRUNC                        2.4e-05  745_[16]_740
G6PD_TRUNC                        2.7e-05  811_[16]_674
Calmodulin-TRUNC                  2.9e-05  753_[16]_732
MIC4-TRUNC                          6e-05  178_[16]_1307
PK4-TRUNC                           6e-05  177_[16]_1308
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 16 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 16 width=15 seqs=16
GAPDH_TRUNC              (  858) TGTGTTTGGTATTGC  1 
PDIpro-trunc             (  680) TGCGTTTGGTTTTGG  1 
MIC5-TRUNC               (   32) TGCGTGTGCAATTGC  1 
MIC2-TRUNC               (  199) TGTGAGTGGACTTGC  1 
cAMP_kinase_reg-trunc    (  898) TTTTTTTGGTCTTGC  1 
MIC11-PRO-TRUNC          ( 1440) ATCGTGTGGGCTTGT  1 
GRA2pre-TRUNC            (  704) TGCATATGGGTTTGC  1 
GRA7-TRUNC               ( 1440) TGTATTGGGGCTTGC  1 
RiboP-TRUNCATED          (  782) GGTCTGTGGTATTGC  1 
Camp-kin-cat-trunc       (  541) AGCGAGTGGCCTGGC  1 
MIC6-TRUNC               ( 1397) GGCGTTTGGGATCGT  1 
ROP9-TRUNC               (  746) TGCCATTGCTCTCGC  1 
G6PD_TRUNC               (  812) ATCGTGGGGTTTTGG  1 
Calmodulin-TRUNC         (  754) AGCATTTGGCTTGGT  1 
MIC4-TRUNC               (  179) ATTTTGTTGTCTCGC  1 
PK4-TRUNC                (  178) TGCATTTTCTACTGC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 16 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 15 n= 23727 bayes= 10.5333 E= 2.5e+006 
    52  -1064    -98    108 
 -1064  -1064    161     -9 
 -1064    122  -1064     49 
    19   -110    102   -109 
   -22  -1064  -1064    161 
  -180  -1064     83     91 
 -1064  -1064    -98    171 
 -1064  -1064    183   -109 
 -1064    -52    172  -1064 
   -80   -110      2     91 
    52     70  -1064     -9 
 -1064   -210  -1064    181 
 -1064    -52    -98    137 
 -1064  -1064    202  -1064 
 -1064    136    -98    -51 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 16 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 15 n= 23727 E= 2.5e+006 
 0.312441  0.000168  0.125076  0.562315 
 0.000136  0.000168  0.749685  0.250010 
 0.000136  0.624777  0.000154  0.374932 
 0.249980  0.125090  0.499842  0.125088 
 0.187519  0.000168  0.000154  0.812159 
 0.062597  0.000168  0.437381  0.499854 
 0.000136  0.000168  0.125076  0.874620 
 0.000136  0.000168  0.874607  0.125088 
 0.000136  0.187551  0.812146  0.000167 
 0.125058  0.125090  0.249998  0.499854 
 0.312441  0.437395  0.000154  0.250010 
 0.000136  0.062629  0.000154  0.937081 
 0.000136  0.187551  0.125076  0.687237 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.687238  0.125076  0.187549 
--------------------------------------------------------------------------------





Time 632.49 secs.

********************************************************************************


********************************************************************************
MOTIF 17	width =    6   sites =  16   llr = 123   E-value = 8.9e+006
********************************************************************************
--------------------------------------------------------------------------------
	Motif 17 Description
--------------------------------------------------------------------------------
Simplified        A  :aaaa:
pos.-specific     C  7::::1
probability       G  3::::9
matrix            T  1:::::

         bits    2.2  **** 
                 2.0  **** 
                 1.8  **** 
                 1.5  *****
Information      1.3  *****
content          1.1  *****
(11.0 bits)      0.9 ******
                 0.7 ******
                 0.4 ******
                 0.2 ******
                 0.0 ------

Multilevel           CAAAAG
consensus            G     
sequence                   
                           
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 17 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value             Site 
-------------             ----- ---------            ------
MIC11-PRO-TRUNC              96  1.51e-04 GGTCCTAGGC CAAAAG AGAGCATTGA
GRA2pre-TRUNC               834  1.51e-04 TGTACTTCGC CAAAAG GAAAATACAC
MIC6-TRUNC                  329  1.51e-04 TCAAGCATGC CAAAAG CCGACATACT
MIC5-TRUNC                 1433  1.51e-04 ACCGTGAAAC CAAAAG CGCAGTTTCA
MIC2-TRUNC                  520  1.51e-04 TTCGTTATGT CAAAAG AGCGCTCGCT
cAMP_kinase_reg-trunc       658  1.51e-04 CCCCAACCGT CAAAAG TGTGAACGTG
Camp-kin-cat-trunc          680  1.51e-04 TATCTTTGTT CAAAAG GTAACATAAA
PDIpro-trunc               1057  1.51e-04 TAAGGCGGTC CAAAAG CGACGCCGTT
GAPDH_TRUNC                1440  1.51e-04 CACGGTGTAG CAAAAG GCGCATTTCT
G6PD_TRUNC                  902  1.51e-04 TGATTTTGTC CAAAAG TTGCAGAGTC
RiboP-TRUNCATED             442  2.89e-04 TTTCAGGGCA GAAAAG GAGGGAAACT
ROP9-TRUNC                  315  2.89e-04 AAAACGGTGG GAAAAG ATGAATATCG
PK4-TRUNC                   268  2.89e-04 AAACGCAACG GAAAAG CACGTCGATA
MIC4-TRUNC                 1177  4.53e-04 ATCTGTGCTG CAAAAC GGGCCTCTGT
GRA7-TRUNC                  891  6.02e-04 TATAATATCT TAAAAG CAGTTGGGTA
Calmodulin-TRUNC            680  7.53e-04 CACTCGCCCG GAAAAC TTTGTAGATC
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 17 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   0.00015  95_[17]_1399
GRA2pre-TRUNC                     0.00015  833_[17]_661
MIC6-TRUNC                        0.00015  328_[17]_1166
MIC5-TRUNC                        0.00015  1432_[17]_62
MIC2-TRUNC                        0.00015  519_[17]_975
cAMP_kinase_reg-trunc             0.00015  657_[17]_837
Camp-kin-cat-trunc                0.00015  679_[17]_765
PDIpro-trunc                      0.00015  1056_[17]_438
GAPDH_TRUNC                       0.00015  1439_[17]_55
G6PD_TRUNC                        0.00015  901_[17]_593
RiboP-TRUNCATED                   0.00029  441_[17]_1054
ROP9-TRUNC                        0.00029  314_[17]_1180
PK4-TRUNC                         0.00029  267_[17]_1227
MIC4-TRUNC                        0.00045  1176_[17]_318
GRA7-TRUNC                         0.0006  890_[17]_604
Calmodulin-TRUNC                  0.00075  679_[17]_815
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 17 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 17 width=6 seqs=16
MIC11-PRO-TRUNC          (   96) CAAAAG  1 
GRA2pre-TRUNC            (  834) CAAAAG  1 
MIC6-TRUNC               (  329) CAAAAG  1 
MIC5-TRUNC               ( 1433) CAAAAG  1 
MIC2-TRUNC               (  520) CAAAAG  1 
cAMP_kinase_reg-trunc    (  658) CAAAAG  1 
Camp-kin-cat-trunc       (  680) CAAAAG  1 
PDIpro-trunc             ( 1057) CAAAAG  1 
GAPDH_TRUNC              ( 1440) CAAAAG  1 
G6PD_TRUNC               (  902) CAAAAG  1 
RiboP-TRUNCATED          (  442) GAAAAG  1 
ROP9-TRUNC               (  315) GAAAAG  1 
PK4-TRUNC                (  268) GAAAAG  1 
MIC4-TRUNC               ( 1177) CAAAAC  1 
GRA7-TRUNC               (  891) TAAAAG  1 
Calmodulin-TRUNC         (  680) GAAAAC  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 17 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 6 n= 23871 bayes= 10.542 E= 8.9e+006 
 -1064    136      2   -209 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
 -1064   -110    183  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 17 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 6 n= 23871 E= 8.9e+006 
 0.000136  0.687238  0.249998  0.062628 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.125090  0.874607  0.000167 
--------------------------------------------------------------------------------





Time 670.90 secs.

********************************************************************************


********************************************************************************
MOTIF 18	width =    6   sites =  16   llr = 122   E-value = 2.6e+007
********************************************************************************
--------------------------------------------------------------------------------
	Motif 18 Description
--------------------------------------------------------------------------------
Simplified        A  3:aa8a
pos.-specific     C  ::::1:
probability       G  :a::::
matrix            T  7:::1:

         bits    2.2   ** *
                 2.0  *** *
                 1.8  *** *
                 1.5  *** *
Information      1.3  *****
content          1.1 ******
(11.0 bits)      0.9 ******
                 0.7 ******
                 0.4 ******
                 0.2 ******
                 0.0 ------

Multilevel           TGAAAA
consensus            A     
sequence                   
                           
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 18 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value             Site 
-------------             ----- ---------            ------
MIC11-PRO-TRUNC             517  1.49e-04 CCCTACGTTT TGAAAA GACTGCCAGT
GRA2pre-TRUNC               535  1.49e-04 GTTATGTTAC TGAAAA GTATAGTCAA
GRA7-TRUNC                  979  1.49e-04 CAGGCGTGGC TGAAAA TCCTCAGCCA
ROP9-TRUNC                  303  1.49e-04 CTCTCTCCCC TGAAAA CGGTGGGAAA
MIC5-TRUNC                 1206  1.49e-04 GCTAACTGTG TGAAAA TTCAGTGACC
MIC2-TRUNC                  621  1.49e-04 ACGCAGAAAC TGAAAA TAACAAGTTT
Calmodulin-TRUNC           1305  1.49e-04 GGCTCTTTTC TGAAAA ATTCACATGA
PK4-TRUNC                   255  1.49e-04 CCGCGTTCTC TGAAAA CGCAACGGAA
RiboP-TRUNCATED             172  2.72e-04 ACGGCACCCA AGAAAA ATACCGCTCT
cAMP_kinase_reg-trunc      1140  2.72e-04 TCAGCGAGCG AGAAAA GGCTGGTCGA
PDIpro-trunc               1234  2.72e-04 CGTTTTCCCA AGAAAA TTCGCGGGCG
GAPDH_TRUNC                 416  2.72e-04 TGAATTCATT AGAAAA CTAGTACTAC
G6PD_TRUNC                  326  2.72e-04 AACGAACACC AGAAAA GACGGGCAAG
MIC4-TRUNC                  957  4.56e-04 CGATGCCGCG TGAACA TGGCGTCCCC
Camp-kin-cat-trunc         1188  4.56e-04 TTCTTCTTCT TGAACA GCGGCTCGTC
MIC6-TRUNC                  620  7.89e-04 CCTCATCACG TGAATA CACGCTGCGT
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 18 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   0.00015  516_[18]_978
GRA2pre-TRUNC                     0.00015  534_[18]_960
GRA7-TRUNC                        0.00015  978_[18]_516
ROP9-TRUNC                        0.00015  302_[18]_1192
MIC5-TRUNC                        0.00015  1205_[18]_289
MIC2-TRUNC                        0.00015  620_[18]_874
Calmodulin-TRUNC                  0.00015  1304_[18]_190
PK4-TRUNC                         0.00015  254_[18]_1240
RiboP-TRUNCATED                   0.00027  171_[18]_1324
cAMP_kinase_reg-trunc             0.00027  1139_[18]_355
PDIpro-trunc                      0.00027  1233_[18]_261
GAPDH_TRUNC                       0.00027  415_[18]_1079
G6PD_TRUNC                        0.00027  325_[18]_1169
MIC4-TRUNC                        0.00046  956_[18]_538
Camp-kin-cat-trunc                0.00046  1187_[18]_257
MIC6-TRUNC                        0.00079  619_[18]_875
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 18 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 18 width=6 seqs=16
MIC11-PRO-TRUNC          (  517) TGAAAA  1 
GRA2pre-TRUNC            (  535) TGAAAA  1 
GRA7-TRUNC               (  979) TGAAAA  1 
ROP9-TRUNC               (  303) TGAAAA  1 
MIC5-TRUNC               ( 1206) TGAAAA  1 
MIC2-TRUNC               (  621) TGAAAA  1 
Calmodulin-TRUNC         ( 1305) TGAAAA  1 
PK4-TRUNC                (  255) TGAAAA  1 
RiboP-TRUNCATED          (  172) AGAAAA  1 
cAMP_kinase_reg-trunc    ( 1140) AGAAAA  1 
PDIpro-trunc             ( 1234) AGAAAA  1 
GAPDH_TRUNC              (  416) AGAAAA  1 
G6PD_TRUNC               (  326) AGAAAA  1 
MIC4-TRUNC               (  957) TGAACA  1 
Camp-kin-cat-trunc       ( 1188) TGAACA  1 
MIC6-TRUNC               (  620) TGAATA  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 18 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 6 n= 23871 bayes= 10.542 E= 2.6e+007 
    52  -1064  -1064    137 
 -1064  -1064    202  -1064 
   219  -1064  -1064  -1064 
   219  -1064  -1064  -1064 
   189   -110  -1064   -209 
   219  -1064  -1064  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 18 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 6 n= 23871 E= 2.6e+007 
 0.312441  0.000168  0.000154  0.687237 
 0.000136  0.000168  0.999529  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
 0.812129  0.125090  0.000154  0.062628 
 0.999512  0.000168  0.000154  0.000167 
--------------------------------------------------------------------------------





Time 708.81 secs.

********************************************************************************


********************************************************************************
MOTIF 19	width =    8   sites =  16   llr = 133   E-value = 5.4e+006
********************************************************************************
--------------------------------------------------------------------------------
	Motif 19 Description
--------------------------------------------------------------------------------
Simplified        A  823:8a:9
pos.-specific     C  17:1::a:
probability       G  1::91::1
matrix            T  :17:1:::

         bits    2.2      *  
                 2.0      ** 
                 1.8    * ***
                 1.5    * ***
Information      1.3 *  *****
content          1.1 * ******
(12.0 bits)      0.9 * ******
                 0.7 ********
                 0.4 ********
                 0.2 ********
                 0.0 --------

Multilevel           ACTGAACA
consensus              A     
sequence                     
                             
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 19 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value              Site
-------------             ----- ---------            --------
cAMP_kinase_reg-trunc       394  1.08e-05 CGTGGCGTTC ACTGAACA CCGACTTGCG
PK4-TRUNC                   765  1.96e-05 CCCTGGGGAA ACAGAACA CCCAGGGGTC
G6PD_TRUNC                 1420  1.96e-05 TCCGATTTAA ACAGAACA TTTTGACGCC
GRA2pre-TRUNC              1338  2.84e-05 AGAGACGCAA AATGAACA GCGGAACCTG
GAPDH_TRUNC                 447  2.84e-05 GAGCTGTAAA AATGAACA ACATTCTGTG
GRA7-TRUNC                  634  4.63e-05 ATCGATCTCT ATTGAACA ACTTCTGAGT
MIC5-TRUNC                  822  4.63e-05 AAAAAAATGC ATTGAACA AGAGCCGCTT
Camp-kin-cat-trunc         1013  4.63e-05 AATAGACGGG AAAGAACA GGCTCACTGA
MIC11-PRO-TRUNC             610  5.84e-05 TGCTCGAGGT GCTGAACA CTCGCCTTTT
RiboP-TRUNCATED            1099  5.84e-05 CTATCTCCTC GCTGAACA CAGGAGTCTG
MIC2-TRUNC                  488  7.16e-05 TCTAAATGAG ACTGTACA AGCTGACGAC
MIC6-TRUNC                  561  1.02e-04 AGAAAACACT ACTGGACA ACCATTCGGT
ROP9-TRUNC                  662  1.50e-04 GGTATTGAAA CCTGAACA GGAAAATGAG
MIC4-TRUNC                  718  1.50e-04 GCGACCATTA ACTGAACG ACTAAGCAGG
Calmodulin-TRUNC            481  1.50e-04 GTGAAACGAA ACAGTACA GTGTGTGTCC
PDIpro-trunc                463  2.11e-04 ACAGAAAACC ACACAACA AGGCGTACAT
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 19 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
cAMP_kinase_reg-trunc             1.1e-05  393_[19]_1099
PK4-TRUNC                           2e-05  764_[19]_728
G6PD_TRUNC                          2e-05  1419_[19]_73
GRA2pre-TRUNC                     2.8e-05  1337_[19]_155
GAPDH_TRUNC                       2.8e-05  446_[19]_1046
GRA7-TRUNC                        4.6e-05  633_[19]_859
MIC5-TRUNC                        4.6e-05  821_[19]_671
Camp-kin-cat-trunc                4.6e-05  1012_[19]_430
MIC11-PRO-TRUNC                   5.8e-05  609_[19]_883
RiboP-TRUNCATED                   5.8e-05  1098_[19]_395
MIC2-TRUNC                        7.2e-05  487_[19]_1005
MIC6-TRUNC                         0.0001  560_[19]_932
ROP9-TRUNC                        0.00015  661_[19]_831
MIC4-TRUNC                        0.00015  717_[19]_775
Calmodulin-TRUNC                  0.00015  480_[19]_1012
PDIpro-trunc                      0.00021  462_[19]_1030
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 19 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 19 width=8 seqs=16
cAMP_kinase_reg-trunc    (  394) ACTGAACA  1 
PK4-TRUNC                (  765) ACAGAACA  1 
G6PD_TRUNC               ( 1420) ACAGAACA  1 
GRA2pre-TRUNC            ( 1338) AATGAACA  1 
GAPDH_TRUNC              (  447) AATGAACA  1 
GRA7-TRUNC               (  634) ATTGAACA  1 
MIC5-TRUNC               (  822) ATTGAACA  1 
Camp-kin-cat-trunc       ( 1013) AAAGAACA  1 
MIC11-PRO-TRUNC          (  610) GCTGAACA  1 
RiboP-TRUNCATED          ( 1099) GCTGAACA  1 
MIC2-TRUNC               (  488) ACTGTACA  1 
MIC6-TRUNC               (  561) ACTGGACA  1 
ROP9-TRUNC               (  662) CCTGAACA  1 
MIC4-TRUNC               (  718) ACTGAACG  1 
Calmodulin-TRUNC         (  481) ACAGTACA  1 
PDIpro-trunc             (  463) ACACAACA  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 19 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 8 n= 23839 bayes= 10.5401 E= 5.4e+006 
   189   -210    -98  -1064 
   -22    136  -1064   -109 
    52  -1064  -1064    137 
 -1064   -210    193  -1064 
   189  -1064   -198   -109 
   219  -1064  -1064  -1064 
 -1064    190  -1064  -1064 
   210  -1064   -198  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 19 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 8 n= 23839 E= 5.4e+006 
 0.812129  0.062629  0.125076  0.000167 
 0.187519  0.687238  0.000154  0.125088 
 0.312441  0.000168  0.000154  0.687237 
 0.000136  0.062629  0.937068  0.000167 
 0.812129  0.000168  0.062615  0.125088 
 0.999512  0.000168  0.000154  0.000167 
 0.000136  0.999543  0.000154  0.000167 
 0.937051  0.000168  0.062615  0.000167 
--------------------------------------------------------------------------------





Time 745.93 secs.

********************************************************************************


********************************************************************************
MOTIF 20	width =    6   sites =  16   llr = 121   E-value = 8.9e+007
********************************************************************************
--------------------------------------------------------------------------------
	Motif 20 Description
--------------------------------------------------------------------------------
Simplified        A  :::8:a
pos.-specific     C  a:::a:
probability       G  :a1:::
matrix            T  ::93::

         bits    2.2      *
                 2.0 **  **
                 1.8 **  **
                 1.5 *** **
Information      1.3 ******
content          1.1 ******
(10.9 bits)      0.9 ******
                 0.7 ******
                 0.4 ******
                 0.2 ******
                 0.0 ------

Multilevel           CGTACA
consensus               T  
sequence                   
                           
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 20 sites sorted by position p-value
--------------------------------------------------------------------------------
Sequence name             Start   P-value             Site 
-------------             ----- ---------            ------
MIC11-PRO-TRUNC             958  2.26e-04 GAGCACCGCA CGTACA GCTCGACGTG
RiboP-TRUNCATED             115  2.26e-04 GAGGCGACAA CGTACA GAGCGTCTCA
GRA2pre-TRUNC               297  2.26e-04 TAGCTGATTT CGTACA CAGACAGATC
ROP9-TRUNC                  697  2.26e-04 TTGTCTCTCA CGTACA TCTGTGCGTT
MIC6-TRUNC                  511  2.26e-04 TTCCGGTGTA CGTACA TCGCGCGACA
MIC4-TRUNC                  860  2.26e-04 TTCGCCGCTT CGTACA ACGTACACTA
MIC2-TRUNC                  399  2.26e-04 CACTGTTACT CGTACA CTAGCTTCAT
Calmodulin-TRUNC           1442  2.26e-04 TGGTGGTTAG CGTACA CATACACTTC
cAMP_kinase_reg-trunc      1026  2.26e-04 CTCCGGTCTA CGTACA CCCCGTAGCA
Camp-kin-cat-trunc         1100  2.26e-04 TATGCCGTTG CGTACA ATGTCGGTGA
PDIpro-trunc                474  2.26e-04 CACAACAAGG CGTACA TTCCTTCCGC
MIC5-TRUNC                  328  5.02e-04 GCAAGTGTTC CGTTCA CTTTCCTTTA
PK4-TRUNC                  1167  5.02e-04 CCACTGCGCA CGTTCA TCTTTGACGT
GAPDH_TRUNC                 745  5.02e-04 AAGTTCTTTG CGTTCA GGCCGTCCCT
G6PD_TRUNC                 1397  5.02e-04 GCAGTTGCCT CGTTCA TCGTGTGTCC
GRA7-TRUNC                  834  7.11e-04 GGTAGAATTT CGGACA GTGAACCATT
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 20 block diagrams
--------------------------------------------------------------------------------
SEQUENCE NAME            POSITION P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
MIC11-PRO-TRUNC                   0.00023  957_[20]_537
RiboP-TRUNCATED                   0.00023  114_[20]_1381
GRA2pre-TRUNC                     0.00023  296_[20]_1198
ROP9-TRUNC                        0.00023  696_[20]_798
MIC6-TRUNC                        0.00023  510_[20]_984
MIC4-TRUNC                        0.00023  859_[20]_635
MIC2-TRUNC                        0.00023  398_[20]_1096
Calmodulin-TRUNC                  0.00023  1441_[20]_53
cAMP_kinase_reg-trunc             0.00023  1025_[20]_469
Camp-kin-cat-trunc                0.00023  1099_[20]_345
PDIpro-trunc                      0.00023  473_[20]_1021
MIC5-TRUNC                         0.0005  327_[20]_1167
PK4-TRUNC                          0.0005  1166_[20]_328
GAPDH_TRUNC                        0.0005  744_[20]_750
G6PD_TRUNC                         0.0005  1396_[20]_98
GRA7-TRUNC                        0.00071  833_[20]_661
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 20 in BLOCKS format
--------------------------------------------------------------------------------
BL   MOTIF 20 width=6 seqs=16
MIC11-PRO-TRUNC          (  958) CGTACA  1 
RiboP-TRUNCATED          (  115) CGTACA  1 
GRA2pre-TRUNC            (  297) CGTACA  1 
ROP9-TRUNC               (  697) CGTACA  1 
MIC6-TRUNC               (  511) CGTACA  1 
MIC4-TRUNC               (  860) CGTACA  1 
MIC2-TRUNC               (  399) CGTACA  1 
Calmodulin-TRUNC         ( 1442) CGTACA  1 
cAMP_kinase_reg-trunc    ( 1026) CGTACA  1 
Camp-kin-cat-trunc       ( 1100) CGTACA  1 
PDIpro-trunc             (  474) CGTACA  1 
MIC5-TRUNC               (  328) CGTTCA  1 
PK4-TRUNC                ( 1167) CGTTCA  1 
GAPDH_TRUNC              (  745) CGTTCA  1 
G6PD_TRUNC               ( 1397) CGTTCA  1 
GRA7-TRUNC               (  834) CGGACA  1 
//

--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 20 position-specific scoring matrix
--------------------------------------------------------------------------------
log-odds matrix: alength= 4 w= 6 n= 23871 bayes= 10.542 E= 8.9e+007 
 -1064    190  -1064  -1064 
 -1064  -1064    202  -1064 
 -1064  -1064   -198    181 
   178  -1064  -1064     -9 
 -1064    190  -1064  -1064 
   219  -1064  -1064  -1064 
--------------------------------------------------------------------------------

--------------------------------------------------------------------------------
	Motif 20 position-specific probability matrix
--------------------------------------------------------------------------------
letter-probability matrix: alength= 4 w= 6 n= 23871 E= 8.9e+007 
 0.000136  0.999543  0.000154  0.000167 
 0.000136  0.000168  0.999529  0.000167 
 0.000136  0.000168  0.062615  0.937081 
 0.749668  0.000168  0.000154  0.250010 
 0.000136  0.999543  0.000154  0.000167 
 0.999512  0.000168  0.000154  0.000167 
--------------------------------------------------------------------------------





Time 783.41 secs.

********************************************************************************


********************************************************************************
SUMMARY OF MOTIFS
********************************************************************************

--------------------------------------------------------------------------------
	Combined block diagrams: non-overlapping sites with p-value < 0.0001
--------------------------------------------------------------------------------
SEQUENCE NAME            COMBINED P-VALUE  MOTIF DIAGRAM
-------------            ----------------  -------------
G6PD_TRUNC                       4.27e-13  10_[3(2.10e-05)]_36_[2(3.85e-05)]_150_[14(2.30e-06)]_149_[5(2.69e-05)]_118_[7(3.66e-06)]_25_[6(4.33e-05)]_61_[8(7.05e-07)]_97_[10(4.94e-07)]_75_[16(2.70e-05)]_46_[11(2.40e-05)]_27_[1(1.30e-06)]_16_[9(4.44e-05)]_320_[12(2.40e-05)]_1_[4(6.14e-06)]_134_[19(1.96e-05)]_73
GAPDH_TRUNC                      1.20e-13  58_[4(3.00e-05)]_150_[6(1.78e-06)]_88_[4(3.92e-06)]_117_[19(2.84e-05)]_38_[10(5.91e-05)]_139_[14(1.25e-05)]_8_[3(3.47e-06)]_110_[2(5.32e-05)]_30_[8(4.22e-08)]_18_[16(2.79e-08)]_85_[9(6.59e-05)]_25_[1(1.31e-05)]_13_[5(8.60e-05)]_17_[7(1.56e-05)]_222_[9(1.69e-05)]_214
PDIpro-trunc                     3.57e-11  74_[7(1.18e-06)]_14_[3(3.47e-06)]_57_[8(1.15e-05)]_139_[12(9.39e-05)]_23_[1(1.56e-06)]_85_[5(4.62e-05)]_219_[16(4.93e-07)]_33_[2(1.96e-05)]_138_[12(4.59e-05)]_31_[4(3.00e-05)]_18_[10(4.16e-05)]_42_[14(1.13e-05)]_122_[6(1.19e-05)]_35_[9(8.13e-05)]_39_[11(7.19e-05)]_269
Camp-kin-cat-trunc               1.24e-08  106_[10(1.92e-05)]_15_[4(1.98e-05)]_69_[8(4.50e-06)]_83_[2(9.02e-05)]_149_[6(3.97e-05)]_58_[16(1.10e-05)]_95_[7(1.56e-05)]_61_[3(3.77e-06)]_131_[14(5.38e-05)]_137_[19(4.63e-05)]_125_[9(3.21e-05)]_240_[5(1.81e-05)]_46
cAMP_kinase_reg-trunc            5.01e-13  122_[5(3.91e-05)]_135_[9(1.69e-05)]_15_[6(3.46e-05)]_91_[19(1.08e-05)]_27_[2(5.84e-06)]_167_[8(5.98e-06)]_108_[7(6.40e-05)]_52_[14(9.15e-07)]_93_[16(1.91e-06)]_92_[11(7.19e-05)]_56_[12(2.40e-05)]_50_[10(2.62e-07)]_73_[1(1.65e-05)]_88_[4(4.80e-06)]_93_[11(7.19e-05)]_29_[3(2.10e-05)]_39
PK4-TRUNC                        1.82e-10  6_[10(4.80e-05)]_18_[1(4.81e-06)]_69_[7(5.16e-06)]_17_[14(2.98e-05)]_23_[16(5.99e-05)]_239_[9(5.44e-06)]_33_[2(5.84e-06)]_19_[8(5.23e-07)]_24_[6(3.46e-05)]_23_[1(4.76e-05)]_49_[3(4.79e-05)]_29_[10(1.92e-05)]_40_[12(2.40e-05)]_26_[19(1.96e-05)]_236_[12(9.39e-05)]_69_[4(1.34e-05)]_372_[5(8.60e-05)]_24
Calmodulin-TRUNC                 3.11e-10  25_[10(1.74e-05)]_331_[1(2.55e-05)]_39_[3(2.27e-05)]_25_[2(5.96e-05)]_6_[14(8.56e-05)]_118_[6(2.46e-05)]_4_[12(9.39e-05)]_134_[16(2.89e-05)]_121_[7(2.18e-05)]_195_[9(1.69e-05)]_92_[9(4.17e-05)]_69_[8(1.16e-09)]_94_[4(4.20e-07)]_98
MIC2-TRUNC                       1.20e-14  63_[16(5.36e-05)]_47_[2(5.84e-06)]_23_[8(1.97e-07)]_23_[16(1.34e-06)]_104_[7(1.14e-05)]_159_[19(7.16e-05)]_117_[5(9.96e-06)]_257_[9(6.97e-06)]_32_[4(1.07e-05)]_136_[10(9.17e-05)]_45_[5(8.60e-05)]_93_[3(1.64e-05)]_46_[1(2.13e-07)]_51_[12(4.59e-05)]_1_[14(1.98e-07)]_50_[6(2.10e-05)]_76
MIC4-TRUNC                       3.12e-08  178_[16(5.99e-05)]_135_[8(1.13e-06)]_22_[14(1.69e-06)]_64_[1(4.81e-06)]_15_[7(2.62e-05)]_31_[10(6.75e-05)]_109_[6(1.77e-05)]_114_[4(5.36e-05)]_224_[5(6.70e-05)]_156_[3(1.44e-05)]_294_[4(1.98e-05)]_9_[9(2.34e-05)]_8
MIC5-TRUNC                       1.56e-15  31_[16(1.19e-06)]_[3(1.37e-06)]_98_[7(1.44e-05)]_2_[2(9.02e-05)]_135_[10(1.51e-06)]_250_[8(1.03e-08)]_89_[9(3.14e-06)]_121_[2(3.85e-05)]_1_[19(4.63e-05)]_26_[7(8.78e-05)]_13_[1(3.56e-06)]_9_[12(9.39e-05)]_66_[14(1.04e-05)]_57_[6(1.01e-05)]_[11(2.40e-05)]_51_[5(9.96e-06)]_31_[12(2.40e-05)]_192_[11(7.19e-05)]_51_[4(3.76e-05)]_23_[3(9.51e-06)]_46
MIC6-TRUNC                       7.79e-11  16_[8(1.46e-05)]_449_[7(7.36e-07)]_45_[11(2.40e-05)]_144_[12(9.39e-05)]_182_[9(5.46e-07)]_30_[3(1.64e-05)]_154_[2(6.76e-05)]_99_[1(2.16e-05)]_16_[10(9.17e-05)]_163_[16(1.19e-05)]_31_[4(1.74e-06)]_34_[6(6.97e-07)]_2
ROP9-TRUNC                       9.45e-11  37_[10(5.15e-05)]_32_[8(1.47e-06)]_325_[2(6.76e-05)]_16_[5(9.96e-06)]_181_[7(7.97e-05)]_97_[16(2.36e-05)]_20_[7(7.99e-06)]_288_[1(4.76e-05)]_1_[1(1.06e-06)]_22_[9(2.25e-06)]_144_[4(1.68e-05)]_24_[11(7.19e-05)]_15_[14(5.42e-07)]_121_[3(5.09e-05)]_[6(9.32e-05)]_9
GRA7-TRUNC                       4.94e-12  56_[14(7.48e-05)]_68_[11(7.19e-05)]_203_[3(3.72e-07)]_132_[2(1.30e-05)]_2_[9(4.49e-06)]_11_[8(2.64e-06)]_70_[8(8.65e-05)]_4_[19(4.63e-05)]_307_[5(9.96e-06)]_20_[5(8.60e-05)]_47_[10(3.80e-05)]_86_[6(1.48e-05)]_63_[1(2.13e-07)]_59_[4(4.06e-05)]_109_[7(1.44e-05)]_36_[16(2.99e-06)]_46
GRA2pre-TRUNC                    4.22e-13  238_[14(4.05e-06)]_1_[2(5.84e-06)]_56_[5(3.91e-05)]_381_[16(2.99e-06)]_79_[10(1.51e-06)]_6_[8(2.85e-06)]_241_[7(2.11e-06)]_31_[9(2.25e-06)]_196_[1(2.74e-05)]_3_[19(2.84e-05)]_7_[6(3.80e-05)]_40_[3(8.86e-06)]_21_[4(3.05e-06)]_54
RiboP-TRUNCATED                  7.88e-11  [5(9.96e-06)]_178_[16(6.66e-05)]_74_[11(7.19e-05)]_88_[11(2.40e-05)]_59_[5(1.81e-05)]_178_[7(9.30e-05)]_8_[14(5.38e-05)]_3_[4(3.76e-05)]_43_[8(3.46e-07)]_51_[16(3.31e-06)]_145_[10(2.92e-06)]_9_[9(7.67e-06)]_69_[1(5.17e-05)]_46_[19(5.84e-05)]_10_[2(5.96e-05)]_56_[12(2.40e-05)]_155_[3(8.86e-06)]_53_[6(1.12e-05)]_[11(7.19e-05)]_75
MIC11-PRO-TRUNC                  1.11e-10  428_[7(1.04e-05)]_170_[19(5.84e-05)]_13_[12(9.39e-05)]_21_[2(4.66e-05)]_68_[10(2.06e-05)]_279_[9(1.25e-05)]_21_[11(2.40e-05)]_21_[8(4.84e-06)]_21_[14(2.30e-06)]_2_[5(5.71e-05)]_24_[4(3.39e-05)]_13_[11(7.19e-05)]_103_[6(3.33e-07)]_56_[9(2.34e-05)]_55_[16(2.99e-06)]_46
--------------------------------------------------------------------------------

********************************************************************************


********************************************************************************
Stopped because nmotifs = 20 reached.
********************************************************************************

CPU: mnode012

********************************************************************************
From shikida at gmail.com  Fri Jun 24 10:59:46 2005
From: shikida at gmail.com (Leonardo Kenji Shikida)
Date: Sat Jun 25 20:51:39 2005
Subject: [Bioperl-l] problems during installation
Message-ID: <1b4364400506240759372ff1af@mail.gmail.com>

trying to install using perl -MCPAN -e "install Bundle::BioPerl" in a
suse 9.3 box

how should I proceed? 

>>>>>>>>

  CPAN.pm: Going to build L/LD/LDS/GD-2.19.tar.gz

NOTICE: This module requires libgd 2.0.28 or higher.
        it will NOT work with earlier versions. If you are getting
        compile or link errors, then please get and install a new
        version of libgd from www.boutell.com. Do NOT ask Lincoln
        for help until you try this.

        If you are using Math::Trig 1.01 or lower, it has a bug that
        causes a "prerequisite not found" warning to be issued.  You may
        safely ignore this warning.

        Type perl Makefile.PL -h for command-line option summary

Configuring for libgd version 2.0.32.
Included Features:          GD_XPM GD_JPEG GD_FONTCONFIG GD_FREETYPE GD_PNG GD_G
IF
GD library used from:       /usr

If you experience compile problems, please check the @INC, @LIBPATH and @LIBS
arrays defined in Makefile.PL and manually adjust, if necessary.

Checking if your kit is complete...
Looks good
Writing Makefile for GD
cp GD/Polyline.pm blib/lib/GD/Polyline.pm
cp qd.pl blib/lib/qd.pl
cp GD.pm blib/lib/GD.pm
AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
cp GD/Simple.pm blib/lib/GD/Simple.pm
/usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap /usr/lib/perl5/5.8.
6/ExtUtils/typemap -typemap typemap  GD.xs > GD.xsc && mv GD.xsc GD.c
cc -c  -I/usr/include -D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS -DDEBUGGING
 -fno-strict-aliasing -pipe -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -marc
h=i586 -mcpu=i686 -fmessage-length=0 -Wall -g -Wall -pipe   -DVERSION=\"2.19\" -
DXS_VERSION=\"2.19\" -fPIC "-I/usr/lib/perl5/5.8.6/i586-linux-thread-multi/CORE"
  -DHAVE_JPEG -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_FONTCONFIG GD.c
GD.xs:7:16: gd.h: No such file or directory
GD.xs:8:21: gdfontg.h: No such file or directory
GD.xs:9:21: gdfontl.h: No such file or directory
GD.xs:10:22: gdfontmb.h: No such file or directory


-- 

[]

Kenji
_______________________
http://kenjiria.blogspot.com 
http://gaitabh.blogspot.com

From hlapp at gmx.net  Sun Jun 26 15:14:59 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sun Jun 26 15:07:15 2005
Subject: [Bioperl-l] Fwd: Re: Bio::DB::BioDB
In-Reply-To: <37588.83.151.196.59.1119681697.squirrel@webmail.ebi.ac.uk>
References: <37588.83.151.196.59.1119681697.squirrel@webmail.ebi.ac.uk>
Message-ID: <acc839adcc01f09ceb6e21e9fd4b325c@gmx.net>

Madhuri,

please do NOT send personal email to Heikki or any other developer with 
questions or reports concerning any software module. Otherwise you risk 
that your emails remain unanswered. There's many people on the mailing 
list who can possibly help you out.

As for your report, I fixed the cause for this in bioperl-db. You need 
to update from cvs, or download the tarball and re-install. The change 
is in a single file, namely Bio/DB/Persistent/PersistentObject.pm. The 
new version should have the revision line
$Id: PersistentObject.pm,v 1.5 2005/06/26 17:38:22 lapp Exp $
at the top of the file.

	-hilmar

On Jun 25, 2005, at 2:41 AM, lehvasla@ebi.ac.uk wrote:

>
> From: madhuri battu <madhuri_battu@yahoo.co.in>
> Date: June 24, 2005 4:33:46 PM EDT
> To: Heikki Lehv?slaiho <heikki@ebi.ac.uk>
> Subject: Re: Bio::DB::BioDB
>
>
> Hi,
>   I loaded the whole Bioperl through cvs and i tried
> to run load_seqdatabase.pl script on my machine and i
> am getting the following errors
>
> Could not store NM_000014: Operation `ne': no method
> found,
>         left argument in overloaded package
> Bio::Annotation::Reference,
>         right argument has no overloaded magic at
> /usr/lib/perl5/site_perl/5.8.0/Bio/DB/Persistent/PersistentObject.pm
> line534, <GEN0> line 581.
>
> Can you please help me in this matter.
> Thanks,
> Madhuri.
> --- Heikki Lehvaslaiho <heikki@ebi.ac.uk> wrote:
>
>> Madhuri,
>>
>> It should work from CVS. I've forwarded your message
>> to the bioperl mailing
>> list (bioperl-l@bioperl.org). Please further queries
>> and more detailed
>> problem reports there.
>>
>> If you have downloaded bioperl-db from CVS, you need
>> to add its root directory
>> to your PERL5LIB environmental variable.
>>
>>
> PERL5LIB=/home/heikki/src/bioperl/core:/home/heikki/src/bioperl/db
>>
>> More generic bioperl install instructions can be
>> found at:
>>
> http://www.ebi.ac.uk/~lehvasla/bioperl/InstallingBioperl.html
>>
>>
>>  -Heikki
>>
>> On Thursday 23 June 2005 19:47, madhuri battu wrote:
>>> Hi,
>>>   My name is Madhuri Battu. I am working at UT
>>> Southwestern in US as an intern. I have a problem
>> with
>>> installing Bio::DB::BioDB. It was saying it is 5
>> years
>>> old on downloads page and recently updated on View
>> cvs
>>> page. Can you please tell whether the module is
>> being
>>> used and how can i install it. If this module is
>> not
>>> being used what module can be used in place of
>> that.
>>> Thanks,
>>> Madhuri.
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>
> __________________________________________________________
>>> Free antispam, antivirus and 1GB to save all your
>> messages
>>> Only in Yahoo! Mail: http://in.mail.yahoo.com
>>
>> -- 
>> ______ _/
>>
> _/_____________________________________________________
>>       _/      _/
>> http://www.ebi.ac.uk/mutations/
>>      _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi
>> _ac _uk
>>     _/_/_/_/_/  EMBL Outstation, European
>> Bioinformatics Institute
>>    _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
>>   _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
>>      _/      Phone: +44 (0)1223 494 644   FAX: +44
>> (0)1223 494 468
>> ___
>>
> _/_/_/_/_/________________________________________________________
>>
>
>
>
> 		
> __________________________________________________________
> How much free photo storage do you get? Store your friends 'n family 
> snaps for FREE with Yahoo! Photos http://in.photos.yahoo.com
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------



From fetter_fake at hotmail.com  Mon Jun 27 05:14:38 2005
From: fetter_fake at hotmail.com (Zack Napalm)
Date: Mon Jun 27 05:09:54 2005
Subject: [Bioperl-l] pubmed article download and storing in object
Message-ID: <BAY17-F7D08F7B2F3A98A082C9D98DEE0@phx.gbl>

Hi,
I am new at Bioperl and wondering whether there is a possibility to scrape 
articles from PubMed automatically, and put them into an 
Bio::Biblio::PubmedArticle object.
I don't want to scrape them via LWP::Simple get and put them into an object 
manually, if there is a appropriate function predefined.

regards
johnny

_________________________________________________________________
Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar mit 
Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu! 
http://desktop.msn.de/ Jetzt gratis downloaden!

From khh103 at york.ac.uk  Mon Jun 27 06:47:57 2005
From: khh103 at york.ac.uk (Kat Hull)
Date: Mon Jun 27 06:40:38 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42BC2F9E.20607@utk.edu>
References: <42BAF1B7.10109@york.ac.uk>
	<42BB131A.2090403@utk.edu>	<42BC298F.8000100@york.ac.uk>
	<42BC2F9E.20607@utk.edu>
Message-ID: <42BFD95D.7070001@york.ac.uk>

Hi Stefan,
I'm still having problems!
I get some features from the sequence object but can't get past this 
part in the code:

  $ac=$feat->annotation();   # This is not returning anything.

Could you look at the code to tell me where its going wrong?

Thanks again,
#________________________________________
#!/biol/programs/perl580/bin/perl
                                                                                              

use Bio::Annotation::Collection;
use Bio::DB::GenPept;
$gb = new Bio::DB::GenPept;
                                                                                              

                                    
my $seqio = $gb->get_Stream_by_id(['13474692']);
my $ac;
my $c;
                                                                                              

  while( my $seq = $seqio->next_seq ) {
      print "seq is  ", $seq->display_id, "\n";
      my @f=$seq->get_all_SeqFeatures;     #This gives you the 
annotation of the retrieved sequence object
                                                                                              

      foreach my $feat (@f) {
        ++$c;
       print "Feature ",$feat->primary_tag," starts ",$feat->start," ends ",
       $feat->end," strand ",$feat->strand,"\n";
                                                                                              

       # features retain link to underlying sequence object
       #print "Feature sequence is ",$feat->seq->seq(),"\n";
                                                                                              

        my $t = $feat->feature_count;
        print "Feature count is $t\n";
        print "count is $c\n";
                                                                                              

        $ac=$feat->annotation();  #  PROBLEM SEEMS TO BE HERE
                                                                                              

        my $blah=$ac->get_all_annotation_keys();
        print "GETS TO HERE WITH NO KEYS $blah\n";
                                                                                              

           foreach $key ( $ac->get_all_annotation_keys() ) {
                print "DOESN'T GET TO HERE\n";
               @values = $ac->get_Annotations($key);
               foreach $value ( @values ) {
                # value is an Bio::AnnotationI, and defines a "as_text" 
method
                print "Annotation ",$key," stringified value 
",$value->as_text,"\n";
                                                                                              

                # also defined hash_tree method, which allows data 
orientated
                # access into this object
                $hash = $value->hash_tree();
               }
           }
                                                                                              

# commented out for now          
                                                                                  

   #    next unless ($ac->get_Annotations('coded_by'));
    #   my @coded=$ac->get_Annotations('coded_by');
     #  foreach my $location (@coded) {
      #   print $location->value, " is the location that codes this 
protein\n";
     #  }
      }
  }





Stefan Kirov wrote:

>   my $seqio = $gb->get_Stream_by_id(['13474692']);
>   while( my $seq = $seqio->next_seq ) {
>       print "seq is  ", $seq->display_id, "\n";
>       my $ann=$seq->annotation; #This gives you the annotation of the 
> retrieved sequence object
>      foreach my $dblink ($ann->get_Annotations('DBLink')) {
>          if ($dblink->database =~/refseq/i) {
>             print $database->primary_id, " is the mRNA accession 
> number\n";
>          }
>       }
>   }
> However, the gene you are looking at is not associated with any NM_ 
> sequence, but rather comes from NC_. Therefore the above will not work 
> for you. You will have to descend through the sequence features and 
> find teh feature that says 'coded_by':
> use Bio::DB::GenPept;
> my $gb=new Bio::DB::GenPept;
>  my $seqio = $gb->get_Stream_by_id(['13474692']);
>   while( my $seq = $seqio->next_seq ) {
>       print "seq is  ", $seq->display_id, "\n";
>       my @f=$seq->get_SeqFeatures; #This gives you the annotation of 
> the retrieved sequence object
>      foreach my $feat (@f) {
>        my $ann=$feat->annotation;
>        next unless ($ann->get_Annotations('coded_by'));
>        my @coded=$ann->get_Annotations('coded_by');
>        foreach my $location (@coded) {
>          print $location->value, " is the location that codes this 
> protein\n";
>        }
>       }
>   }
> No guarantees the code is typo free :-)
> Stefan
>
> Kat Hull wrote:
>
>> Hi Stefan,
>> Thanks for your advice but i'm still struggling!   I have used 
>> Bio::DB::GenPept to get the protein accession number given the 
>> protein gi number.  However, I don't understand how 
>> Bio::Annotation::DBLink works.  Does it fetch the url of a link on 
>> the web-site?   Basically, if I could use this (or something else) to 
>> get the url of the CDS link for my protein of interest, I can get the 
>> corresponding nucleotide accession from this, as it is encoded in the 
>> url.
>> Do you know how to use this module?  Is this what you were suggesting 
>> I try yesterday (I didn't really understand what you were getting at).
>> Many thanks,
>>
>> Kat
>>
>> ps. Here's where i'm at so far:
>>                                                                                                                                                                                    
>>
>> use Bio::Annotation::DBLink;
>> use Bio::DB::GenBank;
>> use Bio::DB::GenPept;
>>   $gb = new Bio::DB::GenPept;
>>                                                                                                                                                                                                                                                                                                                                                                                                                                                  
>>
>>    # given the gi number, this returns the accession
>>    my $seqio = $gb->get_Stream_by_id(['13474692']);
>>    while( my $seq = $seqio->next_seq ) {
>>        print "seq is  ", $seq->display_id, "\n";
>>    }
>>     # not sure what i'm doing here 
>>                                                                                                                                                                                                                                                                                                                                                               
>>
>>   $link2 = new Bio::Annotation::DBLink();
>>   $link2->database('dbSNP');
>>   $link2->primary_id('2367');
>>
>>
>>
>>
>>
>> Stefan Kirov wrote:
>>
>>> Kat,
>>> If you are familiar with Bioperl it is kind of easy-
>>> look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on how 
>>> to get the protein record
>>> Go through the dblinks and find the appropriate accession number 
>>> (where the database method returns  GenBank).
>>> Then retrieve this accession number(s) through Bio::DB::GenBank. If 
>>> you are not familiar with Bioperl- read the docs for 
>>> Bio::DB::GenPept, Bio::DB::GenBank, Bio::Annotation and 
>>> Bio::Annotation::DBLink).
>>> Hope this helps,
>>> Stefan
>>>
>>> Kat Hull wrote:
>>>
>>>> Hi there,
>>>> I was wondering whether anyone has a solution to my problem. I have 
>>>> a list of protein assession numbers and want to retrieve the 
>>>> corresponding nucleotide sequences automatically.  I thought it 
>>>> would be possible to do this by changing the NCBI url, but this 
>>>> doesn't seem to be the case.
>>>> Is there a bio-perl module that can do this?
>>>>
>>>> Kind regards,
>>>> Kat
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l@portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>>
>>>
>>>
>>> Stefan
>>
>>
>>
>>
>>
>


From lifei03 at gmail.com  Mon Jun 27 07:14:40 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Mon Jun 27 07:06:09 2005
Subject: [Bioperl-l] problems during installation
In-Reply-To: <1b4364400506240759372ff1af@mail.gmail.com>
References: <1b4364400506240759372ff1af@mail.gmail.com>
Message-ID: <42BFDFA0.1010609@gmail.com>

Just guess,  I believe the answer is given when you configing as this :

If you experience compile problems, please check the @INC, @LIBPATH and @LIBS
arrays defined in Makefile.PL and manually adjust, if necessary.

For me, I will locate these files and find where they are and add them to the @INC or @LIBPATH, etc. 

Wish you luck





\
Leonardo Kenji Shikida wrote:

>trying to install using perl -MCPAN -e "install Bundle::BioPerl" in a
>suse 9.3 box
>
>how should I proceed? 
>
>  
>
>
>  CPAN.pm: Going to build L/LD/LDS/GD-2.19.tar.gz
>
>NOTICE: This module requires libgd 2.0.28 or higher.
>        it will NOT work with earlier versions. If you are getting
>        compile or link errors, then please get and install a new
>        version of libgd from www.boutell.com. Do NOT ask Lincoln
>        for help until you try this.
>
>        If you are using Math::Trig 1.01 or lower, it has a bug that
>        causes a "prerequisite not found" warning to be issued.  You may
>        safely ignore this warning.
>
>        Type perl Makefile.PL -h for command-line option summary
>
>Configuring for libgd version 2.0.32.
>Included Features:          GD_XPM GD_JPEG GD_FONTCONFIG GD_FREETYPE GD_PNG GD_G
>IF
>GD library used from:       /usr
>
>If you experience compile problems, please check the @INC, @LIBPATH and @LIBS
>arrays defined in Makefile.PL and manually adjust, if necessary.
>
>Checking if your kit is complete...
>Looks good
>Writing Makefile for GD
>cp GD/Polyline.pm blib/lib/GD/Polyline.pm
>cp qd.pl blib/lib/qd.pl
>cp GD.pm blib/lib/GD.pm
>AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
>cp GD/Simple.pm blib/lib/GD/Simple.pm
>/usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap /usr/lib/perl5/5.8.
>6/ExtUtils/typemap -typemap typemap  GD.xs > GD.xsc && mv GD.xsc GD.c
>cc -c  -I/usr/include -D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS -DDEBUGGING
> -fno-strict-aliasing -pipe -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -marc
>h=i586 -mcpu=i686 -fmessage-length=0 -Wall -g -Wall -pipe   -DVERSION=\"2.19\" -
>DXS_VERSION=\"2.19\" -fPIC "-I/usr/lib/perl5/5.8.6/i586-linux-thread-multi/CORE"
>  -DHAVE_JPEG -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_FONTCONFIG GD.c
>GD.xs:7:16: gd.h: No such file or directory
>GD.xs:8:21: gdfontg.h: No such file or directory
>GD.xs:9:21: gdfontl.h: No such file or directory
>GD.xs:10:22: gdfontmb.h: No such file or directory
>
>
>  
>

From Richard.Adams at ed.ac.uk  Mon Jun 27 09:56:46 2005
From: Richard.Adams at ed.ac.uk (Richard Adams)
Date: Mon Jun 27 09:48:13 2005
Subject: [Bioperl-l] Bio::DB::CUTG behaving weird
Message-ID: <42C0059E.1050708@ed.ac.uk>

Stefan,
I'm looking into it although I don't have access to either of those  OSs.
Does the test script (t/DBCUTG.t) run OK on both systems?

I imagine the error is coming from  the fact that the parser is trying 
to parse the mitochondrial table
and I will try to sort out why that isn't parsing properly. Basically 
all the DBCUTG module does to cope
with a non-unique species is just select the  first in the list based on 
regexp matching, this is usually the most likely choice.


I'll put in some hopefully more challenging tests in the test script to 
help find the bug. If you can run your script with
$db->verbose(1) set (using the CVS version) and send me the output I can 
look into it more...

Best wishes,

Richard


-- 
Dr Richard Adams
Psychiatric Genetics Group,
Medical Genetics,
Molecular Medicine Centre,
Western General Hospital,
Crewe Rd West,
Edinburgh UK
EH4 2XU

Tel: 44 131 651 1084
richard.adams@ed.ac.uk


From skirov at utk.edu  Mon Jun 27 10:20:01 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Mon Jun 27 10:13:02 2005
Subject: [Bioperl-l] Bio::DB::CUTG behaving weird
In-Reply-To: <42C0059E.1050708@ed.ac.uk>
References: <42C0059E.1050708@ed.ac.uk>
Message-ID: <42C00B11.3040300@utk.edu>

I am trying to debug it right now and I have some limited success. I 
will let you know what may be wrong as soon as I can. By the way, do you 
minde adding some simple functionality which may be useful to this 
module such as 3-way table consisting of AA name, symbol and letter as in:
Alanine=>Ala=>A.
If you don't have the time I can add this as well (if you consider it 
useful of course).
Stefan

Richard Adams wrote:

> Stefan,
> I'm looking into it although I don't have access to either of those  OSs.
> Does the test script (t/DBCUTG.t) run OK on both systems?
>
> I imagine the error is coming from  the fact that the parser is trying 
> to parse the mitochondrial table
> and I will try to sort out why that isn't parsing properly. Basically 
> all the DBCUTG module does to cope
> with a non-unique species is just select the  first in the list based 
> on regexp matching, this is usually the most likely choice.
>
>
> I'll put in some hopefully more challenging tests in the test script 
> to help find the bug. If you can run your script with
> $db->verbose(1) set (using the CVS version) and send me the output I 
> can look into it more...
>
> Best wishes,
>
> Richard
>
>

From lifei03 at gmail.com  Mon Jun 27 11:06:38 2005
From: lifei03 at gmail.com (Frank Lee)
Date: Mon Jun 27 10:57:46 2005
Subject: [Bioperl-l] convert Refseq ID to another ID can be used for Gene
	ontology?
Message-ID: <42C015FE.6060305@gmail.com>

Dear All,

I met a  trouble question for using gene ontology.   I have finished my 
protein analysis by using data from Refseq database.  But when I wish to 
further analyze the protein function with GO, I unfortunately found that 
refseq ID are not supported:-(.    Can anybody have the experience on 
convert refseq ID to another IDs which can be used in GO?  

My protein sequence cover Homo, Mus,  Arabidopsis, Oryza, Drosophila, C. 
elegans.   It seems IDs used for GO is different for different species.  
Anyway, I should try one by one.  Thanks in advance.

Best wishes

Frank
From skirov at utk.edu  Mon Jun 27 11:56:02 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Mon Jun 27 11:47:21 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42BFD95D.7070001@york.ac.uk>
References: <42BAF1B7.10109@york.ac.uk> <42BB131A.2090403@utk.edu>
	<42BC298F.8000100@york.ac.uk> <42BC2F9E.20607@utk.edu>
	<42BFD95D.7070001@york.ac.uk>
Message-ID: <42C02192.3020400@utk.edu>

Kat,
In my experience works OK:
60 mendel /home/sao> perl test.pl
seq is  NP_106261
Feature source starts 1 ends 243 strand 1
Feature count is 0
count is 1
GETS TO HERE WITH NO KEYS 3
DOESN'T GET TO HERE
Annotation db_xref stringified value Value: taxon:266835
DOESN'T GET TO HERE
Annotation strain stringified value Value: MAFF303099
DOESN'T GET TO HERE
Annotation organism stringified value Value: Mesorhizobium loti MAFF303099
Feature Protein starts 1 ends 243 strand 1
Feature count is 0
count is 2
GETS TO HERE WITH NO KEYS 1
DOESN'T GET TO HERE
Annotation product stringified value Value: transcriptional regulator
Feature CDS starts 1 ends 243 strand 1
Feature count is 0
count is 3
GETS TO HERE WITH NO KEYS 4
DOESN'T GET TO HERE
Annotation locus_tag stringified value Value: mlr5637
DOESN'T GET TO HERE
Annotation db_xref stringified value Value: GeneID:1228922
DOESN'T GET TO HERE
Annotation coded_by stringified value Value: NC_002678.2:4529413..4530144
DOESN'T GET TO HERE
Annotation transl_table stringified value Value: 11

What you need is
Annotation coded_by stringified value Value: NC_002678.2:4529413..4530144
What bioperl version are you using?

Stefan

Kat Hull wrote:

> Hi Stefan,
> I'm still having problems!
> I get some features from the sequence object but can't get past this 
> part in the code:
>
>  $ac=$feat->annotation();   # This is not returning anything.
>
> Could you look at the code to tell me where its going wrong?
>
> Thanks again,
> #________________________________________
> #!/biol/programs/perl580/bin/perl
>                                                                                              
>
> use Bio::Annotation::Collection;
> use Bio::DB::GenPept;
> $gb = new Bio::DB::GenPept;
>                                                                                              
>
>                                    my $seqio = 
> $gb->get_Stream_by_id(['13474692']);
> my $ac;
> my $c;
>                                                                                              
>
>  while( my $seq = $seqio->next_seq ) {
>      print "seq is  ", $seq->display_id, "\n";
>      my @f=$seq->get_all_SeqFeatures;     #This gives you the 
> annotation of the retrieved sequence object
>                                                                                              
>
>      foreach my $feat (@f) {
>        ++$c;
>       print "Feature ",$feat->primary_tag," starts ",$feat->start," 
> ends ",
>       $feat->end," strand ",$feat->strand,"\n";
>                                                                                              
>
>       # features retain link to underlying sequence object
>       #print "Feature sequence is ",$feat->seq->seq(),"\n";
>                                                                                              
>
>        my $t = $feat->feature_count;
>        print "Feature count is $t\n";
>        print "count is $c\n";
>                                                                                              
>
>        $ac=$feat->annotation();  #  PROBLEM SEEMS TO BE HERE
>                                                                                              
>
>        my $blah=$ac->get_all_annotation_keys();
>        print "GETS TO HERE WITH NO KEYS $blah\n";
>                                                                                              
>
>           foreach $key ( $ac->get_all_annotation_keys() ) {
>                print "DOESN'T GET TO HERE\n";
>               @values = $ac->get_Annotations($key);
>               foreach $value ( @values ) {
>                # value is an Bio::AnnotationI, and defines a "as_text" 
> method
>                print "Annotation ",$key," stringified value 
> ",$value->as_text,"\n";
>                                                                                              
>
>                # also defined hash_tree method, which allows data 
> orientated
>                # access into this object
>                $hash = $value->hash_tree();
>               }
>           }
>                                                                                              
>
> # commented out for now          
>                                                                                  
>
>   #    next unless ($ac->get_Annotations('coded_by'));
>    #   my @coded=$ac->get_Annotations('coded_by');
>     #  foreach my $location (@coded) {
>      #   print $location->value, " is the location that codes this 
> protein\n";
>     #  }
>      }
>  }
>
>
>
>
>
> Stefan Kirov wrote:
>
>>   my $seqio = $gb->get_Stream_by_id(['13474692']);
>>   while( my $seq = $seqio->next_seq ) {
>>       print "seq is  ", $seq->display_id, "\n";
>>       my $ann=$seq->annotation; #This gives you the annotation of the 
>> retrieved sequence object
>>      foreach my $dblink ($ann->get_Annotations('DBLink')) {
>>          if ($dblink->database =~/refseq/i) {
>>             print $database->primary_id, " is the mRNA accession 
>> number\n";
>>          }
>>       }
>>   }
>> However, the gene you are looking at is not associated with any NM_ 
>> sequence, but rather comes from NC_. Therefore the above will not 
>> work for you. You will have to descend through the sequence features 
>> and find teh feature that says 'coded_by':
>> use Bio::DB::GenPept;
>> my $gb=new Bio::DB::GenPept;
>>  my $seqio = $gb->get_Stream_by_id(['13474692']);
>>   while( my $seq = $seqio->next_seq ) {
>>       print "seq is  ", $seq->display_id, "\n";
>>       my @f=$seq->get_SeqFeatures; #This gives you the annotation of 
>> the retrieved sequence object
>>      foreach my $feat (@f) {
>>        my $ann=$feat->annotation;
>>        next unless ($ann->get_Annotations('coded_by'));
>>        my @coded=$ann->get_Annotations('coded_by');
>>        foreach my $location (@coded) {
>>          print $location->value, " is the location that codes this 
>> protein\n";
>>        }
>>       }
>>   }
>> No guarantees the code is typo free :-)
>> Stefan
>>
>> Kat Hull wrote:
>>
>>> Hi Stefan,
>>> Thanks for your advice but i'm still struggling!   I have used 
>>> Bio::DB::GenPept to get the protein accession number given the 
>>> protein gi number.  However, I don't understand how 
>>> Bio::Annotation::DBLink works.  Does it fetch the url of a link on 
>>> the web-site?   Basically, if I could use this (or something else) 
>>> to get the url of the CDS link for my protein of interest, I can get 
>>> the corresponding nucleotide accession from this, as it is encoded 
>>> in the url.
>>> Do you know how to use this module?  Is this what you were 
>>> suggesting I try yesterday (I didn't really understand what you were 
>>> getting at).
>>> Many thanks,
>>>
>>> Kat
>>>
>>> ps. Here's where i'm at so far:
>>>                                                                                                                                                                                    
>>>
>>> use Bio::Annotation::DBLink;
>>> use Bio::DB::GenBank;
>>> use Bio::DB::GenPept;
>>>   $gb = new Bio::DB::GenPept;
>>>                                                                                                                                                                                                                                                                                                                                                                                                                                                  
>>>
>>>    # given the gi number, this returns the accession
>>>    my $seqio = $gb->get_Stream_by_id(['13474692']);
>>>    while( my $seq = $seqio->next_seq ) {
>>>        print "seq is  ", $seq->display_id, "\n";
>>>    }
>>>     # not sure what i'm doing here 
>>>                                                                                                                                                                                                                                                                                                                                                               
>>>
>>>   $link2 = new Bio::Annotation::DBLink();
>>>   $link2->database('dbSNP');
>>>   $link2->primary_id('2367');
>>>
>>>
>>>
>>>
>>>
>>> Stefan Kirov wrote:
>>>
>>>> Kat,
>>>> If you are familiar with Bioperl it is kind of easy-
>>>> look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on 
>>>> how to get the protein record
>>>> Go through the dblinks and find the appropriate accession number 
>>>> (where the database method returns  GenBank).
>>>> Then retrieve this accession number(s) through Bio::DB::GenBank. If 
>>>> you are not familiar with Bioperl- read the docs for 
>>>> Bio::DB::GenPept, Bio::DB::GenBank, Bio::Annotation and 
>>>> Bio::Annotation::DBLink).
>>>> Hope this helps,
>>>> Stefan
>>>>
>>>> Kat Hull wrote:
>>>>
>>>>> Hi there,
>>>>> I was wondering whether anyone has a solution to my problem. I 
>>>>> have a list of protein assession numbers and want to retrieve the 
>>>>> corresponding nucleotide sequences automatically.  I thought it 
>>>>> would be possible to do this by changing the NCBI url, but this 
>>>>> doesn't seem to be the case.
>>>>> Is there a bio-perl module that can do this?
>>>>>
>>>>> Kind regards,
>>>>> Kat
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l@portal.open-bio.org
>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> Stefan
>>>
>>>
>>>
>>>
>>>
>>>
>>
>
>

-- 
Stefan Kirov, Ph.D.
University of Tennessee/Oak Ridge National Laboratory
5700 bldg, PO BOX 2008 MS6164
Oak Ridge TN 37831-6164
USA
tel +865 576 5120
fax +865-576-5332
e-mail: skirov@utk.edu
sao@ornl.gov

"And the wars go on with brainwashed pride
For the love of God and our human rights
And all these things are swept aside"

From khh103 at york.ac.uk  Mon Jun 27 12:16:28 2005
From: khh103 at york.ac.uk (Kat Hull)
Date: Mon Jun 27 12:08:16 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42C02192.3020400@utk.edu>
References: <42BAF1B7.10109@york.ac.uk> <42BB131A.2090403@utk.edu>
	<42BC298F.8000100@york.ac.uk> <42BC2F9E.20607@utk.edu>
	<42BFD95D.7070001@york.ac.uk> <42C02192.3020400@utk.edu>
Message-ID: <42C0265C.7070408@york.ac.uk>

Hi Stefan,
I've devised a far simpler way of getting what I want using a perl 
module called: WWW::Mechanize.
It simply gets the page source of a url which you can then parse the 
appropriate links to get the nucleotide accession number.
Thanks again,
Kat


use 
WWW::Mechanize;                                                                                                                           

my $mech = 
WWW::Mechanize->new();                                                                                                                            

                                                                                                                              

# THIS GETS THE HTML CONTENTS OF A WEBSITE
                                                                                                                              

my $url = 
"http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=protein&val=13488063";
$mech->get( $url 
);                                                                                                                             

print $mech->content();



Stefan Kirov wrote:

> Kat,
> In my experience works OK:
> 60 mendel /home/sao> perl test.pl
> seq is  NP_106261
> Feature source starts 1 ends 243 strand 1
> Feature count is 0
> count is 1
> GETS TO HERE WITH NO KEYS 3
> DOESN'T GET TO HERE
> Annotation db_xref stringified value Value: taxon:266835
> DOESN'T GET TO HERE
> Annotation strain stringified value Value: MAFF303099
> DOESN'T GET TO HERE
> Annotation organism stringified value Value: Mesorhizobium loti 
> MAFF303099
> Feature Protein starts 1 ends 243 strand 1
> Feature count is 0
> count is 2
> GETS TO HERE WITH NO KEYS 1
> DOESN'T GET TO HERE
> Annotation product stringified value Value: transcriptional regulator
> Feature CDS starts 1 ends 243 strand 1
> Feature count is 0
> count is 3
> GETS TO HERE WITH NO KEYS 4
> DOESN'T GET TO HERE
> Annotation locus_tag stringified value Value: mlr5637
> DOESN'T GET TO HERE
> Annotation db_xref stringified value Value: GeneID:1228922
> DOESN'T GET TO HERE
> Annotation coded_by stringified value Value: NC_002678.2:4529413..4530144
> DOESN'T GET TO HERE
> Annotation transl_table stringified value Value: 11
>
> What you need is
> Annotation coded_by stringified value Value: NC_002678.2:4529413..4530144
> What bioperl version are you using?
>
> Stefan
>
> Kat Hull wrote:
>
>> Hi Stefan,
>> I'm still having problems!
>> I get some features from the sequence object but can't get past this 
>> part in the code:
>>
>>  $ac=$feat->annotation();   # This is not returning anything.
>>
>> Could you look at the code to tell me where its going wrong?
>>
>> Thanks again,
>> #________________________________________
>> #!/biol/programs/perl580/bin/perl
>>                                                                                              
>>
>> use Bio::Annotation::Collection;
>> use Bio::DB::GenPept;
>> $gb = new Bio::DB::GenPept;
>>                                                                                              
>>
>>                                    my $seqio = 
>> $gb->get_Stream_by_id(['13474692']);
>> my $ac;
>> my $c;
>>                                                                                              
>>
>>  while( my $seq = $seqio->next_seq ) {
>>      print "seq is  ", $seq->display_id, "\n";
>>      my @f=$seq->get_all_SeqFeatures;     #This gives you the 
>> annotation of the retrieved sequence object
>>                                                                                              
>>
>>      foreach my $feat (@f) {
>>        ++$c;
>>       print "Feature ",$feat->primary_tag," starts ",$feat->start," 
>> ends ",
>>       $feat->end," strand ",$feat->strand,"\n";
>>                                                                                              
>>
>>       # features retain link to underlying sequence object
>>       #print "Feature sequence is ",$feat->seq->seq(),"\n";
>>                                                                                              
>>
>>        my $t = $feat->feature_count;
>>        print "Feature count is $t\n";
>>        print "count is $c\n";
>>                                                                                              
>>
>>        $ac=$feat->annotation();  #  PROBLEM SEEMS TO BE HERE
>>                                                                                              
>>
>>        my $blah=$ac->get_all_annotation_keys();
>>        print "GETS TO HERE WITH NO KEYS $blah\n";
>>                                                                                              
>>
>>           foreach $key ( $ac->get_all_annotation_keys() ) {
>>                print "DOESN'T GET TO HERE\n";
>>               @values = $ac->get_Annotations($key);
>>               foreach $value ( @values ) {
>>                # value is an Bio::AnnotationI, and defines a 
>> "as_text" method
>>                print "Annotation ",$key," stringified value 
>> ",$value->as_text,"\n";
>>                                                                                              
>>
>>                # also defined hash_tree method, which allows data 
>> orientated
>>                # access into this object
>>                $hash = $value->hash_tree();
>>               }
>>           }
>>                                                                                              
>>
>> # commented out for now          
>>                                                                                  
>>
>>   #    next unless ($ac->get_Annotations('coded_by'));
>>    #   my @coded=$ac->get_Annotations('coded_by');
>>     #  foreach my $location (@coded) {
>>      #   print $location->value, " is the location that codes this 
>> protein\n";
>>     #  }
>>      }
>>  }
>>
>>
>>
>>
>>
>> Stefan Kirov wrote:
>>
>>>   my $seqio = $gb->get_Stream_by_id(['13474692']);
>>>   while( my $seq = $seqio->next_seq ) {
>>>       print "seq is  ", $seq->display_id, "\n";
>>>       my $ann=$seq->annotation; #This gives you the annotation of 
>>> the retrieved sequence object
>>>      foreach my $dblink ($ann->get_Annotations('DBLink')) {
>>>          if ($dblink->database =~/refseq/i) {
>>>             print $database->primary_id, " is the mRNA accession 
>>> number\n";
>>>          }
>>>       }
>>>   }
>>> However, the gene you are looking at is not associated with any NM_ 
>>> sequence, but rather comes from NC_. Therefore the above will not 
>>> work for you. You will have to descend through the sequence features 
>>> and find teh feature that says 'coded_by':
>>> use Bio::DB::GenPept;
>>> my $gb=new Bio::DB::GenPept;
>>>  my $seqio = $gb->get_Stream_by_id(['13474692']);
>>>   while( my $seq = $seqio->next_seq ) {
>>>       print "seq is  ", $seq->display_id, "\n";
>>>       my @f=$seq->get_SeqFeatures; #This gives you the annotation of 
>>> the retrieved sequence object
>>>      foreach my $feat (@f) {
>>>        my $ann=$feat->annotation;
>>>        next unless ($ann->get_Annotations('coded_by'));
>>>        my @coded=$ann->get_Annotations('coded_by');
>>>        foreach my $location (@coded) {
>>>          print $location->value, " is the location that codes this 
>>> protein\n";
>>>        }
>>>       }
>>>   }
>>> No guarantees the code is typo free :-)
>>> Stefan
>>>
>>> Kat Hull wrote:
>>>
>>>> Hi Stefan,
>>>> Thanks for your advice but i'm still struggling!   I have used 
>>>> Bio::DB::GenPept to get the protein accession number given the 
>>>> protein gi number.  However, I don't understand how 
>>>> Bio::Annotation::DBLink works.  Does it fetch the url of a link on 
>>>> the web-site?   Basically, if I could use this (or something else) 
>>>> to get the url of the CDS link for my protein of interest, I can 
>>>> get the corresponding nucleotide accession from this, as it is 
>>>> encoded in the url.
>>>> Do you know how to use this module?  Is this what you were 
>>>> suggesting I try yesterday (I didn't really understand what you 
>>>> were getting at).
>>>> Many thanks,
>>>>
>>>> Kat
>>>>
>>>> ps. Here's where i'm at so far:
>>>>                                                                                                                                                                                    
>>>>
>>>> use Bio::Annotation::DBLink;
>>>> use Bio::DB::GenBank;
>>>> use Bio::DB::GenPept;
>>>>   $gb = new Bio::DB::GenPept;
>>>>                                                                                                                                                                                                                                                                                                                                                                                                                                                  
>>>>
>>>>    # given the gi number, this returns the accession
>>>>    my $seqio = $gb->get_Stream_by_id(['13474692']);
>>>>    while( my $seq = $seqio->next_seq ) {
>>>>        print "seq is  ", $seq->display_id, "\n";
>>>>    }
>>>>     # not sure what i'm doing here 
>>>>                                                                                                                                                                                                                                                                                                                                                               
>>>>
>>>>   $link2 = new Bio::Annotation::DBLink();
>>>>   $link2->database('dbSNP');
>>>>   $link2->primary_id('2367');
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> Stefan Kirov wrote:
>>>>
>>>>> Kat,
>>>>> If you are familiar with Bioperl it is kind of easy-
>>>>> look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on 
>>>>> how to get the protein record
>>>>> Go through the dblinks and find the appropriate accession number 
>>>>> (where the database method returns  GenBank).
>>>>> Then retrieve this accession number(s) through Bio::DB::GenBank. 
>>>>> If you are not familiar with Bioperl- read the docs for 
>>>>> Bio::DB::GenPept, Bio::DB::GenBank, Bio::Annotation and 
>>>>> Bio::Annotation::DBLink).
>>>>> Hope this helps,
>>>>> Stefan
>>>>>
>>>>> Kat Hull wrote:
>>>>>
>>>>>> Hi there,
>>>>>> I was wondering whether anyone has a solution to my problem. I 
>>>>>> have a list of protein assession numbers and want to retrieve the 
>>>>>> corresponding nucleotide sequences automatically.  I thought it 
>>>>>> would be possible to do this by changing the NCBI url, but this 
>>>>>> doesn't seem to be the case.
>>>>>> Is there a bio-perl module that can do this?
>>>>>>
>>>>>> Kind regards,
>>>>>> Kat
>>>>>>
>>>>>> _______________________________________________
>>>>>> Bioperl-l mailing list
>>>>>> Bioperl-l@portal.open-bio.org
>>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> Stefan
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>>
>>>
>>
>>
>


From hlapp at gmx.net  Mon Jun 27 12:17:49 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon Jun 27 12:09:18 2005
Subject: [Bioperl-l] Getting nucleotide seq from protein accession
In-Reply-To: <42BFD95D.7070001@york.ac.uk>
References: <42BAF1B7.10109@york.ac.uk>
	<42BB131A.2090403@utk.edu>	<42BC298F.8000100@york.ac.uk>
	<42BC2F9E.20607@utk.edu> <42BFD95D.7070001@york.ac.uk>
Message-ID: <ccd0cd1d038ba873706bd11f85794c69@gmx.net>

Features aren't getting their annotation bundles populated by the 
genbank/genpept parsers. Instead, the feature table tags end up as 
tag/value pairs, i.e., use $feature->get_all_tags() followed by 
get_tag_values() for each tag returned.

Alternatively, you can look at the features tag and annotation bundle 
as a single bundle using Bio::SeqFeature::AnnotationAdaptor:

use  Bio::SeqFeature::AnnotationAdaptor;
# ... code to obtain feature $feat here
my $ac = Bio::SeqFeature::AnnotationAdaptor->new(-feature => $feat);
# ... use $ac as you would any annotation collection

Hth,

	-hilmar

On Jun 27, 2005, at 6:47 AM, Kat Hull wrote:

> Hi Stefan,
> I'm still having problems!
> I get some features from the sequence object but can't get past this 
> part in the code:
>
>  $ac=$feat->annotation();   # This is not returning anything.
>
> Could you look at the code to tell me where its going wrong?
>
> Thanks again,
> #________________________________________
> #!/biol/programs/perl580/bin/perl
>
> use Bio::Annotation::Collection;
> use Bio::DB::GenPept;
> $gb = new Bio::DB::GenPept;
>
>                                    my $seqio = 
> $gb->get_Stream_by_id(['13474692']);
> my $ac;
> my $c;
>
>  while( my $seq = $seqio->next_seq ) {
>      print "seq is  ", $seq->display_id, "\n";
>      my @f=$seq->get_all_SeqFeatures;     #This gives you the 
> annotation of the retrieved sequence object
>
>      foreach my $feat (@f) {
>        ++$c;
>       print "Feature ",$feat->primary_tag," starts ",$feat->start," 
> ends ",
>       $feat->end," strand ",$feat->strand,"\n";
>
>       # features retain link to underlying sequence object
>       #print "Feature sequence is ",$feat->seq->seq(),"\n";
>
>        my $t = $feat->feature_count;
>        print "Feature count is $t\n";
>        print "count is $c\n";
>
>        $ac=$feat->annotation();  #  PROBLEM SEEMS TO BE HERE
>
>        my $blah=$ac->get_all_annotation_keys();
>        print "GETS TO HERE WITH NO KEYS $blah\n";
>
>           foreach $key ( $ac->get_all_annotation_keys() ) {
>                print "DOESN'T GET TO HERE\n";
>               @values = $ac->get_Annotations($key);
>               foreach $value ( @values ) {
>                # value is an Bio::AnnotationI, and defines a "as_text" 
> method
>                print "Annotation ",$key," stringified value 
> ",$value->as_text,"\n";
>
>                # also defined hash_tree method, which allows data 
> orientated
>                # access into this object
>                $hash = $value->hash_tree();
>               }
>           }
>
> # commented out for now
>   #    next unless ($ac->get_Annotations('coded_by'));
>    #   my @coded=$ac->get_Annotations('coded_by');
>     #  foreach my $location (@coded) {
>      #   print $location->value, " is the location that codes this 
> protein\n";
>     #  }
>      }
>  }
>
>
>
>
>
> Stefan Kirov wrote:
>
>>   my $seqio = $gb->get_Stream_by_id(['13474692']);
>>   while( my $seq = $seqio->next_seq ) {
>>       print "seq is  ", $seq->display_id, "\n";
>>       my $ann=$seq->annotation; #This gives you the annotation of the 
>> retrieved sequence object
>>      foreach my $dblink ($ann->get_Annotations('DBLink')) {
>>          if ($dblink->database =~/refseq/i) {
>>             print $database->primary_id, " is the mRNA accession 
>> number\n";
>>          }
>>       }
>>   }
>> However, the gene you are looking at is not associated with any NM_ 
>> sequence, but rather comes from NC_. Therefore the above will not 
>> work for you. You will have to descend through the sequence features 
>> and find teh feature that says 'coded_by':
>> use Bio::DB::GenPept;
>> my $gb=new Bio::DB::GenPept;
>>  my $seqio = $gb->get_Stream_by_id(['13474692']);
>>   while( my $seq = $seqio->next_seq ) {
>>       print "seq is  ", $seq->display_id, "\n";
>>       my @f=$seq->get_SeqFeatures; #This gives you the annotation of 
>> the retrieved sequence object
>>      foreach my $feat (@f) {
>>        my $ann=$feat->annotation;
>>        next unless ($ann->get_Annotations('coded_by'));
>>        my @coded=$ann->get_Annotations('coded_by');
>>        foreach my $location (@coded) {
>>          print $location->value, " is the location that codes this 
>> protein\n";
>>        }
>>       }
>>   }
>> No guarantees the code is typo free :-)
>> Stefan
>>
>> Kat Hull wrote:
>>
>>> Hi Stefan,
>>> Thanks for your advice but i'm still struggling!   I have used 
>>> Bio::DB::GenPept to get the protein accession number given the 
>>> protein gi number.  However, I don't understand how 
>>> Bio::Annotation::DBLink works.  Does it fetch the url of a link on 
>>> the web-site?   Basically, if I could use this (or something else) 
>>> to get the url of the CDS link for my protein of interest, I can get 
>>> the corresponding nucleotide accession from this, as it is encoded 
>>> in the url.
>>> Do you know how to use this module?  Is this what you were 
>>> suggesting I try yesterday (I didn't really understand what you were 
>>> getting at).
>>> Many thanks,
>>>
>>> Kat
>>>
>>> ps. Here's where i'm at so far:
>>>
>>> use Bio::Annotation::DBLink;
>>> use Bio::DB::GenBank;
>>> use Bio::DB::GenPept;
>>>   $gb = new Bio::DB::GenPept;
>>>
>>>    # given the gi number, this returns the accession
>>>    my $seqio = $gb->get_Stream_by_id(['13474692']);
>>>    while( my $seq = $seqio->next_seq ) {
>>>        print "seq is  ", $seq->display_id, "\n";
>>>    }
>>>     # not sure what i'm doing here
>>>   $link2 = new Bio::Annotation::DBLink();
>>>   $link2->database('dbSNP');
>>>   $link2->primary_id('2367');
>>>
>>>
>>>
>>>
>>>
>>> Stefan Kirov wrote:
>>>
>>>> Kat,
>>>> If you are familiar with Bioperl it is kind of easy-
>>>> look at Bio::DB::GenPept (I suppose you use GenPept/GenBank?) on 
>>>> how to get the protein record
>>>> Go through the dblinks and find the appropriate accession number 
>>>> (where the database method returns  GenBank).
>>>> Then retrieve this accession number(s) through Bio::DB::GenBank. If 
>>>> you are not familiar with Bioperl- read the docs for 
>>>> Bio::DB::GenPept, Bio::DB::GenBank, Bio::Annotation and 
>>>> Bio::Annotation::DBLink).
>>>> Hope this helps,
>>>> Stefan
>>>>
>>>> Kat Hull wrote:
>>>>
>>>>> Hi there,
>>>>> I was wondering whether anyone has a solution to my problem. I 
>>>>> have a list of protein assession numbers and want to retrieve the 
>>>>> corresponding nucleotide sequences automatically.  I thought it 
>>>>> would be possible to do this by changing the NCBI url, but this 
>>>>> doesn't seem to be the case.
>>>>> Is there a bio-perl module that can do this?
>>>>>
>>>>> Kind regards,
>>>>> Kat
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l@portal.open-bio.org
>>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> Stefan
>>>
>>>
>>>
>>>
>>>
>>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From skirov at utk.edu  Mon Jun 27 13:00:28 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Mon Jun 27 12:51:51 2005
Subject: [Bioperl-l] Bio::DB::CUTG behaving weird
In-Reply-To: <42C0059E.1050708@ed.ac.uk>
References: <42C0059E.1050708@ed.ac.uk>
Message-ID: <42C030AC.4000803@utk.edu>

Nailed it! SImple as compiling LWP/UserAgent with Get/Head/POST (last I 
believe not necessary, but...) enabled (disabled by default). UserAgent 
does not complain loudly these are used, but not available (LWP bug?). 
This may need to be in the docs, what do you think? All tests pass (have 
not tried the new ones, but will).
Stefan

Richard Adams wrote:

> Stefan,
> I'm looking into it although I don't have access to either of those  OSs.
> Does the test script (t/DBCUTG.t) run OK on both systems?
>
> I imagine the error is coming from  the fact that the parser is trying 
> to parse the mitochondrial table
> and I will try to sort out why that isn't parsing properly. Basically 
> all the DBCUTG module does to cope
> with a non-unique species is just select the  first in the list based 
> on regexp matching, this is usually the most likely choice.
>
>
> I'll put in some hopefully more challenging tests in the test script 
> to help find the bug. If you can run your script with
> $db->verbose(1) set (using the CVS version) and send me the output I 
> can look into it more...
>
> Best wishes,
>
> Richard
>
>

From allenday at ucla.edu  Mon Jun 27 14:26:30 2005
From: allenday at ucla.edu (Allen Day)
Date: Mon Jun 27 14:17:52 2005
Subject: [Bioperl-l] pubmed article download and storing in object
In-Reply-To: <BAY17-F7D08F7B2F3A98A082C9D98DEE0@phx.gbl>
References: <BAY17-F7D08F7B2F3A98A082C9D98DEE0@phx.gbl>
Message-ID: <Pine.LNX.4.58.0506271124110.9314@sumo.ctrl.ucla.edu>

try Bio::DB::Biblio::eutils.  it doesn't give back an object, but gives 
back an xml document.

to any volunteers out there looking for something to contribute: this
would be an easy place to jump in and add something useful to bioperl.  
you'd have a chance to learn a bit of pubmed query language and xml dom
api.

-allen

On Mon, 27 Jun 2005, Zack Napalm wrote:

> Hi,
> I am new at Bioperl and wondering whether there is a possibility to scrape 
> articles from PubMed automatically, and put them into an 
> Bio::Biblio::PubmedArticle object.
> I don't want to scrape them via LWP::Simple get and put them into an object 
> manually, if there is a appropriate function predefined.
> 
> regards
> johnny
> 
> _________________________________________________________________
> Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar mit 
> Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu! 
> http://desktop.msn.de/ Jetzt gratis downloaden!
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
From MEC at Stowers-Institute.org  Mon Jun 27 18:36:15 2005
From: MEC at Stowers-Institute.org (Cook, Malcolm)
Date: Mon Jun 27 18:27:34 2005
Subject: [Bioperl-l] HOWTO: fix the broken left margin in all HOWTO pdfs
	from http://bioperl.org/HOWTOs/
Message-ID: <200506272227.j5RMRQ77010799@portal.open-bio.org>

Cheers,

This article http://www.e-novative-forum.com/article21.htm suggests to
me that patching /bioperl-live/doc/howto/sgml/stylesheet/e-novative.xsl
as follows is in order

Line 367 (e-novative.xsl): 
- <xsl:param name="title.margin.left">0</xsl:param> 
+ <xsl:param name="title.margin.left">0cm</xsl:param> 

as it will fix the broken left margin in all the great HOWTO pdfs (which
print out lousy this way)!

Can someone prove this patch and if indeed this fixes problem is it
possible to release fixed pdfs (with good margins) at
http://bioperl.org/HOWTOs/

Thanks?

Regards,

Malcolm Cook - mec@stowers-institute.org - 816-926-4449
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, MO  USA 






From hlapp at gmx.net  Mon Jun 27 22:06:47 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Mon Jun 27 21:58:05 2005
Subject: [Bioperl-l] why string overload is bad
Message-ID: <53373dfd309aab36a69d08ff0b11cf97@gmx.net>

I've been debugging bioperl-db now for two days in a row to find all 
places that are affected by the string overload for the 
Bio::Annotation::* modules. There are many cases that break because a 
boolean evaluation of $obj is used as a shorthand for defined($obj) && 
ref($obj). One may argue that those cases deserve to be fixed anyway. 
BTW I'm also finding instances of this in the core bioperl library.

However, it gets uglier than this. Consider the following innocuous 
looking code.

use Bio::Annotation::SimpleValue;
my $a = Bio::Annotation::SimpleValue->new(-value => "");
%args = (-blah,$a);
my $ann = $args{-blah} || $args{-BLAH}; # ignore case
print "type of annotation: ", ref($ann),"\n";

This will print 'type of annotation:' and nothing else, because the || 
operator triggers the string overload, so all of a sudden $ann becomes 
a (empty) string instead of an object. So the correct way to express 
this is

my $ann = $args{-blah};
$ann = $args{-BLAH} unless defined($ann); # ignore case

I would argue that string-overloading core library classes requires a 
degree of discipline when programming against it that the library 
becomes pretty unforgiving.

Not really the spirit of how and for whom Bioperl should be useful. A 
beginner could have a pretty hard time tracking down the mistake above, 
let alone the frustration this can generate in the course of such an 
exercise.

Do people really want to go the route of string-overloading the 
annotation classes? To me it's really over the top and is a step 
backwards for ease of using the toolkit.

Comments, opinions anybody?

	-hilmar

-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------

From brian_osborne at cognia.com  Tue Jun 28 05:23:27 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Jun 28 05:15:55 2005
Subject: [Bioperl-l] HOWTO: fix the broken left margin in all HOWTO
	pdfs from http://bioperl.org/HOWTOs/
In-Reply-To: <200506272227.j5RMRQ77010799@portal.open-bio.org>
Message-ID: <BEE68F4F.2431%brian_osborne@cognia.com>

Malcolm,

Thank you for the tip, I've changed the XSL. Unfortunately I can't verify
the change at the moment, my new computer is docbook-deficent!

Brian O.


On 6/27/05 6:36 PM, "Cook, Malcolm" <MEC@stowers-institute.org> wrote:

> Cheers,
> 
> This article http://www.e-novative-forum.com/article21.htm suggests to
> me that patching /bioperl-live/doc/howto/sgml/stylesheet/e-novative.xsl
> as follows is in order
> 
> Line 367 (e-novative.xsl):
> - <xsl:param name="title.margin.left">0</xsl:param>
> + <xsl:param name="title.margin.left">0cm</xsl:param>
> 
> as it will fix the broken left margin in all the great HOWTO pdfs (which
> print out lousy this way)!
> 
> Can someone prove this patch and if indeed this fixes problem is it
> possible to release fixed pdfs (with good margins) at
> http://bioperl.org/HOWTOs/
> 
> Thanks?
> 
> Regards,
> 
> Malcolm Cook - mec@stowers-institute.org - 816-926-4449
> Database Applications Manager - Bioinformatics
> Stowers Institute for Medical Research - Kansas City, MO  USA
> 
> 
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From fetter_fake at hotmail.com  Tue Jun 28 09:09:12 2005
From: fetter_fake at hotmail.com (Zack Napalm)
Date: Tue Jun 28 09:00:32 2005
Subject: [Bioperl-l] pubmed article download and storing in object
In-Reply-To: <Pine.LNX.4.58.0506271124110.9314@sumo.ctrl.ucla.edu>
Message-ID: <BAY17-F188551B2A44A562AF875268DE10@phx.gbl>

how does this work exactly? the bioperl documentation seems very poor 
concerning structure and content.
i have tried the following easy piece of code:

my $biblio = new Bio::Biblio;
my $bibResult = $biblio->find('p53');
my $cit = $bibResult->get_next();
print "$_\n" for @{$cit};

just a lot of numbers in an array come back, but no xml file => if i try to 
print $cit directly, just byte[]=ARRAY(0x...) is printed

when i try to use Bio::DB::Biblio::eutils, the interpreter says, that this 
eutils.pm isn't installed. all moduls i use work properly, though. in the 
bioperl documentation is mentioned, that you shouldn't use this modul 
directly, but use it via my $biblio = new Bio::Biblio (-access => 
'eutils');, which doesn't work either (eutils.pm not installed again).

how can i get a proper xml file back? is there a nice bioperl documentation 
out there?

>From: Allen Day <allenday@ucla.edu>
>To: Zack Napalm <fetter_fake@hotmail.com>
>CC: bioperl-l@bioperl.org
>Subject: Re: [Bioperl-l] pubmed article download and storing in object
>Date: Mon, 27 Jun 2005 11:26:30 -0700 (PDT)
>
>try Bio::DB::Biblio::eutils.  it doesn't give back an object, but gives
>back an xml document.
>
>to any volunteers out there looking for something to contribute: this
>would be an easy place to jump in and add something useful to bioperl.
>you'd have a chance to learn a bit of pubmed query language and xml dom
>api.
>
>-allen
>
>On Mon, 27 Jun 2005, Zack Napalm wrote:
>
> > Hi,
> > I am new at Bioperl and wondering whether there is a possibility to 
>scrape
> > articles from PubMed automatically, and put them into an
> > Bio::Biblio::PubmedArticle object.
> > I don't want to scrape them via LWP::Simple get and put them into an 
>object
> > manually, if there is a appropriate function predefined.
> >
> > regards
> > johnny
> >
> > _________________________________________________________________
> > Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar mit
> > Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu!
> > http://desktop.msn.de/ Jetzt gratis downloaden!
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
> >
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

_________________________________________________________________
Die neue MSN Suche Toolbar mit Windows-Desktopsuche. Suchen Sie gleichzeitig 
im Web, Ihren E-Mails und auf Ihrem PC! Jetzt neu! http://desktop.msn.de/ 
Jetzt gratis downloaden!

From skirov at utk.edu  Tue Jun 28 09:44:07 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Tue Jun 28 09:35:21 2005
Subject: [Bioperl-l] why string overload is bad
In-Reply-To: <53373dfd309aab36a69d08ff0b11cf97@gmx.net>
References: <53373dfd309aab36a69d08ff0b11cf97@gmx.net>
Message-ID: <42C15427.6010706@utk.edu>


Hilmar Lapp wrote:

> I've been debugging bioperl-db now for two days in a row to find all 
> places that are affected by the string overload for the 
> Bio::Annotation::* modules. There are many cases that break because a 
> boolean evaluation of $obj is used as a shorthand for defined($obj) && 
> ref($obj). One may argue that those cases deserve to be fixed anyway. 
> BTW I'm also finding instances of this in the core bioperl library.
>
> However, it gets uglier than this. Consider the following innocuous 
> looking code.
>
> use Bio::Annotation::SimpleValue;
> my $a = Bio::Annotation::SimpleValue->new(-value => "");
> %args = (-blah,$a);
> my $ann = $args{-blah} || $args{-BLAH}; # ignore case
> print "type of annotation: ", ref($ann),"\n";
>
> This will print 'type of annotation:' and nothing else, because the || 
> operator triggers the string overload, so all of a sudden $ann becomes 
> a (empty) string instead of an object. So the correct way to express 
> this is
>
> my $ann = $args{-blah};
> $ann = $args{-BLAH} unless defined($ann); # ignore case
>
> I would argue that string-overloading core library classes requires a 
> degree of discipline when programming against it that the library 
> becomes pretty unforgiving.
>
> Not really the spirit of how and for whom Bioperl should be useful. A 
> beginner could have a pretty hard time tracking down the mistake 
> above, let alone the frustration this can generate in the course of 
> such an exercise.
>
> Do people really want to go the route of string-overloading the 
> annotation classes? To me it's really over the top and is a step 
> backwards for ease of using the toolkit.

Hilmar definitely has a point here. Overloading also causes trouble with 
respect to other code- take as an example Devel::ptkdb. Try to inspect a 
variable, that contains or is an object of type Bio::Annotation::*. Of 
course, one can always dump the data, but it is slower and this can be 
rather annoying if you just want to take a peek into something. And I 
have no doubt there would be other packages that fail because of the 
overloading.

>
> Comments, opinions anybody?
>
>     -hilmar
>

From birney at ebi.ac.uk  Tue Jun 28 09:56:39 2005
From: birney at ebi.ac.uk (Ewan Birney)
Date: Tue Jun 28 09:48:00 2005
Subject: [Bioperl-l] why string overload is bad
In-Reply-To: <42C15427.6010706@utk.edu>
References: <53373dfd309aab36a69d08ff0b11cf97@gmx.net>
	<42C15427.6010706@utk.edu>
Message-ID: <42C15717.9000900@ebi.ac.uk>



>> Not really the spirit of how and for whom Bioperl should be useful. A 
>> beginner could have a pretty hard time tracking down the mistake 
>> above, let alone the frustration this can generate in the course of 
>> such an exercise.
>>
>> Do people really want to go the route of string-overloading the 
>> annotation classes? To me it's really over the top and is a step 
>> backwards for ease of using the toolkit.
> 
> 
> Hilmar definitely has a point here. Overloading also causes trouble with 
> respect to other code- take as an example Devel::ptkdb. Try to inspect a 
> variable, that contains or is an object of type Bio::Annotation::*. Of 
> course, one can always dump the data, but it is slower and this can be 
> rather annoying if you just want to take a peek into something. And I 
> have no doubt there would be other packages that fail because of the 
> overloading.
> 

I have always been against string overloading. The subtly of the bugs
generated and non-obvious code paths (when Perl wants a number, does
it go via hte string-overloaded case...)


I also (personally) think overloading in C++ is bad. I just think overloading
is bad wherever.




>>
>> Comments, opinions anybody?
>>
>>     -hilmar
>>
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
From fetter_fake at hotmail.com  Tue Jun 28 10:38:44 2005
From: fetter_fake at hotmail.com (Zack Napalm)
Date: Tue Jun 28 10:30:09 2005
Subject: [Bioperl-l] pubmed article download and storing in object
In-Reply-To: <BAY17-F188551B2A44A562AF875268DE10@phx.gbl>
Message-ID: <BAY17-F6D806A69DFAE65FC19BAA8DE10@phx.gbl>

solution:
install bioperl 1.5 (instead of 1.4) and all works fine ;-)

>From: "Zack Napalm" <fetter_fake@hotmail.com>
>To: bioperl-l@bioperl.org
>Subject: Re: [Bioperl-l] pubmed article download and storing in object
>Date: Tue, 28 Jun 2005 13:09:12 +0000
>
>how does this work exactly? the bioperl documentation seems very poor 
>concerning structure and content.
>i have tried the following easy piece of code:
>
>my $biblio = new Bio::Biblio;
>my $bibResult = $biblio->find('p53');
>my $cit = $bibResult->get_next();
>print "$_\n" for @{$cit};
>
>just a lot of numbers in an array come back, but no xml file => if i try to 
>print $cit directly, just byte[]=ARRAY(0x...) is printed
>
>when i try to use Bio::DB::Biblio::eutils, the interpreter says, that this 
>eutils.pm isn't installed. all moduls i use work properly, though. in the 
>bioperl documentation is mentioned, that you shouldn't use this modul 
>directly, but use it via my $biblio = new Bio::Biblio (-access => 
>'eutils');, which doesn't work either (eutils.pm not installed again).
>
>how can i get a proper xml file back? is there a nice bioperl documentation 
>out there?
>
>>From: Allen Day <allenday@ucla.edu>
>>To: Zack Napalm <fetter_fake@hotmail.com>
>>CC: bioperl-l@bioperl.org
>>Subject: Re: [Bioperl-l] pubmed article download and storing in object
>>Date: Mon, 27 Jun 2005 11:26:30 -0700 (PDT)
>>
>>try Bio::DB::Biblio::eutils.  it doesn't give back an object, but gives
>>back an xml document.
>>
>>to any volunteers out there looking for something to contribute: this
>>would be an easy place to jump in and add something useful to bioperl.
>>you'd have a chance to learn a bit of pubmed query language and xml dom
>>api.
>>
>>-allen
>>
>>On Mon, 27 Jun 2005, Zack Napalm wrote:
>>
>> > Hi,
>> > I am new at Bioperl and wondering whether there is a possibility to 
>>scrape
>> > articles from PubMed automatically, and put them into an
>> > Bio::Biblio::PubmedArticle object.
>> > I don't want to scrape them via LWP::Simple get and put them into an 
>>object
>> > manually, if there is a appropriate function predefined.
>> >
>> > regards
>> > johnny
>> >
>> > _________________________________________________________________
>> > Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar 
>>mit
>> > Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu!
>> > http://desktop.msn.de/ Jetzt gratis downloaden!
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l@portal.open-bio.org
>> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >
>>_______________________________________________
>>Bioperl-l mailing list
>>Bioperl-l@portal.open-bio.org
>>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>_________________________________________________________________
>Die neue MSN Suche Toolbar mit Windows-Desktopsuche. Suchen Sie 
>gleichzeitig im Web, Ihren E-Mails und auf Ihrem PC! Jetzt neu! 
>http://desktop.msn.de/ Jetzt gratis downloaden!
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

_________________________________________________________________
Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar mit 
Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu! 
http://desktop.msn.de/ Jetzt gratis downloaden!

From michael.watson at bbsrc.ac.uk  Tue Jun 28 11:11:55 2005
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue Jun 28 11:03:14 2005
Subject: [Bioperl-l] Sequence trace as PNG image
Message-ID: <8975119BCD0AC5419D61A9CF1A923E950172D7D3@iahce2knas1.iah.bbsrc.reserved>

Hi

Has anyone contributed code to bioperl (or would be willing to
contribute it) that creates a PNG image of a sequence sequence trace
(SCF)?  I see that bioperl has a nice SequenceTrace object that could be
used, but I don't want to reinvent the wheel if it is already out
there...

Thanks
Mick

From anunberg at oriongenomics.com  Tue Jun 28 11:21:26 2005
From: anunberg at oriongenomics.com (Andrew Nunberg)
Date: Tue Jun 28 11:12:44 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
Message-ID: <BEE6D526.6953%anunberg@oriongenomics.com>

I was wondering if there is any documentation about using GFF3 format with
Gbrowse.  Since this is the "new" format, I wanted to start using it, but
observing some behaviors.

The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
the Name tag is the id to be displayed and the ID tag is unique and
internal, however when I use Gbrowse 1.62 it is ID that is being displayed
as the label.

I wish to use processed_transcript aggregator, the GFF3 document indicates
you only need to  display the exons and CDS and the UTRs will be inferred,
however I did not see that when  viewed in Gbrowse.

If there is some extra code or documentation I need please let me know

Thanks
Andy
-- 
Andrew Nunberg
Bioinformagician
Orion Genomics
(314)-615-6989
www.oriongenomics.com


From brian_osborne at cognia.com  Tue Jun 28 12:24:42 2005
From: brian_osborne at cognia.com (Brian Osborne)
Date: Tue Jun 28 12:16:00 2005
Subject: [Bioperl-l] pubmed article download and storing in object
In-Reply-To: <BAY17-F188551B2A44A562AF875268DE10@phx.gbl>
Message-ID: <BEE6F20A.2471%brian_osborne@cognia.com>

Zack,

There are *some* examples in the examples/biblio/biblio_examples.pl script.
If you come up with some more please send them our way, I can add them.

Do  you have XML::Twig installed? If not that could explain the error using
"eutils".


Brian O.


On 6/28/05 9:09 AM, "Zack Napalm" <fetter_fake@hotmail.com> wrote:

> how does this work exactly? the bioperl documentation seems very poor
> concerning structure and content.
> i have tried the following easy piece of code:
> 
> my $biblio = new Bio::Biblio;
> my $bibResult = $biblio->find('p53');
> my $cit = $bibResult->get_next();
> print "$_\n" for @{$cit};
> 
> just a lot of numbers in an array come back, but no xml file => if i try to
> print $cit directly, just byte[]=ARRAY(0x...) is printed
> 
> when i try to use Bio::DB::Biblio::eutils, the interpreter says, that this
> eutils.pm isn't installed. all moduls i use work properly, though. in the
> bioperl documentation is mentioned, that you shouldn't use this modul
> directly, but use it via my $biblio = new Bio::Biblio (-access =>
> 'eutils');, which doesn't work either (eutils.pm not installed again).
> 
> how can i get a proper xml file back? is there a nice bioperl documentation
> out there?
> 
>> From: Allen Day <allenday@ucla.edu>
>> To: Zack Napalm <fetter_fake@hotmail.com>
>> CC: bioperl-l@bioperl.org
>> Subject: Re: [Bioperl-l] pubmed article download and storing in object
>> Date: Mon, 27 Jun 2005 11:26:30 -0700 (PDT)
>> 
>> try Bio::DB::Biblio::eutils.  it doesn't give back an object, but gives
>> back an xml document.
>> 
>> to any volunteers out there looking for something to contribute: this
>> would be an easy place to jump in and add something useful to bioperl.
>> you'd have a chance to learn a bit of pubmed query language and xml dom
>> api.
>> 
>> -allen
>> 
>> On Mon, 27 Jun 2005, Zack Napalm wrote:
>> 
>>> Hi,
>>> I am new at Bioperl and wondering whether there is a possibility to
>> scrape
>>> articles from PubMed automatically, and put them into an
>>> Bio::Biblio::PubmedArticle object.
>>> I don't want to scrape them via LWP::Simple get and put them into an
>> object
>>> manually, if there is a appropriate function predefined.
>>> 
>>> regards
>>> johnny
>>> 
>>> _________________________________________________________________
>>> Sie suchen E-Mails, Dokumente oder Fotos? Die neue MSN Suche Toolbar mit
>>> Windows-Desktopsuche liefert in sekundenschnelle Ergebnisse. Jetzt neu!
>>> http://desktop.msn.de/ Jetzt gratis downloaden!
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l@portal.open-bio.org
>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@portal.open-bio.org
>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
> _________________________________________________________________
> Die neue MSN Suche Toolbar mit Windows-Desktopsuche. Suchen Sie gleichzeitig
> im Web, Ihren E-Mails und auf Ihrem PC! Jetzt neu! http://desktop.msn.de/
> Jetzt gratis downloaden!
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l


From lstein at cshl.edu  Tue Jun 28 13:24:42 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Tue Jun 28 13:16:13 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <BEE6D526.6953%anunberg@oriongenomics.com>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
Message-ID: <200506281324.42717.lstein@cshl.edu>

The bioperl GFF database (both the inmemory and relational database versions) 
need to be brought up to date to handle the full expressive powerof GFF3. So 
for the time being ID trumps Name. Also you must use the so_transcript 
aggregator instead of the processed_transcript aggregator.

Lincoln

On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> I was wondering if there is any documentation about using GFF3 format with
> Gbrowse.  Since this is the "new" format, I wanted to start using it, but
> observing some behaviors.
>
> The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
> the Name tag is the id to be displayed and the ID tag is unique and
> internal, however when I use Gbrowse 1.62 it is ID that is being displayed
> as the label.
>
> I wish to use processed_transcript aggregator, the GFF3 document indicates
> you only need to  display the exons and CDS and the UTRs will be inferred,
> however I did not see that when  viewed in Gbrowse.
>
> If there is some extra code or documentation I need please let me know
>
> Thanks
> Andy

-- 
Lincoln Stein
lstein@cshl.edu
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
From lstein at cshl.edu  Tue Jun 28 13:24:42 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Tue Jun 28 13:16:15 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <BEE6D526.6953%anunberg@oriongenomics.com>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
Message-ID: <200506281324.42717.lstein@cshl.edu>

The bioperl GFF database (both the inmemory and relational database versions) 
need to be brought up to date to handle the full expressive powerof GFF3. So 
for the time being ID trumps Name. Also you must use the so_transcript 
aggregator instead of the processed_transcript aggregator.

Lincoln

On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> I was wondering if there is any documentation about using GFF3 format with
> Gbrowse.  Since this is the "new" format, I wanted to start using it, but
> observing some behaviors.
>
> The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
> the Name tag is the id to be displayed and the ID tag is unique and
> internal, however when I use Gbrowse 1.62 it is ID that is being displayed
> as the label.
>
> I wish to use processed_transcript aggregator, the GFF3 document indicates
> you only need to  display the exons and CDS and the UTRs will be inferred,
> however I did not see that when  viewed in Gbrowse.
>
> If there is some extra code or documentation I need please let me know
>
> Thanks
> Andy

-- 
Lincoln Stein
lstein@cshl.edu
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
From cain at cshl.edu  Tue Jun 28 13:58:42 2005
From: cain at cshl.edu (Scott Cain)
Date: Tue Jun 28 13:49:57 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <200506281324.42717.lstein@cshl.edu>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
Message-ID: <1119981522.3365.34.camel@localhost.localdomain>

Though you can always use a callback on the label to get the Name
instead:

label   = sub {
            my $f = shift;
            my ($name) = $f->attributes('Name');
            return $name;
        }

On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> The bioperl GFF database (both the inmemory and relational database versions) 
> need to be brought up to date to handle the full expressive powerof GFF3. So 
> for the time being ID trumps Name. Also you must use the so_transcript 
> aggregator instead of the processed_transcript aggregator.
> 
> Lincoln
> 
> On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > I was wondering if there is any documentation about using GFF3 format with
> > Gbrowse.  Since this is the "new" format, I wanted to start using it, but
> > observing some behaviors.
> >
> > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
> > the Name tag is the id to be displayed and the ID tag is unique and
> > internal, however when I use Gbrowse 1.62 it is ID that is being displayed
> > as the label.
> >
> > I wish to use processed_transcript aggregator, the GFF3 document indicates
> > you only need to  display the exons and CDS and the UTRs will be inferred,
> > however I did not see that when  viewed in Gbrowse.
> >
> > If there is some extra code or documentation I need please let me know
> >
> > Thanks
> > Andy
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From MEC at Stowers-Institute.org  Tue Jun 28 14:01:29 2005
From: MEC at Stowers-Institute.org (Cook, Malcolm)
Date: Tue Jun 28 13:52:48 2005
Subject: [Bioperl-l] HOWTO: fix the broken left margin in all HOWTO pdfs
	from http://bioperl.org/HOWTOs/
Message-ID: <200506281752.j5SHqhPB030988@portal.open-bio.org>

Thanks Brian,

Though I have privs to commit, I was loath to go there without being
able to conduct test on pdf generation myself.

I'd appreciate a heads up if/when this is tested and new pdfs posted.

Cheers,

Malcolm

-----Original Message-----
From: Brian Osborne [mailto:brian_osborne@cognia.com] 
Sent: Tuesday, June 28, 2005 4:23 AM
To: Cook, Malcolm; bioperl-l
Subject: Re: [Bioperl-l] HOWTO: fix the broken left margin in all HOWTO
pdfs from http://bioperl.org/HOWTOs/


Malcolm,

Thank you for the tip, I've changed the XSL. Unfortunately I can't
verify
the change at the moment, my new computer is docbook-deficent!

Brian O.


On 6/27/05 6:36 PM, "Cook, Malcolm" <MEC@stowers-institute.org> wrote:

> Cheers,
> 
> This article http://www.e-novative-forum.com/article21.htm suggests to
> me that patching
/bioperl-live/doc/howto/sgml/stylesheet/e-novative.xsl
> as follows is in order
> 
> Line 367 (e-novative.xsl):
> - <xsl:param name="title.margin.left">0</xsl:param>
> + <xsl:param name="title.margin.left">0cm</xsl:param>
> 
> as it will fix the broken left margin in all the great HOWTO pdfs
(which
> print out lousy this way)!
> 
> Can someone prove this patch and if indeed this fixes problem is it
> possible to release fixed pdfs (with good margins) at
> http://bioperl.org/HOWTOs/
> 
> Thanks?
> 
> Regards,
> 
> Malcolm Cook - mec@stowers-institute.org - 816-926-4449
> Database Applications Manager - Bioinformatics
> Stowers Institute for Medical Research - Kansas City, MO  USA
> 
> 
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l



From cain at cshl.edu  Tue Jun 28 15:44:10 2005
From: cain at cshl.edu (Scott Cain)
Date: Tue Jun 28 15:35:25 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <200506281324.42717.lstein@cshl.edu>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
Message-ID: <1119987851.3365.46.camel@localhost.localdomain>

Lincoln,

This is the first I've heard of the so_transcript aggregator; have you
committed it anywhere?

Scott

On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> The bioperl GFF database (both the inmemory and relational database versions) 
> need to be brought up to date to handle the full expressive powerof GFF3. So 
> for the time being ID trumps Name. Also you must use the so_transcript 
> aggregator instead of the processed_transcript aggregator.
> 
> Lincoln
> 
> On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > I was wondering if there is any documentation about using GFF3 format with
> > Gbrowse.  Since this is the "new" format, I wanted to start using it, but
> > observing some behaviors.
> >
> > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
> > the Name tag is the id to be displayed and the ID tag is unique and
> > internal, however when I use Gbrowse 1.62 it is ID that is being displayed
> > as the label.
> >
> > I wish to use processed_transcript aggregator, the GFF3 document indicates
> > you only need to  display the exons and CDS and the UTRs will be inferred,
> > however I did not see that when  viewed in Gbrowse.
> >
> > If there is some extra code or documentation I need please let me know
> >
> > Thanks
> > Andy
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From cain at cshl.edu  Tue Jun 28 15:44:10 2005
From: cain at cshl.edu (Scott Cain)
Date: Tue Jun 28 15:35:33 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <200506281324.42717.lstein@cshl.edu>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
Message-ID: <1119987851.3365.46.camel@localhost.localdomain>

Lincoln,

This is the first I've heard of the so_transcript aggregator; have you
committed it anywhere?

Scott

On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> The bioperl GFF database (both the inmemory and relational database versions) 
> need to be brought up to date to handle the full expressive powerof GFF3. So 
> for the time being ID trumps Name. Also you must use the so_transcript 
> aggregator instead of the processed_transcript aggregator.
> 
> Lincoln
> 
> On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > I was wondering if there is any documentation about using GFF3 format with
> > Gbrowse.  Since this is the "new" format, I wanted to start using it, but
> > observing some behaviors.
> >
> > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml indicates
> > the Name tag is the id to be displayed and the ID tag is unique and
> > internal, however when I use Gbrowse 1.62 it is ID that is being displayed
> > as the label.
> >
> > I wish to use processed_transcript aggregator, the GFF3 document indicates
> > you only need to  display the exons and CDS and the UTRs will be inferred,
> > however I did not see that when  viewed in Gbrowse.
> >
> > If there is some extra code or documentation I need please let me know
> >
> > Thanks
> > Andy
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From lstein at cshl.edu  Tue Jun 28 16:54:34 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Tue Jun 28 16:45:51 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <1119987851.3365.46.camel@localhost.localdomain>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
	<1119987851.3365.46.camel@localhost.localdomain>
Message-ID: <200506281654.35206.lstein@cshl.edu>

It's in bioperl CVS. A copy is also in the gbrowse CVS which will be installed 
if it detects an old version of bioperl.

Lincoln

On Tuesday 28 June 2005 03:44 pm, Scott Cain wrote:
> Lincoln,
>
> This is the first I've heard of the so_transcript aggregator; have you
> committed it anywhere?
>
> Scott
>
> On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> > The bioperl GFF database (both the inmemory and relational database
> > versions) need to be brought up to date to handle the full expressive
> > powerof GFF3. So for the time being ID trumps Name. Also you must use the
> > so_transcript aggregator instead of the processed_transcript aggregator.
> >
> > Lincoln
> >
> > On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > > I was wondering if there is any documentation about using GFF3 format
> > > with Gbrowse.  Since this is the "new" format, I wanted to start using
> > > it, but observing some behaviors.
> > >
> > > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml
> > > indicates the Name tag is the id to be displayed and the ID tag is
> > > unique and internal, however when I use Gbrowse 1.62 it is ID that is
> > > being displayed as the label.
> > >
> > > I wish to use processed_transcript aggregator, the GFF3 document
> > > indicates you only need to  display the exons and CDS and the UTRs will
> > > be inferred, however I did not see that when  viewed in Gbrowse.
> > >
> > > If there is some extra code or documentation I need please let me know
> > >
> > > Thanks
> > > Andy

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From lstein at cshl.edu  Tue Jun 28 16:54:34 2005
From: lstein at cshl.edu (Lincoln Stein)
Date: Tue Jun 28 16:45:56 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <1119987851.3365.46.camel@localhost.localdomain>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
	<1119987851.3365.46.camel@localhost.localdomain>
Message-ID: <200506281654.35206.lstein@cshl.edu>

It's in bioperl CVS. A copy is also in the gbrowse CVS which will be installed 
if it detects an old version of bioperl.

Lincoln

On Tuesday 28 June 2005 03:44 pm, Scott Cain wrote:
> Lincoln,
>
> This is the first I've heard of the so_transcript aggregator; have you
> committed it anywhere?
>
> Scott
>
> On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> > The bioperl GFF database (both the inmemory and relational database
> > versions) need to be brought up to date to handle the full expressive
> > powerof GFF3. So for the time being ID trumps Name. Also you must use the
> > so_transcript aggregator instead of the processed_transcript aggregator.
> >
> > Lincoln
> >
> > On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > > I was wondering if there is any documentation about using GFF3 format
> > > with Gbrowse.  Since this is the "new" format, I wanted to start using
> > > it, but observing some behaviors.
> > >
> > > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml
> > > indicates the Name tag is the id to be displayed and the ID tag is
> > > unique and internal, however when I use Gbrowse 1.62 it is ID that is
> > > being displayed as the label.
> > >
> > > I wish to use processed_transcript aggregator, the GFF3 document
> > > indicates you only need to  display the exons and CDS and the UTRs will
> > > be inferred, however I did not see that when  viewed in Gbrowse.
> > >
> > > If there is some extra code or documentation I need please let me know
> > >
> > > Thanks
> > > Andy

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
From cain at cshl.edu  Tue Jun 28 16:59:08 2005
From: cain at cshl.edu (Scott Cain)
Date: Tue Jun 28 16:50:20 2005
Subject: [Bioperl-l] GFF3 and Gbrowse
In-Reply-To: <200506281654.35206.lstein@cshl.edu>
References: <BEE6D526.6953%anunberg@oriongenomics.com>
	<200506281324.42717.lstein@cshl.edu>
	<1119987851.3365.46.camel@localhost.localdomain>
	<200506281654.35206.lstein@cshl.edu>
Message-ID: <1119992348.3365.54.camel@localhost.localdomain>

Lincoln,

I hate to be a pain, but it is not in bioperl-live/Bio/DB/GFF/Aggregator
(updated just now).  Is it somewhere less obvious, or did you not cvs
add it?

Thanks,
Scott



On Tue, 2005-06-28 at 16:54 -0400, Lincoln Stein wrote:
> It's in bioperl CVS. A copy is also in the gbrowse CVS which will be installed 
> if it detects an old version of bioperl.
> 
> Lincoln
> 
> On Tuesday 28 June 2005 03:44 pm, Scott Cain wrote:
> > Lincoln,
> >
> > This is the first I've heard of the so_transcript aggregator; have you
> > committed it anywhere?
> >
> > Scott
> >
> > On Tue, 2005-06-28 at 13:24 -0400, Lincoln Stein wrote:
> > > The bioperl GFF database (both the inmemory and relational database
> > > versions) need to be brought up to date to handle the full expressive
> > > powerof GFF3. So for the time being ID trumps Name. Also you must use the
> > > so_transcript aggregator instead of the processed_transcript aggregator.
> > >
> > > Lincoln
> > >
> > > On Tuesday 28 June 2005 11:21 am, Andrew Nunberg wrote:
> > > > I was wondering if there is any documentation about using GFF3 format
> > > > with Gbrowse.  Since this is the "new" format, I wanted to start using
> > > > it, but observing some behaviors.
> > > >
> > > > The GFF3 documentation on http://song.sourceforge.net/gff3.shtml
> > > > indicates the Name tag is the id to be displayed and the ID tag is
> > > > unique and internal, however when I use Gbrowse 1.62 it is ID that is
> > > > being displayed as the label.
> > > >
> > > > I wish to use processed_transcript aggregator, the GFF3 document
> > > > indicates you only need to  display the exons and CDS and the UTRs will
> > > > be inferred, however I did not see that when  viewed in Gbrowse.
> > > >
> > > > If there is some extra code or documentation I need please let me know
> > > >
> > > > Thanks
> > > > Andy
> 
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain@cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory

From bioinfovijayaraj at yahoo.com  Wed Jun 29 03:19:47 2005
From: bioinfovijayaraj at yahoo.com (vijayaraj nagarajan)
Date: Wed Jun 29 03:11:05 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
Message-ID: <20050629071947.38624.qmail@web53608.mail.yahoo.com>

hi
i have a cluster file with contents like this:

1 2 5 7 8 11
2 5 7 8 11 
3 13 17 19
4 21 45 67
5 7 8 11

Now the 1,2 and 5th lines are redundant. i need to
remove the 2nd and 5th line from the file, while
retaining only the first line, since the first line
contains all the members present in 2 and 5th line...

could anyone suggest me how to parse this file, to
remove such redundant lines using perl.
any help and suggestions in this regard would be
greatly appreciated.

thanks 

vijayaraj nagarajan
research assistant
the university of southern mississippi
ms, usa 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From heikki at ebi.ac.uk  Wed Jun 29 05:00:38 2005
From: heikki at ebi.ac.uk (Heikki Lehvaslaiho)
Date: Wed Jun 29 04:51:42 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
In-Reply-To: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
References: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
Message-ID: <200506291000.38963.heikki@ebi.ac.uk>

Vijayraj,

Your probelm in mathematical terms is comparing sets. 

In pseudocode:

parse first line, create a set, write the line
add set to an array
for each subsequent line {
    parse the line, create a set
    for each old set in the array {
        if this set is a subset of the old set {
           next line
        }
    }
    # if we are here, we have not seen the set before
    add set to an array, write the line
}

the output will contain the unique lines only.

There are a lot of modules in CPAN that can do the algebra for you. One of 
them is Set::Scalar: http://search.cpan.org/~jhi/Set-Scalar-1.19/


Yours,
 -Heikki

On Wednesday 29 June 2005 08:19, vijayaraj nagarajan wrote:
> hi
> i have a cluster file with contents like this:
>
> 1 2 5 7 8 11
> 2 5 7 8 11
> 3 13 17 19
> 4 21 45 67
> 5 7 8 11
>
> Now the 1,2 and 5th lines are redundant. i need to
> remove the 2nd and 5th line from the file, while
> retaining only the first line, since the first line
> contains all the members present in 2 and 5th line...
>
> could anyone suggest me how to parse this file, to
> remove such redundant lines using perl.
> any help and suggestions in this regard would be
> greatly appreciated.
>
> thanks
>
> vijayaraj nagarajan
> research assistant
> the university of southern mississippi
> ms, usa
>
>
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________
From heikki at ebi.ac.uk  Wed Jun 29 05:20:40 2005
From: heikki at ebi.ac.uk (Heikki Lehvaslaiho)
Date: Wed Jun 29 05:12:49 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
In-Reply-To: <200506291000.38963.heikki@ebi.ac.uk>
References: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
	<200506291000.38963.heikki@ebi.ac.uk>
Message-ID: <200506291020.40561.heikki@ebi.ac.uk>


... and if your set are not in decreasing order, you can not print them out 
immediately, bit you have to store them in a hash and test if the new set is 
a superset or a subset of each existing set, and remove and add sets in the 
hash accordingly - and print the hash elements in the end.

 -Heikki

On Wednesday 29 June 2005 10:00, Heikki Lehvaslaiho wrote:
> Vijayraj,
>
> Your probelm in mathematical terms is comparing sets.
>
> In pseudocode:
>
> parse first line, create a set, write the line
> add set to an array
> for each subsequent line {
>     parse the line, create a set
>     for each old set in the array {
>         if this set is a subset of the old set {
>            next line
>         }
>     }
>     # if we are here, we have not seen the set before
>     add set to an array, write the line
> }
>
> the output will contain the unique lines only.
>
> There are a lot of modules in CPAN that can do the algebra for you. One of
> them is Set::Scalar: http://search.cpan.org/~jhi/Set-Scalar-1.19/
>
>
> Yours,
>  -Heikki
>
> On Wednesday 29 June 2005 08:19, vijayaraj nagarajan wrote:
> > hi
> > i have a cluster file with contents like this:
> >
> > 1 2 5 7 8 11
> > 2 5 7 8 11
> > 3 13 17 19
> > 4 21 45 67
> > 5 7 8 11
> >
> > Now the 1,2 and 5th lines are redundant. i need to
> > remove the 2nd and 5th line from the file, while
> > retaining only the first line, since the first line
> > contains all the members present in 2 and 5th line...
> >
> > could anyone suggest me how to parse this file, to
> > remove such redundant lines using perl.
> > any help and suggestions in this regard would be
> > greatly appreciated.
> >
> > thanks
> >
> > vijayaraj nagarajan
> > research assistant
> > the university of southern mississippi
> > ms, usa
> >
> >
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam protection around
> > http://mail.yahoo.com
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@portal.open-bio.org
> > http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________
From tcj25 at cam.ac.uk  Wed Jun 29 05:32:09 2005
From: tcj25 at cam.ac.uk (Terry Jones)
Date: Wed Jun 29 05:24:09 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
In-Reply-To: Your message at 00:19:47 on Wednesday, 29 June 2005
References: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
Message-ID: <17090.27289.678948.95804@terry.jones.tc>

>>>>> "vijayaraj" == vijayaraj nagarajan <bioinfovijayaraj@yahoo.com> writes:
vijayaraj> i have a cluster file with contents like this:

vijayaraj> 1 2 5 7 8 11
vijayaraj> 2 5 7 8 11 
vijayaraj> 3 13 17 19
vijayaraj> 4 21 45 67
vijayaraj> 5 7 8 11

vijayaraj> Now the 1,2 and 5th lines are redundant. i need to
vijayaraj> remove the 2nd and 5th line from the file, while
vijayaraj> retaining only the first line, since the first line
vijayaraj> contains all the members present in 2 and 5th line...

Are there any constraints on your data that might help solve this?

For example, do the numbers always have exactly one space between
them? Do the numbers always appear in ascending order? Is there ever
any trailing whitespace on a line (there was a space at the end of
your second line).

If the answers to the above are yes, yes, and no, then the following
works. If not, you'll need to do a little more to canonicalize each
line (e.g., strip spaces, sort the numbers, etc).

#!/usr/bin/perl -w

use strict;
my @lines;

while (my $line = <>){
    next if grep /\Q$line\E/, @lines;
    push @lines, $line;
    print $line;
}


or if you feel like being obscure today, you can do it straight from
the command line:

  perl -ne '$l = $_; push(@lines, $l), print($l) unless grep /\Q$l\E/, @lines' < data

Terry
From tcj25 at cam.ac.uk  Wed Jun 29 06:30:28 2005
From: tcj25 at cam.ac.uk (Terry Jones)
Date: Wed Jun 29 06:24:00 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
In-Reply-To: Your message at 11:32:09 on Wednesday, 29 June 2005
References: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
	<17090.27289.678948.95804@terry.jones.tc>
Message-ID: <17090.30788.631518.157296@terry.jones.tc>

Oops......  I wrote the following rubbish:

| Are there any constraints on your data that might help solve this?
| 
| For example, do the numbers always have exactly one space between
| them? Do the numbers always appear in ascending order? Is there ever
| any trailing whitespace on a line (there was a space at the end of
| your second line).
| 
| If the answers to the above are yes, yes, and no, then the following
| works. If not, you'll need to do a little more to canonicalize each
| line (e.g., strip spaces, sort the numbers, etc).
|
| [Incriminating / embarrassing perl deleted]

My code has at least two serious errors: 1) as Heikki points out, you
can't output anything until you've read all the data, and 2) it will
give spurious matches in input cases like this

  23 45 67
   3 45

I hereby disown my earlier posting. You should follow Heikki's advice
and use sets.

Terry
From tcj25 at cam.ac.uk  Wed Jun 29 07:16:28 2005
From: tcj25 at cam.ac.uk (Terry Jones)
Date: Wed Jun 29 07:07:52 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines
In-Reply-To: Your message at 11:32:09 on Wednesday, 29 June 2005
References: <20050629071947.38624.qmail@web53608.mail.yahoo.com>
	<17090.27289.678948.95804@terry.jones.tc>
Message-ID: <17090.33548.689475.727979@terry.jones.tc>

>>>>> "vijayaraj" == vijayaraj nagarajan <bioinfovijayaraj@yahoo.com> writes:
vijayaraj> i have a cluster file with contents like this:

vijayaraj> 1 2 5 7 8 11
vijayaraj> 2 5 7 8 11 
vijayaraj> 3 13 17 19
vijayaraj> 4 21 45 67
vijayaraj> 5 7 8 11

vijayaraj> Now the 1,2 and 5th lines are redundant. i need to
vijayaraj> remove the 2nd and 5th line from the file, while
vijayaraj> retaining only the first line, since the first line
vijayaraj> contains all the members present in 2 and 5th line...

Here's something much better. It tries to be somewhat efficient.

Terry


#!/usr/bin/perl -w

use strict;
my @lines;

while (<>){
	my @nums = split;
	my $nums = {};
	map { $nums->{$_} = undef } @nums;
	push @lines, [ $nums, scalar(@nums) ];
}

my @sorted = sort { $lines[$b]->[1] <=> $lines[$a]->[1] } 0 .. $#lines;

for (my $i = 0; $i < @lines; $i++){
	print join(' ', sort { $a <=> $b } keys %{$lines[$sorted[$i]]->[0]}), "\n" unless match($i);
}

sub match {
	my $index = shift;
	my $target_set = $lines[$sorted[$index]]->[0];

	for (my $i = 0; $i < $index; $i++){
		my $is_subset = 1;
		my $bigger_set = $lines[$sorted[$i]]->[0];
		for my $element (keys %$target_set){
			unless (exists $bigger_set->{$element}){
				$is_subset = 0;
				last;
			}
		}
		return 1 if $is_subset;
	}
}

exit(0);
From MEC at Stowers-Institute.org  Wed Jun 29 15:40:38 2005
From: MEC at Stowers-Institute.org (Cook, Malcolm)
Date: Wed Jun 29 15:32:20 2005
Subject: [Bioperl-l] Alternate hit sorting for Bio::Search::Result objects
Message-ID: <200506291931.j5TJVmPB026792@portal.open-bio.org>

Hi,

To re-raise a thread that was under discussion in Dec 2003
http://portal.open-bio.org/pipermail/bioperl-l/2003-December/014416.html
...

In service of a particular analysis, I am trying to programmatically
'edit' a Bio::Search::Result::BlastResult by filtering and sorting the
hits in a variety of ways prior to writing it back out (once for each
way).

I first tried breaking the interface (as suggested by Jason in Dec 03)
by directly setting `$myResult->{'_hits'}`.

However, as Jason further suggested, it _is_ prone to problems.  I don't
know if it would have worked in Dec 2003, but it does not work now (for
blast reports at least).

As I discovered, B::S::R::BlastResult overrides
B::S::R::GenericResult->hits to accommodate tracking iterations such as
reported by psiblast.  It does this for all blast outputs, including
flavors that don't iterate (`blastall -p blastx ` in my case).

Thus I found that to break the interface, I had to do the following
   $myResult->{_iterations}[0]->{_newhits_below_threshold} =
\@sortedFilteredAndOtherwiseMungedHits;

This works but is ugly and probably even more prone to (future?)
problems.

My question is, what to do in general.

Options:

	1) use the -filter capability of
Bio::SearchIO::Writer::ResultTableWriter in combination with
Bio::Search::Result::ResultI->sort_hits
	2) write an API for resetting hits
	3) continue to live dangerously by setting
$myResult->{_iterations}[0]->{_newhits_below_threshold}
		
In either case, it _may_ make sense to not track hits by iteration
unless necessary by having the Result $rc created in
Bio::SearchIO::blast set _no_iterations to 1 unless the report is
psiblast (or other iteration producer).

I don't really like option 1 due to all the objects and levels of
indirection just to grep/sort a list of hits but it might work fine...

Thoughts ...suggestions ...advice ...admonitions all appreciated

Regards,

Malcolm Cook - mec@stowers-institute.org - 816-926-4449
Database Applications Manager - Bioinformatics
Stowers Institute for Medical Research - Kansas City, MO  USA 




From julipao at terra.es  Wed Jun 29 20:26:15 2005
From: julipao at terra.es (=?ISO-8859-1?Q?Julio_Fern=E1ndez_Banet?=)
Date: Wed Jun 29 20:17:39 2005
Subject: [Bioperl-l] Help on module for the analysis of sequence alignment
Message-ID: <7505a92c43f2e45fcc83672039e03ec3@terra.es>

Hello all!.

I would like to ask if there is a bioperl module that can extract 
information from an alignment obtained by bl2seq.
The kind of info I need to extract is the position of a change, the 
nucleotide in the two sequences and in case of a deletion or insertion 
the length and the sequence that was inserted/deleted.
The reason to do this is because I'm comparing the wild type sequence 
of my gene  of interest against the sequences obtained from my 
population of study and I would like to store this kind of information 
in a database to integrate genotype variation with phenotype

To be more descriptive I need something that works like this:


Alignment:
Seq1:  acgtacgtacgtacgt----acgt
              | | | | | | | | | |  |              | | | |
seq2:  acgtacgtacct----acgtacgt

Result from parsing:

Position 11 g  -> c
Position (13-16)insertion ACGT
Position (17-20)deletion ACGT

Thanks a lot.

Julio Fern?ndez


PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

PhD. Julio Fern?ndez Banet
C/ Benito Corbal n?20 -6?A
Pontevedra C.P. 36001
Spain

Phone: (0034)607747946
Web: http://www.freelancebio.com

From bioinfovijayaraj at yahoo.com  Wed Jun 29 22:32:30 2005
From: bioinfovijayaraj at yahoo.com (vijayaraj nagarajan)
Date: Wed Jun 29 22:23:47 2005
Subject: [Bioperl-l] how-to-remove-redundant-lines-IT WORKED-TERRY
In-Reply-To: <17090.30788.631518.157296@terry.jones.tc>
Message-ID: <20050630023230.21601.qmail@web53608.mail.yahoo.com>

hi TERRY
your so called [Incriminating / embarrassing perl
deleted] code worked GREAT for me...
thanks dear. 
i think this is bcause, all that your so called
RUBBISH, where exactly that I had...hahahaha...
i am really happy and was jumping out of joy, seeing
the code work wonderful.... 
thank you SO MUCH.....

infact i didnt try the other code you had
suggested...just bcause i got the results and verified
them to be correct.

THANKS TO HEIKKI... even though i studied stat..and
searched cpan for modules..this set concept didnt
strike me...what a stupid i was... THANKS you once
again Heikki for showing me the way...to set concept
and perl modules...
i would be more than happy to acknowledge you guys,
when i am gonna publish my paper...

cheers guys
vijayaraj nagarajan
research assistant
department of biological sciences
the university of southern mississippi
ms, usa

--- Terry Jones <tcj25@cam.ac.uk> wrote:

> Oops......  I wrote the following rubbish:
> 
> | Are there any constraints on your data that might
> help solve this?
> | 
> | For example, do the numbers always have exactly
> one space between
> | them? Do the numbers always appear in ascending
> order? Is there ever
> | any trailing whitespace on a line (there was a
> space at the end of
> | your second line).
> | 
> | If the answers to the above are yes, yes, and no,
> then the following
> | works. If not, you'll need to do a little more to
> canonicalize each
> | line (e.g., strip spaces, sort the numbers, etc).
> |
> | [Incriminating / embarrassing perl deleted]
> 
> My code has at least two serious errors: 1) as
> Heikki points out, you
> can't output anything until you've read all the
> data, and 2) it will
> give spurious matches in input cases like this
> 
>   23 45 67
>    3 45
> 
> I hereby disown my earlier posting. You should
> follow Heikki's advice
> and use sets.
> 
> Terry
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
>
http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 
From heikki at ebi.ac.uk  Thu Jun 30 06:45:48 2005
From: heikki at ebi.ac.uk (Heikki Lehvaslaiho)
Date: Thu Jun 30 06:36:54 2005
Subject: [Bioperl-l] Help on module for the analysis of sequence alignment
In-Reply-To: <7505a92c43f2e45fcc83672039e03ec3@terra.es>
References: <7505a92c43f2e45fcc83672039e03ec3@terra.es>
Message-ID: <200506301145.48957.heikki@ebi.ac.uk>

Julio,

We do not have anything ready that would do it, but it should not be too 
difficult it.

We have:

Bio::AlignIO::bl2seq, that can allows Bio::AlignIO to read bl2seq output
Bio::SimpleAlign,     is the structure that stores the alignment
                      it has a lot of methods
Bio::Variation::SeqDiff
Bio::Variation::DNAMutation
                      for storing the variation information

also,
Bio::Coordinate::Utils->from_align($aln)
                      that can be used to calculate sequence positions


Using these, it should be possible to do what you need.

Part of the problem is task specific and is best done in a script but some of 
it could be put in a utility method into BioPerl:
- take an alignment as the first argument
- assume that first seq is the reference,
  allow to change that using second argument
- to simplify things, allow only pairwise alignments
- process the alignment and return a Bio::Variation::SeqDiff object holding 
all detected Bio::Variation::DNA::Mutations


The script would take care of reading in the alignment and processing the 
output for printing or for adding into the database.


Is this something you could write and give the method back to be included into 
BioPerl?

Yours,
 -Heikki

P.S. You do know of the EMBOSS program diffseq, don't you?
     http://emboss.sourceforge.net/apps/diffseq.html



On Thursday 30 June 2005 01:26, Julio Fern?ndez Banet wrote:
> Hello all!.
>
> I would like to ask if there is a bioperl module that can extract
> information from an alignment obtained by bl2seq.
> The kind of info I need to extract is the position of a change, the
> nucleotide in the two sequences and in case of a deletion or insertion
> the length and the sequence that was inserted/deleted.
> The reason to do this is because I'm comparing the wild type sequence
> of my gene  of interest against the sequences obtained from my
> population of study and I would like to store this kind of information
> in a database to integrate genotype variation with phenotype
>
> To be more descriptive I need something that works like this:
>
>
> Alignment:
> Seq1:  acgtacgtacgtacgt----acgt
>
> seq2:  acgtacgtacct----acgtacgt
>
> Result from parsing:
>
> Position 11 g  -> c
> Position (13-16)insertion ACGT
> Position (17-20)deletion ACGT
>
> Thanks a lot.
>
> Julio Fern?ndez
>
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> PhD. Julio Fern?ndez Banet
> C/ Benito Corbal n?20 -6?A
> Pontevedra C.P. 36001
> Spain
>
> Phone: (0034)607747946
> Web: http://www.freelancebio.com
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_ebi _ac _uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambridge, CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________

From shikida at gmail.com  Mon Jun 27 07:27:51 2005
From: shikida at gmail.com (Leonardo Kenji Shikida)
Date: Thu Jun 30 11:11:02 2005
Subject: [Bioperl-l] problems during installation
In-Reply-To: <42BFDFA0.1010609@gmail.com>
References: <1b4364400506240759372ff1af@mail.gmail.com>
	<42BFDFA0.1010609@gmail.com>
Message-ID: <1b43644005062704271bbbd346@mail.gmail.com>

thank you. I fixed the problem installing the required non-perl libraries

regards

Kenji

On 6/27/05, Frank Lee <lifei03@gmail.com> wrote:
> Just guess,  I believe the answer is given when you configing as this :
> 
> If you experience compile problems, please check the @INC, @LIBPATH and @LIBS
> arrays defined in Makefile.PL and manually adjust, if necessary.
> 
> For me, I will locate these files and find where they are and add them to the @INC or @LIBPATH, etc.
> 
> Wish you luck
> 
> 
> 
> 
> 
> \
> Leonardo Kenji Shikida wrote:
> 
> >trying to install using perl -MCPAN -e "install Bundle::BioPerl" in a
> >suse 9.3 box
> >
> >how should I proceed?
> >
> >
> >
> >
> >  CPAN.pm: Going to build L/LD/LDS/GD-2.19.tar.gz
> >
> >NOTICE: This module requires libgd 2.0.28 or higher.
> >        it will NOT work with earlier versions. If you are getting
> >        compile or link errors, then please get and install a new
> >        version of libgd from www.boutell.com. Do NOT ask Lincoln
> >        for help until you try this.
> >
> >        If you are using Math::Trig 1.01 or lower, it has a bug that
> >        causes a "prerequisite not found" warning to be issued.  You may
> >        safely ignore this warning.
> >
> >        Type perl Makefile.PL -h for command-line option summary
> >
> >Configuring for libgd version 2.0.32.
> >Included Features:          GD_XPM GD_JPEG GD_FONTCONFIG GD_FREETYPE GD_PNG GD_G
> >IF
> >GD library used from:       /usr
> >
> >If you experience compile problems, please check the @INC, @LIBPATH and @LIBS
> >arrays defined in Makefile.PL and manually adjust, if necessary.
> >
> >Checking if your kit is complete...
> >Looks good
> >Writing Makefile for GD
> >cp GD/Polyline.pm blib/lib/GD/Polyline.pm
> >cp qd.pl blib/lib/qd.pl
> >cp GD.pm blib/lib/GD.pm
> >AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
> >cp GD/Simple.pm blib/lib/GD/Simple.pm
> >/usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap /usr/lib/perl5/5.8.
> >6/ExtUtils/typemap -typemap typemap  GD.xs > GD.xsc && mv GD.xsc GD.c
> >cc -c  -I/usr/include -D_REENTRANT -D_GNU_SOURCE -DTHREADS_HAVE_PIDS -DDEBUGGING
> > -fno-strict-aliasing -pipe -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -marc
> >h=i586 -mcpu=i686 -fmessage-length=0 -Wall -g -Wall -pipe   -DVERSION=\"2.19\" -
> >DXS_VERSION=\"2.19\" -fPIC "-I/usr/lib/perl5/5.8.6/i586-linux-thread-multi/CORE"
> >  -DHAVE_JPEG -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_FONTCONFIG GD.c
> >GD.xs:7:16: gd.h: No such file or directory
> >GD.xs:8:21: gdfontg.h: No such file or directory
> >GD.xs:9:21: gdfontl.h: No such file or directory
> >GD.xs:10:22: gdfontmb.h: No such file or directory
> >
> >
> >
> >
> 
> 


-- 

[]

Kenji
_______________________
http://kenjiria.blogspot.com 
http://gaitabh.blogspot.com

From chris at bioteam.net  Mon Jun 27 09:08:15 2005
From: chris at bioteam.net (Chris Dagdigian)
Date: Thu Jun 30 11:11:08 2005
Subject: [Bioperl-l] problems during installation
In-Reply-To: <1b4364400506240759372ff1af@mail.gmail.com>
References: <1b4364400506240759372ff1af@mail.gmail.com>
Message-ID: <01900A2D-9724-45B8-BF89-4BF2676B6A74@bioteam.net>


You may want to check SuSE's software install tool (YaST) -- the GD  
perl module is usually included in an RPM and the version in Suse's  
repository may be modern enough for what you need - it will remove  
the need for you to find and deal with libgd. You should also check  
with YaST to see if the updated libgd is available in case you need  
to build the perl GD module from source.

-Chris





On Jun 24, 2005, at 10:59 AM, Leonardo Kenji Shikida wrote:

> trying to install using perl -MCPAN -e "install Bundle::BioPerl" in a
> suse 9.3 box
>
> how should I proceed?
>
>
>>>>>>>>>
>>>>>>>>>
>
>   CPAN.pm: Going to build L/LD/LDS/GD-2.19.tar.gz
>
> NOTICE: This module requires libgd 2.0.28 or higher.
>         it will NOT work with earlier versions. If you are getting
>         compile or link errors, then please get and install a new
>         version of libgd from www.boutell.com. Do NOT ask Lincoln
>         for help until you try this.
>
>         If you are using Math::Trig 1.01 or lower, it has a bug that
>         causes a "prerequisite not found" warning to be issued.   
> You may
>         safely ignore this warning.
>
>         Type perl Makefile.PL -h for command-line option summary
>
> Configuring for libgd version 2.0.32.
> Included Features:          GD_XPM GD_JPEG GD_FONTCONFIG  
> GD_FREETYPE GD_PNG GD_G
> IF
> GD library used from:       /usr
>
> If you experience compile problems, please check the @INC, @LIBPATH  
> and @LIBS
> arrays defined in Makefile.PL and manually adjust, if necessary.
>
> Checking if your kit is complete...
> Looks good
> Writing Makefile for GD
> cp GD/Polyline.pm blib/lib/GD/Polyline.pm
> cp qd.pl blib/lib/qd.pl
> cp GD.pm blib/lib/GD.pm
> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
> cp GD/Simple.pm blib/lib/GD/Simple.pm
> /usr/bin/perl /usr/lib/perl5/5.8.6/ExtUtils/xsubpp  -typemap /usr/ 
> lib/perl5/5.8.
> 6/ExtUtils/typemap -typemap typemap  GD.xs > GD.xsc && mv GD.xsc GD.c
> cc -c  -I/usr/include -D_REENTRANT -D_GNU_SOURCE - 
> DTHREADS_HAVE_PIDS -DDEBUGGING
>  -fno-strict-aliasing -pipe -D_LARGEFILE_SOURCE - 
> D_FILE_OFFSET_BITS=64 -O2 -marc
> h=i586 -mcpu=i686 -fmessage-length=0 -Wall -g -Wall -pipe   - 
> DVERSION=\"2.19\" -
> DXS_VERSION=\"2.19\" -fPIC "-I/usr/lib/perl5/5.8.6/i586-linux- 
> thread-multi/CORE"
>   -DHAVE_JPEG -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG - 
> DHAVE_FONTCONFIG GD.c
> GD.xs:7:16: gd.h: No such file or directory
> GD.xs:8:21: gdfontg.h: No such file or directory
> GD.xs:9:21: gdfontl.h: No such file or directory
> GD.xs:10:22: gdfontmb.h: No such file or directory
>
>
> -- 
>
> []
>
> Kenji
> _______________________
> http://kenjiria.blogspot.com
> http://gaitabh.blogspot.com
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>

From rfsouza at cecm.usp.br  Tue Jun 28 19:02:00 2005
From: rfsouza at cecm.usp.br (rfsouza@cecm.usp.br)
Date: Thu Jun 30 11:11:12 2005
Subject: [Bioperl-l] nhx.pm does not print bootstrap values
Message-ID: <32880.143.107.53.101.1119999720.squirrel@webmail.cecm.usp.br>

Hi,

I been trying to reformat some phylogenies built by the Phyml program to
the nhx format, in order to print them through ATV, but, for some reason,
the nhx.pm module doesn't print the bootstrap values.

Those values are loaded using newick.pm and get printed out through
nexus.pm, but nhx.pm seems to loose them. I'm using bioperl-live from
CVS (downloaded 20050523). Is this a known bug?

Thanks for any help.
Robson


#--------------
Here is my code:

#!/usr/bin/perl -w

use Bio::TreeIO;
use Getopt::Long;
use strict;

my $usage = 0;
my $outfile = undef;
my $infmt = 'newick';
my $outfmt = 'nhx';
my $bootstyle = '';
GetOptions("infmt|i=s" => \$infmt,
	   "outfmt|o=s" => \$outfmt,
	   "bootstyle|b=s" => \$bootstyle,
	   "outfile|f=s" => \$outfile,
	   "usage|help|h" => \$usage)
    || die "Error parsing command line arguments";
usage() if ($usage || scalar(@ARGV) == 0);

# Storing input file command line arguments
my %inargs = ('-file'=>$ARGV[0], '-format'=>$infmt);
$inargs{'-bootstrap_style'} = $bootstyle if (defined $bootstyle);

# Storing input file command line arguments
my %outargs = ('-format'=>$outfmt);
if (defined $outfile) {
    $outargs{'-file'} = ">$outfile";
} else {
    $outargs{'-fh'} = \*STDOUT;
}

# Building data streams
my $in  = Bio::TreeIO->new(%inargs);
my $out = Bio::TreeIO->new(%outargs);
while (my $t = $in->next_tree) {
    $out->write_tree($t);
}

exit 0;

sub usage {
    die "Usage: $0 [options] <file1> <file2>...
Available options:
 --infmt|-i    <string> : input file format (default: newick)
 --outfmt|-o   <string> : output file format (default: nhx)
 --bootstyle|b <string> : input bootstrap values format
 --outfile|-f  <file>   : output file name (default: stdout)
 --usage|--help|-h      : print this message
";
}


From ylin9 at gel.ym.edu.tw  Thu Jun 30 10:17:12 2005
From: ylin9 at gel.ym.edu.tw (=?big5?B?WXUtSHN1YW4gTGluKKpMpnSwYSk=?=)
Date: Thu Jun 30 11:11:15 2005
Subject: [Bioperl-l] Problem of installing bioperl-run-1.4 
Message-ID: <002501c57d7e$68c66170$7a4e818c@sandy>

Hi, all,

I have a problem to install bioperl-run-1.4. Because I want to use EMBOSS program within

my bioperl script, I installed bioperl 1.4 and EMBOSS ( /home/tools/EMBOSS-2.10.0 ) in

my debian linux system. When I tried to type in command line "make test", it said

t/EMBOSS..................ok                                                 
        28/30 skipped: EMBOSS not installed locally or XML::Twig not installed


I also installed XML::Twig and tried symbolic link from /usr/local to

/home/tools/EMBOSS-2.10.0 but still get the same message. Can anyone kindly tell me how to

solve this problem or where to find solution ?

Thank you very much,

Vincent,

From jason.stajich at duke.edu  Thu Jun 30 11:40:46 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu Jun 30 11:32:00 2005
Subject: [Bioperl-l] Problem of installing bioperl-run-1.4 
In-Reply-To: <002501c57d7e$68c66170$7a4e818c@sandy>
References: <002501c57d7e$68c66170$7a4e818c@sandy>
Message-ID: <1120146046.42c4127e11197@webmail.duke.edu>

did you make sure the EMBOSS bin directory is in your PATH?

-jason
-- 
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


Quoting "Yu-Hsuan Lin(?L?t?a)" <ylin9@gel.ym.edu.tw>:

> Hi, all,
> 
> I have a problem to install bioperl-run-1.4. Because I want to use EMBOSS
> program within
> 
> my bioperl script, I installed bioperl 1.4 and EMBOSS (
> /home/tools/EMBOSS-2.10.0 ) in
> 
> my debian linux system. When I tried to type in command line "make test", it
> said
> 
> t/EMBOSS..................ok                                                
> 
>         28/30 skipped: EMBOSS not installed locally or XML::Twig not
> installed
> 
> 
> I also installed XML::Twig and tried symbolic link from /usr/local to
> 
> /home/tools/EMBOSS-2.10.0 but still get the same message. Can anyone kindly
> tell me how to
> 
> solve this problem or where to find solution ?
> 
> Thank you very much,
> 
> Vincent,
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 
From hlapp at gmx.net  Thu Jun 30 01:00:50 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun 30 12:04:02 2005
Subject: [Bioperl-l] More unresolved issues with Bio::AnnotatableI 
In-Reply-To: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
References: <EEF5E2D6-9629-4F77-BDEA-054BC0E8DF06@pcbi.upenn.edu>
Message-ID: <4d0a050d2d74a15ffb4f3bab69355588@gmx.net>

I fixed this.

I actually turned out that the dependency was more a bug than a real 
dependency, and a rather trivial one: SimpleGOEngine was use'd in 
Bio::Ontology::Ontology.pm even though the code didn't use it - the 
default engine implementation is SimpleOntologyEngine.

Nonetheless I also changed the instantiation of SimpleOntologyEngine to 
be on demand only - so if in the future it acquires a nasty dependency, 
or if the default is changed, the dependency is soft in that it only 
becomes a hard one when you call one of the methods requiring the 
engine.

	 -hilmar

On Jun 22, 2005, at 9:46 AM, Aaron J. Mackey wrote:

>
> Because AnnotatableI has implementations for add_tag and get_tag that 
> invoke Bio::Annotation::OntologyTerm, and therefore Graph::Directed, 
> which relies on Scalar::Util::weaken(), therefore I cannot even use 
> basic Bio::Seq functionality on any perl that doesn't have weak 
> references (oddly, this cropped up in a 5.8.0 install via an RPM that 
> was evidently compiled without support for weak references, so this 
> isn't just an "ancient perl" problem).
>
> This is something of a showstopper for any 1.6; in effect, we'd need 
> to disable Annotation::OntologyTerm use for any Perl without weak 
> reference support.
>
> We've said it before, and we need to say it again: the changes made to 
> the feature/annotation object model are seriously impeding our ability 
> to move forward to a release (and frighteningly, the GBrowse 
> distribution now includes those parts of 1.5 that it relies on, so a 
> user's BioPerl install could be a hodge-podge of 1.4/1.5 code).  This 
> seems important to all GMOD projects, so why hasn't there been any 
> work on it?
>
> Thanks,
>
> -Aaron
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From jason.stajich at duke.edu  Thu Jun 30 12:19:50 2005
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu Jun 30 12:11:29 2005
Subject: [Bioperl-l] nhx.pm does not print bootstrap values
In-Reply-To: <32880.143.107.53.101.1119999720.squirrel@webmail.cecm.usp.br>
References: <32880.143.107.53.101.1119999720.squirrel@webmail.cecm.usp.br>
Message-ID: <1120148390.42c41ba6753a3@webmail.duke.edu>

I guess this is a bug - can you submit it as a bug to bugzilla.open-bio.org so
we can track it.  I thought I unified the slots where newick/nhx/nexus all
get/set bootstraps but perhaps not.

Bootstraps should be in the 'B' tag for nhx but I guess it isn't there?

-jason

-- 
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/


Quoting rfsouza@cecm.usp.br:

> Hi,
> 
> I been trying to reformat some phylogenies built by the Phyml program to
> the nhx format, in order to print them through ATV, but, for some reason,
> the nhx.pm module doesn't print the bootstrap values.
> 
> Those values are loaded using newick.pm and get printed out through
> nexus.pm, but nhx.pm seems to loose them. I'm using bioperl-live from
> CVS (downloaded 20050523). Is this a known bug?
> 
> Thanks for any help.
> Robson
> 
> 
> #--------------
> Here is my code:
> 
> #!/usr/bin/perl -w
> 
> use Bio::TreeIO;
> use Getopt::Long;
> use strict;
> 
> my $usage = 0;
> my $outfile = undef;
> my $infmt = 'newick';
> my $outfmt = 'nhx';
> my $bootstyle = '';
> GetOptions("infmt|i=s" => \$infmt,
> 	   "outfmt|o=s" => \$outfmt,
> 	   "bootstyle|b=s" => \$bootstyle,
> 	   "outfile|f=s" => \$outfile,
> 	   "usage|help|h" => \$usage)
>     || die "Error parsing command line arguments";
> usage() if ($usage || scalar(@ARGV) == 0);
> 
> # Storing input file command line arguments
> my %inargs = ('-file'=>$ARGV[0], '-format'=>$infmt);
> $inargs{'-bootstrap_style'} = $bootstyle if (defined $bootstyle);
> 
> # Storing input file command line arguments
> my %outargs = ('-format'=>$outfmt);
> if (defined $outfile) {
>     $outargs{'-file'} = ">$outfile";
> } else {
>     $outargs{'-fh'} = \*STDOUT;
> }
> 
> # Building data streams
> my $in  = Bio::TreeIO->new(%inargs);
> my $out = Bio::TreeIO->new(%outargs);
> while (my $t = $in->next_tree) {
>     $out->write_tree($t);
> }
> 
> exit 0;
> 
> sub usage {
>     die "Usage: $0 [options] <file1> <file2>...
> Available options:
>  --infmt|-i    <string> : input file format (default: newick)
>  --outfmt|-o   <string> : output file format (default: nhx)
>  --bootstyle|b <string> : input bootstrap values format
>  --outfile|-f  <file>   : output file name (default: stdout)
>  --usage|--help|-h      : print this message
> ";
> }
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
> 

From hlapp at gmx.net  Thu Jun 30 12:20:12 2005
From: hlapp at gmx.net (Hilmar Lapp)
Date: Thu Jun 30 12:11:43 2005
Subject: [Bioperl-l] broken term relationships from dagedit files fixed 
In-Reply-To: <1118687174.3265.35.camel@localhost.localdomain>
References: <20050613180019.64772.qmail@web54103.mail.yahoo.com>
	<1118687174.3265.35.camel@localhost.localdomain>
Message-ID: <a2e3ea97b2f4ac8e0b516095f3a57bfb@gmx.net>

I fixed the bug in Bioperl that prevented relationships from being 
returned when $ontology->get_relationships() is called without 
arguments. (if you called $ontology->get_relationships($term), 
everything worked fine)

The rest is a sort of a post-mortem and probably largely uninteresting 
to most people unless you're a developer.

The bug consisted of $graph->edges_at() being called incorrectly with 
an undef argument instead of calling $graph->edges() iff the term ID is 
undef (in Bio::Ontology::SimpleGOEngine.pm). The fix consisted of 
changing a single line of code. A test in the Bioperl test suite 
(t/Ontology.t) would readily expose the problem. However, versions of 
Graph.pm earlier than somewhere in 0.6.x behaved as if edges() had been 
called when the argument to edges_at() was undef, so that I only 
recently noticed the test failures, which had never been reported by 
someone actually experiencing the problem.

This single-line bug which would be detected by an existing test 
triggered a motivation to migrate away from using Bioperl because it 
was considered broken, as opposed to a motivation to debug the problem 
in Bioperl and fix it.

I am wondering whether this is just the way it goes or whether this 
experience could be used to draw some lessons for how GMOD developers 
and Bioperl developers could work together more productively, because 
generally I believe both groups of people could benefit significantly 
from each other. Also, I don't see being a GMOD developer as mutually 
exclusive with being a Bioperl developer and vice versa, so I'm not 
even sure these are two distinct groups of people ...

Any comments greatly welcome.

	-hilmar

On Jun 13, 2005, at 2:26 PM, Scott Cain wrote:

> Hello Elena,
>
> Unfortunately, this isn't going to work for you.  Bioperl is currently
> broken in that it doesn't capture cvterm relationship information from
> the DAG-Edit formatted files, so the cvterm_relationship table isn't
> populated.  This will be fixed when I migrate to using go-perl for
> loading ontologies, but that is a few weeks away at the earliest.
>
> As a side note, that shell script is also broken, as it uses $USER and
> $DBNAME where it should be using $CHADO_DB_USERNAME and $CHADO_DB_NAME,
> but that is very much a moot point, as this script will be deprecated 
> in
> favor of the postgres function for populationg the cvtermpath table.
>
> Thanks,
> Scott
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------


From skirov at utk.edu  Thu Jun 30 13:57:48 2005
From: skirov at utk.edu (Stefan Kirov)
Date: Thu Jun 30 13:48:58 2005
Subject: [Bioperl-l] Bio::SeqIO::game question
Message-ID: <42C4329C.6010800@utk.edu>

I am trying to parse a game xml file from flybase.org. I am unsure if 
the format flybase provides is 1.2 or earlier, but in any case I get:

-------------------- WARNING ---------------------
MSG: I did not find a protein sequence for
---------------------------------------------------
Can't call method "seq" on an undefined value at /home/sao/lib/perl5/site_perl/5.8.1/Bio/SeqIO/game/featHandler.pm line 790, <GEN0> line 484483.

game tests look fine.
Thanks!
Stefan
From laurichj at bioinfo.ucr.edu  Thu Jun 30 17:03:25 2005
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Thu Jun 30 16:54:35 2005
Subject: [Bioperl-l] BLAST scores
Message-ID: <20050630210325.GA13422@bioinfo.ucr.edu>

Not really a BioPerl question, but... 

I ran a bunch of blasts using the tablular output. However, I need the
score reported and it apparently doesn't do that. The reason I'm using
the tabular format is to speed parsing, since that was taking more than
half the CPU time... Anyhow, is there anyway to compute the score from
the e-value and/or bit scores? Or am I stuck rerunning all those
blasts?

Thanks

-- 

------------------------------------------------------
| Josh Lauricha            | Ford, you're turning    |
| laurichj@bioinfo.ucr.edu | into a penguin. Stop    |
| Bioinformatics, UCR      | it                      |
|----------------------------------------------------|
| OpenPG:                                            |
|  4E7D 0FC0 DB6C E91D 4D7B C7F3 9BE9 8740 E4DC 6184 |
|----------------------------------------------------|
From jbedell at oriongenomics.com  Thu Jun 30 17:48:36 2005
From: jbedell at oriongenomics.com (Joseph Bedell)
Date: Thu Jun 30 17:39:55 2005
Subject: [Bioperl-l] BLAST scores
Message-ID: <434AF352F9D03C4C896782B8CC78BC7687F264@VADER.oriongenomics.com>

Hi Josh,


>-----Original Message-----
>From: bioperl-l-bounces@portal.open-bio.org [mailto:bioperl-l-
>bounces@portal.open-bio.org] On Behalf Of Josh Lauricha
>Sent: Thursday, June 30, 2005 4:03 PM
>To: bioperl-l@portal.open-bio.org
>Subject: [Bioperl-l] BLAST scores
>
>Not really a BioPerl question, but...
>
>I ran a bunch of blasts using the tablular output. However, I need the
>score reported and it apparently doesn't do that. The reason I'm using
>the tabular format is to speed parsing, since that was taking more than
>half the CPU time... Anyhow, is there anyway to compute the score from
>the e-value and/or bit scores? Or am I stuck rerunning all those
>blasts?
 
You can calculate the score given the bit score (from the tabular
output) and Lambda (calculated from the matrix). The equation is Score =
(Bits)/(Lambda in bits).

Lambda is only dependent upon the matrix. Did you use NCBI-blast or
WU-BLAST? Which flavor of blast (blastn, blastp, etc)? In any case, you
can just run a single blast and look at the stats at the bottom of the
report to get the value of lambda. For example, a default NCBI-blastn
(+1/-3) search has a lambda of 1.37

============================
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31
===============================

But, what is difficult to discover is this lambda is in NATS. To convert
it to bits, divide it by the natural log of 2, or in perl:

perl -e 'print 1.37/log(2),"\n"'
1.97649220601788

So, now you can take all of your bit scores divided by 1.97649220601788
to get the Score.

HTH,
Joey


>Thanks
>
>--
>
>------------------------------------------------------
>| Josh Lauricha            | Ford, you're turning    |
>| laurichj@bioinfo.ucr.edu | into a penguin. Stop    |
>| Bioinformatics, UCR      | it                      |
>|----------------------------------------------------|
>| OpenPG:                                            |
>|  4E7D 0FC0 DB6C E91D 4D7B C7F3 9BE9 8740 E4DC 6184 |
>|----------------------------------------------------|
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l

From laurichj at bioinfo.ucr.edu  Thu Jun 30 17:55:53 2005
From: laurichj at bioinfo.ucr.edu (Josh Lauricha)
Date: Thu Jun 30 17:47:00 2005
Subject: [Bioperl-l] BLAST scores
In-Reply-To: <434AF352F9D03C4C896782B8CC78BC7687F264@VADER.oriongenomics.com>
References: <434AF352F9D03C4C896782B8CC78BC7687F264@VADER.oriongenomics.com>
Message-ID: <20050630215553.GB13422@bioinfo.ucr.edu>

On Thu 06/30/05 16:48, Joseph Bedell wrote:
> You can calculate the score given the bit score (from the tabular
> output) and Lambda (calculated from the matrix). The equation is Score =
> (Bits)/(Lambda in bits).
> 
> Lambda is only dependent upon the matrix. Did you use NCBI-blast or
> WU-BLAST? Which flavor of blast (blastn, blastp, etc)? In any case, you
> can just run a single blast and look at the stats at the bottom of the
> report to get the value of lambda. For example, a default NCBI-blastn
> (+1/-3) search has a lambda of 1.37
> 
> ============================
> Lambda     K      H
>     1.37    0.711     1.31 
> 
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
> ===============================
> 
> But, what is difficult to discover is this lambda is in NATS. To convert
> it to bits, divide it by the natural log of 2, or in perl:
> 
> perl -e 'print 1.37/log(2),"\n"'
> 1.97649220601788
> 
> So, now you can take all of your bit scores divided by 1.97649220601788
> to get the Score.
> 
> HTH,
> Joey

Cool, thanks. That'll save me a bunch of time ;) This was NCBI blastp,
so I've already got it calculated ;)

Thanks.

-- 

------------------------------------------------------
| Josh Lauricha            | Ford, you're turning    |
| laurichj@bioinfo.ucr.edu | into a penguin. Stop    |
| Bioinformatics, UCR      | it                      |
|----------------------------------------------------|
| OpenPG:                                            |
|  4E7D 0FC0 DB6C E91D 4D7B C7F3 9BE9 8740 E4DC 6184 |
|----------------------------------------------------|
| Geek Code: Version 3.12                            |
| GAT/CS$/IT$ d+ s-: a-->--- C++++$ UL++++$ P++ L++++|
| $E--- W+ N o? K? w--(---) O? M+(++) V? PS++ PE-(--)|
| Y+ PGP+++ t--- 5+++ X+ R tv DI++ D--- G++          |
| e++ h- r++ z?                                      |
|----------------------------------------------------|
From gbazykin at Princeton.EDU  Thu Jun 30 12:55:56 2005
From: gbazykin at Princeton.EDU (Georgii Bazykin)
Date: Fri Jul  1 14:28:34 2005
Subject: [Bioperl-l] TreeIO::nhx doesn't write internal node labels
Message-ID: <174361574726.20050630205556@princeton.edu>

Hi,

I am new to BioPerl, and I am having trouble trying to save a tree in
NHX format. I load a nexus tree and parse a PAUP log file ("branch
linkages") to get internal node ids (I will then need to process
character changes between internal nodes, this is why I need internal
node ids). I then put write PAUP ids (which are numbers) as ids of
internal nodes of the tree, and write the tree in nxh format, hoping
that the internal node labels will be preserved. But the resulting nhx
file has only empty [&&NHX] labels and no internal node labels. Is
this a feature, or am I doing something wrong?

Please help!

Yegor