From cjfields at uiuc.edu  Sat Apr  1 01:54:45 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 1 Apr 2006 00:54:45 -0600
Subject: [Bioperl-l] Issue with Bio::SearchIO::psl (was: Bioperl bug
	1977)
In-Reply-To: <6E8F6494-F5C9-4763-93D3-7A9B3F238821@uiuc.edu>
References: <001901c65446$bfb0b270$15327e82@pyrimidine>
	<9AFA96E5-79BE-4BE7-8B33-F6C28012B929@cshl.edu>
	<6E8F6494-F5C9-4763-93D3-7A9B3F238821@uiuc.edu>
Message-ID: <778E9E29-FA55-4288-8C3B-E386AC6A508A@uiuc.edu>

Albert,

I had no problems with this on Mac OS X (I'm running from 10.4.5,  
perl 5.8.6).  I noticed that several fixes were made in the last 6  
months that would potentially fix this issue, including two which  
involve newlines (that is what seems to be hanging things up here).   
Have you tried a full bioperl-live install to see if that fixes it?

computer:~/searchio_test cjfields$ perl psl.pl
/usr/local/blat/db/hg17/hg17.2bit:chr5
     100.00
/usr/local/blat/db/hg17/hg17.2bit:chr21
     90.00
/usr/local/blat/db/hg17/hg17.2bit:chr5
     85.00
/usr/local/blat/db/hg17/hg17.2bit:chr13
     80.00
/usr/local/blat/db/hg17/hg17.2bit:chr7
     80.00


Chris

On Mar 31, 2006, at 7:40 AM, Chris Fields wrote:

> I'll try it with Mac OS X this weekend to confirm; I'm running v.
> 10.4.5 with perl 5.8.6.
>
> I noticed that there's no tests for psl in SearchIO.t which should
> have caught this error.  I'll double check that in case I'm
> mistaken.  If not, I'll add a few to see what happens... maybe we'll
> get some responses back?
>
> I'll also forward this to the mail list to see if anybody else has
> had this issue.
>
> Chris
>
> On Mar 31, 2006, at 3:53 AM, Albert Vernon Smith wrote:
>
>> Running your same code, on the same file, I get:
>>
>> Output:
>> -------
>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>     100.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr21
>>     90.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>     85.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr13
>>     80.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr7
>>     80.00
>> Use of uninitialized value in pattern match (m//) at /Users/albert/
>> Documents/CSHL/cvswork/bioperl-live/Bio/SearchIO/psl.pm line 173,
>> <GEN1> line 10.
>> --------
>>
>> This is current CVS, and I see the problem on Mac OS X, as well as
>> on Linux.
>>
>> As it stands the code for Bio::Search::psl *should* be fine (as I
>> run it in my head :-), and the error message is kinda weird.  The
>> last line is #10, so there should be a value for the line, unless
>> things are trying to cycle back over it again for some reason.
>>
>> -albert
>>
>>
>> On 30.3.2006, at 22:10, Chris Fields wrote:
>>
>>> I'm running off bioperl-live from CVS (updated yesterday) and I get
>>> everything to work on this end (no errors) using your file,
>>> although I'm
>>> just printing names and HSP scores out, like this:
>>>
>>> --------------------------------------
>>>
>>> my $parser = Bio::SearchIO->new(-verbose    => $v,
>>>                                 -file       => 'psl.out',
>>>                                 -format     => 'psl');
>>>
>>> while (my $result = $parser->next_result) {
>>>     while (my $hit = $result->next_hit) {
>>>         print $hit->name,"\n";
>>>         while (my $hsp = $hit->next_hsp) {
>>>             print "    ",$hsp->score,"\n";
>>>         }
>>>     }
>>> }
>>>
>>> --------------------------------------
>>> Output:
>>> --------------------------------------
>>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>>     100.00
>>> /usr/local/blat/db/hg17/hg17.2bit:chr21
>>>     90.00
>>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>>     85.00
>>> /usr/local/blat/db/hg17/hg17.2bit:chr13
>>>     80.00
>>> /usr/local/blat/db/hg17/hg17.2bit:chr7
>>>     80.00
>>> --------------------------------------
>>>
>>> Is this a recent update of Bioperl?  There were several updates in
>>> CVS to
>>> Bio::SearchIO::psl for various bugfixes over the last year,
>>> including one
>>> that postdates the 1.5.1 release.  I would recommend trying the
>>> CVS version
>>> (copy it over the your old version if possible or just install
>>> bioperl-live
>>> from CVS).  If this doesn't work could you send your script?  It
>>> may be a
>>> specific method that's acting up.
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher - Switzer Lab
>>> Dept. of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>>>> -----Original Message-----
>>>> From: Albert Vernon Smith [mailto:smithav at cshl.edu]
>>>> Sent: Thursday, March 30, 2006 1:49 PM
>>>> To: Chris Fields
>>>> Subject: Re: Bioperl bug 1977
>>>>
>>>> [Message never went out before.  Was stuck in outbox.]
>>>>
>>>> I've attached an output which causes issues.  While parsing this
>>>> output gives me an issue, I'm actually doing something slightly
>>>> different.  I have a webBlat server, and am getting output via
>>>> LWP::UserAgent, and I take the psl returned from my query and pass
>>>> that in memory (with IO::String) to the parser.  When I do that, I
>>>> get a complaint which references the last line.  Still, parsing  
>>>> this
>>>> as a file should be the same thing.
>>>>
>>>> -albert
>>>
>>>
>>
>
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From hlapp at gmx.net  Sat Apr  1 04:34:19 2006
From: hlapp at gmx.net (Hilmar Lapp)
Date: Sat, 1 Apr 2006 01:34:19 -0800
Subject: [Bioperl-l] possible bug printing GenBank feature qualfiers
In-Reply-To: <62CBAEDB-A87B-4D0B-9266-D295CF5401D4@uiuc.edu>
References: <000101c65501$81db02a0$15327e82@pyrimidine>
	<C0530A60.8049%osborne1@optonline.net>
	<aea845b90603311502t2e7fbdc8v1a3cc1da4d0b26b@mail.gmail.com>
	<62CBAEDB-A87B-4D0B-9266-D295CF5401D4@uiuc.edu>
Message-ID: <1a4799cf28d062163ae67235dd0956a5@gmx.net>


On Mar 31, 2006, at 8:26 PM, Chris Fields wrote:

> Since the problem seems to be solved and both fixes (Scott's and 
> Heikki's) are redundant and essentially get the same results, one of 
> them should be rolled back.

Please don't leave the line

	$value = $value->{"value"};

Either remove it (because the problem needs to either be 'fixed' in all 
writers, or at the root), or if you want to leave this construct in, 
protect it with a conditional and use the method-based access as I sent 
an example before.

	-hilmar
-- 
----------------------------------------------------------
: Hilmar Lapp -:- San Diego, CA -:- hlapp at gmx dot net :
----------------------------------------------------------


From cjfields at uiuc.edu  Sat Apr  1 10:47:52 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Sat, 1 Apr 2006 09:47:52 -0600
Subject: [Bioperl-l] possible bug printing GenBank feature qualfiers
In-Reply-To: <1a4799cf28d062163ae67235dd0956a5@gmx.net>
References: <000101c65501$81db02a0$15327e82@pyrimidine>
	<C0530A60.8049%osborne1@optonline.net>
	<aea845b90603311502t2e7fbdc8v1a3cc1da4d0b26b@mail.gmail.com>
	<62CBAEDB-A87B-4D0B-9266-D295CF5401D4@uiuc.edu>
	<1a4799cf28d062163ae67235dd0956a5@gmx.net>
Message-ID: <85387BB7-8F38-41C8-A6D9-A5A7E6E08C33@uiuc.edu>

Removed Scott's line from Bio::SeqIO::genbank in CVS (reverted back  
to the previous version); it's much simpler that way and we avoid an  
extra method call.  Sorry about all the confusion here; I was worried  
that the parsing issue I was seeing about the feature flag had  
something to do with Scott's bug when they were completely unrelated.

Chris

On Apr 1, 2006, at 3:34 AM, Hilmar Lapp wrote:

>
> On Mar 31, 2006, at 8:26 PM, Chris Fields wrote:
>
>> Since the problem seems to be solved and both fixes (Scott's and
>> Heikki's) are redundant and essentially get the same results, one of
>> them should be rolled back.
>
> Please don't leave the line
>
> 	$value = $value->{"value"};
>
> Either remove it (because the problem needs to either be 'fixed' in  
> all
> writers, or at the root), or if you want to leave this construct in,
> protect it with a conditional and use the method-based access as I  
> sent
> an example before.
>
> 	-hilmar
> -- 
> ----------------------------------------------------------
> : Hilmar Lapp -:- San Diego, CA -:- hlapp at gmx dot net :
> ----------------------------------------------------------
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From jason.stajich at duke.edu  Mon Apr  3 11:32:20 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon, 3 Apr 2006 11:32:20 -0400
Subject: [Bioperl-l] PAML 3.15 parsing
Message-ID: <5E25B9FC-EBCF-4664-847A-A85C59D80DAA@duke.edu>

PAML 3.15 parsing should work now - small change in the format  
between 3.14 and 3.15 caused a choke-up.  One day we'll get the  
parser to be more robust, as it stands right now it is pretty fragile  
to any format changes between versions.

I have some other outstanding commits dealing with branch-specific  
parameter parsers that I'll get to later in the month.

-jason
--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From smarkel at scitegic.com  Mon Apr  3 12:28:09 2006
From: smarkel at scitegic.com (Scott Markel)
Date: Mon, 03 Apr 2006 09:28:09 -0700
Subject: [Bioperl-l] possible bug printing GenBank feature qualfiers
In-Reply-To: <85387BB7-8F38-41C8-A6D9-A5A7E6E08C33@uiuc.edu>
References: <000101c65501$81db02a0$15327e82@pyrimidine>
	<C0530A60.8049%osborne1@optonline.net>
	<aea845b90603311502t2e7fbdc8v1a3cc1da4d0b26b@mail.gmail.com>
	<62CBAEDB-A87B-4D0B-9266-D295CF5401D4@uiuc.edu>
	<1a4799cf28d062163ae67235dd0956a5@gmx.net>
	<85387BB7-8F38-41C8-A6D9-A5A7E6E08C33@uiuc.edu>
Message-ID: <44314D19.5080804@scitegic.com>

Chris,

Apologies again that my simplistic input file caused confusion.
Thanks for making the CVS changes.

Scott

Chris Fields wrote:

> Removed Scott's line from Bio::SeqIO::genbank in CVS (reverted back  to 
> the previous version); it's much simpler that way and we avoid an  extra 
> method call.  Sorry about all the confusion here; I was worried  that 
> the parsing issue I was seeing about the feature flag had  something to 
> do with Scott's bug when they were completely unrelated.
> 
> Chris
> 
> On Apr 1, 2006, at 3:34 AM, Hilmar Lapp wrote:
> 
>>
>> On Mar 31, 2006, at 8:26 PM, Chris Fields wrote:
>>
>>> Since the problem seems to be solved and both fixes (Scott's and
>>> Heikki's) are redundant and essentially get the same results, one of
>>> them should be rolled back.
>>
>>
>> Please don't leave the line
>>
>>     $value = $value->{"value"};
>>
>> Either remove it (because the problem needs to either be 'fixed' in  all
>> writers, or at the root), or if you want to leave this construct in,
>> protect it with a conditional and use the method-based access as I  sent
>> an example before.
>>
>>     -hilmar
>> -- 
>> ----------------------------------------------------------
>> : Hilmar Lapp -:- San Diego, CA -:- hlapp at gmx dot net :
>> ----------------------------------------------------------
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
> 
> 

-- 
Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  smarkel at scitegic.com
SciTegic Inc.                       mobile: +1 858 205 3653
9665 Chesapeake Drive, Suite 401    voice:  +1 858 279 8800, ext. 253
San Diego, CA 92123                 fax:    +1 858 279 8804
USA                                 web:    http://www.scitegic.com


From cjfields at uiuc.edu  Tue Apr  4 10:15:00 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Apr 2006 09:15:00 -0500
Subject: [Bioperl-l] biosql-schema CVS problems
Message-ID: <000001c657f2$2924d660$15327e82@pyrimidine>

I'm having problems checking out biosql-schema from CVS using my developer
account on the new CVS server (dev.open-bio.org).  I'm currently using
TortoiseCVS and I am able to checkout all other packages w/o problems (core,
run, db, etc), so I know everything is set up correctly and works.  When I
try 'biosql-schema' or 'schema' I get this:

In C:\Perl\src\bioperl: "C:\Program Files\TortoiseCVS\cvs.exe" "-q" "--lf"
"checkout" "-P" "schema"
CVSROOT=:ext:cjfields at dev.open-bio.org:/home/repository/bioperl

cvs checkout: failed to create lock directory for
`/home/repository/bioperl/biosql-schema'
(/home/repository/bioperl/biosql-schema/#cvs.lock): Permission denied
cvs checkout: failed to obtain dir lock in repository
`/home/repository/bioperl/biosql-schema'
cvs [checkout aborted]: read lock failed - giving up
cvs.exe checkout: in directory .:
cvs.exe checkout: cannot open CVS/Entries for reading: No such file or
directory

Error, CVS operation failed



This didn't happen with the old cvs server.  Any ideas?


Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 



From jason.stajich at duke.edu  Tue Apr  4 11:01:44 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Tue, 4 Apr 2006 11:01:44 -0400
Subject: [Bioperl-l] biosql-schema CVS problems
In-Reply-To: <000001c657f2$2924d660$15327e82@pyrimidine>
References: <000001c657f2$2924d660$15327e82@pyrimidine>
Message-ID: <1EF7D89D-864C-4E67-8997-C9F717FA9456@duke.edu>

It is a symlink to /home/repository/biosql because this is a shared  
project, but you need to be in the biosql group though to checkout  
with read+write permissions.

An email to the helpdesk will get this straightened out.

We'll have to think more about how we want to handle this in the  
future in terms of granting permissions to the schema for r/w.


-jason
On Apr 4, 2006, at 10:15 AM, Chris Fields wrote:

> I'm having problems checking out biosql-schema from CVS using my  
> developer
> account on the new CVS server (dev.open-bio.org).  I'm currently using
> TortoiseCVS and I am able to checkout all other packages w/o  
> problems (core,
> run, db, etc), so I know everything is set up correctly and works.   
> When I
> try 'biosql-schema' or 'schema' I get this:
>
> In C:\Perl\src\bioperl: "C:\Program Files\TortoiseCVS\cvs.exe" "-q"  
> "--lf"
> "checkout" "-P" "schema"
> CVSROOT=:ext:cjfields at dev.open-bio.org:/home/repository/bioperl
>
> cvs checkout: failed to create lock directory for
> `/home/repository/bioperl/biosql-schema'
> (/home/repository/bioperl/biosql-schema/#cvs.lock): Permission denied
> cvs checkout: failed to obtain dir lock in repository
> `/home/repository/bioperl/biosql-schema'
> cvs [checkout aborted]: read lock failed - giving up
> cvs.exe checkout: in directory .:
> cvs.exe checkout: cannot open CVS/Entries for reading: No such file or
> directory
>
> Error, CVS operation failed
>
>
>
> This didn't happen with the old cvs server.  Any ideas?
>
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From cjfields at uiuc.edu  Tue Apr  4 11:08:32 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Apr 2006 10:08:32 -0500
Subject: [Bioperl-l] biosql-schema CVS problems
In-Reply-To: <1EF7D89D-864C-4E67-8997-C9F717FA9456@duke.edu>
Message-ID: <000701c657f9$a3245ba0$15327e82@pyrimidine>

No problem (I can just download the tarball, I don't need r/w permissions
for the schema).  I didn't have an issue when checking out from the old cvs
server; it's been a while so I may be wrong.  Looks like Chris D. figured it
out though.  Thanks!

Chris (F.)

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: Jason Stajich [mailto:jason.stajich at duke.edu]
> Sent: Tuesday, April 04, 2006 10:02 AM
> To: Chris Fields
> Cc: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] biosql-schema CVS problems
> 
> It is a symlink to /home/repository/biosql because this is a shared
> project, but you need to be in the biosql group though to checkout
> with read+write permissions.
> 
> An email to the helpdesk will get this straightened out.
> 
> We'll have to think more about how we want to handle this in the
> future in terms of granting permissions to the schema for r/w.
> 
> 
> -jason
> On Apr 4, 2006, at 10:15 AM, Chris Fields wrote:
> 
> > I'm having problems checking out biosql-schema from CVS using my
> > developer
> > account on the new CVS server (dev.open-bio.org).  I'm currently using
> > TortoiseCVS and I am able to checkout all other packages w/o
> > problems (core,
> > run, db, etc), so I know everything is set up correctly and works.
> > When I
> > try 'biosql-schema' or 'schema' I get this:
> >
> > In C:\Perl\src\bioperl: "C:\Program Files\TortoiseCVS\cvs.exe" "-q"
> > "--lf"
> > "checkout" "-P" "schema"
> > CVSROOT=:ext:cjfields at dev.open-bio.org:/home/repository/bioperl
> >
> > cvs checkout: failed to create lock directory for
> > `/home/repository/bioperl/biosql-schema'
> > (/home/repository/bioperl/biosql-schema/#cvs.lock): Permission denied
> > cvs checkout: failed to obtain dir lock in repository
> > `/home/repository/bioperl/biosql-schema'
> > cvs [checkout aborted]: read lock failed - giving up
> > cvs.exe checkout: in directory .:
> > cvs.exe checkout: cannot open CVS/Entries for reading: No such file or
> > directory
> >
> > Error, CVS operation failed
> >
> >
> >
> > This didn't happen with the old cvs server.  Any ideas?
> >
> >
> > Christopher Fields
> > Postdoctoral Researcher - Switzer Lab
> > Dept. of Biochemistry
> > University of Illinois Urbana-Champaign
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12



From cjfields at uiuc.edu  Tue Apr  4 18:03:58 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 4 Apr 2006 17:03:58 -0500
Subject: [Bioperl-l] FW: Issue with Bio::SearchIO::psl (was: Bioperl bug
	1977)
Message-ID: <001701c65833$ad255840$15327e82@pyrimidine>

Of course I forgot to forward this...

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


Original message:


I'm going to go back on the mail list since it's probably not the script,
though it still sounds like an input file issue via IO::String.  Jason may
have some ideas on this as well.  

On the surface it looks like the end_document method isn't called for some
reason so it tries reading through, gets undef and chokes.  However I am
unable to replicate that here (everything ends as expected).  It doesn't
hurt to add your fix as a failsafe so I'll go ahead and commit it (it passes
all tests) but I would like you to try a few things first.

Did you try 'make test' when you installed bioperl from CVS?  I had
previously thought that the psl tests weren't included but they are actually
under UCSCParsers.t.  This error ("Use of uninitialized value in pattern
match (m//)") should pop up if you run 'make test'.  Or, even simpler, run
this from the bioperl-live directory (where you ran 'perl Makefile.PL, and
'make test'):

perl -I. -w t/USCSParsers.t

The only other thing I can think of is that, in your original test run of
the script, your error line indicated that you had a local installation of
bioperl and that version of Bio::SearchIO::psl was the one causing the
error:

Use of uninitialized value in pattern match (m//) at /Users/albert/
Documents/CSHL/cvswork/bioperl-live/Bio/SearchIO/psl.pm line 173, <GEN1>
line 10.

Is it possible that you have two versions of bioperl installed, one in the
/Library/Perl folder and the one being used above?  If you tried
uninstalling and reinstalling using 'perl Makefile.PL', 'make', 'make
install' then it will install in your system by default (though I believe
you have to use 'sudo' for that).  If PERL5LIB is set to your local perl
version, it will use that one first.

Personally, I don't think that's it though it's worth a shot.  I tried old
versions of SearchIO::psl from CVS and they all seemed to work just fine, so
I'm a bit mystified about this one since you get the same error on Linux and
Mac OS X, but I don't get it on either WinXP or Mac OS X (both using a CVS
copy of bioperl with PERL5LIB).  

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: Albert Vernon Smith [mailto:smithav at cshl.edu]
> Sent: Tuesday, April 04, 2006 1:27 PM
> To: Chris Fields
> Subject: Re: [Bioperl-l] Issue with Bio::SearchIO::psl (was: Bioperl 
> bug
> 1977)
> 
> it is exactly your script where i get this (as well as my own 
> variations).  plus data for the test.
> 
> -a



From asnascimento at if.sc.usp.br  Tue Apr  4 11:28:26 2006
From: asnascimento at if.sc.usp.br (Alessandro S. Nascimento)
Date: Tue, 04 Apr 2006 12:28:26 -0300
Subject: [Bioperl-l] problems with blast parser
Message-ID: <4432909A.9030107@if.sc.usp.br>

Hi all

I'm trying to parse a blast standalone (blaspgp) result file and filter 
some sequences using length and identity. The script used to work but 
this time after several minutes working in 99.9% of my processor I have  
a "killed"message with no more information. The blast file is very 
large. Does anyone have any clue ?

Thanks in advance

Alessandro

From smithav at cshl.edu  Tue Apr  4 11:15:42 2006
From: smithav at cshl.edu (Albert Vernon Smith)
Date: Tue, 4 Apr 2006 15:15:42 +0000
Subject: [Bioperl-l] Issue with Bio::SearchIO::psl (was: Bioperl bug
	1977)
In-Reply-To: <778E9E29-FA55-4288-8C3B-E386AC6A508A@uiuc.edu>
References: <001901c65446$bfb0b270$15327e82@pyrimidine>
	<9AFA96E5-79BE-4BE7-8B33-F6C28012B929@cshl.edu>
	<6E8F6494-F5C9-4763-93D3-7A9B3F238821@uiuc.edu>
	<778E9E29-FA55-4288-8C3B-E386AC6A508A@uiuc.edu>
Message-ID: <930B08C3-209D-4915-B86D-82CA2CF0E42B@cshl.edu>

I deleted all of my bioperl installation, and reinstalled to be  
certain that this is a current issue.  Having done that, I am still  
seeing the issue.  I also updated IO::Handle to the most recent  
version, on the off chance that it was something coming from there.

-albert


On 1.4.2006, at 06:54, Chris Fields wrote:

> Albert,
>
> I had no problems with this on Mac OS X (I'm running from 10.4.5,  
> perl 5.8.6).  I noticed that several fixes were made in the last 6  
> months that would potentially fix this issue, including two which  
> involve newlines (that is what seems to be hanging things up  
> here).  Have you tried a full bioperl-live install to see if that  
> fixes it?
>
> computer:~/searchio_test cjfields$ perl psl.pl
> /usr/local/blat/db/hg17/hg17.2bit:chr5
>     100.00
> /usr/local/blat/db/hg17/hg17.2bit:chr21
>     90.00
> /usr/local/blat/db/hg17/hg17.2bit:chr5
>     85.00
> /usr/local/blat/db/hg17/hg17.2bit:chr13
>     80.00
> /usr/local/blat/db/hg17/hg17.2bit:chr7
>     80.00
>
>
> Chris


From cjfields at uiuc.edu  Wed Apr  5 15:24:14 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Apr 2006 14:24:14 -0500
Subject: [Bioperl-l] mailing list summaries
Message-ID: <001201c658e6$86c779e0$15327e82@pyrimidine>

I posted this on the news blog already, but I want to know what people
think.  Jason has listed on the wiki a list of priorities, including a
regular summary of the mail list traffic.  I have decided to take this up
and see how it goes. 

Basically, I plan on starting a weekly, possibly biweekly, summary of
mailing list traffic. These will be somewhat in the same vein as the Perl5
or Perl6 summaries and will be posted on the blog here and sent to the
bioperl-l mail list. Barring another natural disaster here, these should
start up next week (covering mail list traffic starting from April 1). The
summaries will cover traffic mainly from bioperl-l (the main mail list) but
will include biosql-l, since it's fairly low traffic, and bugs/module
updates from bioperl-guts-l.

Let me know if there are any requests/questions/gripes/etc.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 



From y.itan at ucl.ac.uk  Wed Apr  5 18:00:54 2006
From: y.itan at ucl.ac.uk (Yuval Itan)
Date: Thu, 06 Apr 2006 08:00:54 +1000
Subject: [Bioperl-l] Getting sequences by ID
Message-ID: <200604051803.25547.y.itan@ucl.ac.uk>

Hi Torsten,

I would be grateful for an advice from you regarding Bioperl, after I was 
fiddling around trying to write the Perl script for that from scratch.
I have a large fasta file of about 20,000 genes, and another file which is a 
list of about 2,000 gene IDs (no sequences), all included in the large file. 
I need to create a fasta file which will include only the genes with these 
specific 200 IDs. I was wondering if there is a method in Bioperl that will 
allow me to do the following pseudocode:

For each $ID from 200_IDs_set_file
{
	$my_seq = get_sequence_by_ID(from large_fasta_file, $ID)
	write $my_seq into file
}

Many thanks for any hint!

Yuval 


From torsten.seemann at infotech.monash.edu.au  Wed Apr  5 18:14:01 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Thu, 06 Apr 2006 08:14:01 +1000
Subject: [Bioperl-l] Getting sequences by ID
In-Reply-To: <200604051803.25547.y.itan@ucl.ac.uk>
References: <200604051803.25547.y.itan@ucl.ac.uk>
Message-ID: <1144275241.22967.7.camel@chauvel.csse.monash.edu.au>

On Wed, 2006-04-05 at 18:03 +0100, Yuval Itan wrote:
> I would be grateful for an advice from you regarding Bioperl, after I was 
> fiddling around trying to write the Perl script for that from scratch.
> I have a large fasta file of about 20,000 genes, and another file which is a 
> list of about 2,000 gene IDs (no sequences), all included in the large file. 
> I need to create a fasta file which will include only the genes with these 
> specific 200 IDs. I was wondering if there is a method in Bioperl that will 
> allow me to do the following pseudocode:
> 
> For each $ID from 200_IDs_set_file
> {
> 	$my_seq = get_sequence_by_ID(from large_fasta_file, $ID)
> 	write $my_seq into file
> }

There are many possibilities involving combinations of pure Perl and
BioPerl modules, and some even involving no Perl, but rather using
commands like 'formatdb' and 'fastacmd -s'. There are probably EMBOSS
solutions too.

Using your pseudo code, you could use Bio::Index::Fasta to index your
20,000 genes. Then loop over each ID, and retrieve the Seq via the
index, and write it out using Bio::SeqIO.

Perhaps look at it from another perspective:

# put all the IDs we want into a hash (read from file)
my %want_id = .... ; 

foreach $seq (use Seq::IO to read large_fasta_file) {
  if $want_id{$seq->id} then
    use Seq::IO to write this $seq out
  end
}



-- 
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From cjfields at uiuc.edu  Thu Apr  6 00:28:12 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Wed, 5 Apr 2006 23:28:12 -0500
Subject: [Bioperl-l] Issue with Bio::SearchIO::psl (was: Bioperl bug
	1977)
In-Reply-To: <930B08C3-209D-4915-B86D-82CA2CF0E42B@cshl.edu>
References: <001901c65446$bfb0b270$15327e82@pyrimidine>
	<9AFA96E5-79BE-4BE7-8B33-F6C28012B929@cshl.edu>
	<6E8F6494-F5C9-4763-93D3-7A9B3F238821@uiuc.edu>
	<778E9E29-FA55-4288-8C3B-E386AC6A508A@uiuc.edu>
	<930B08C3-209D-4915-B86D-82CA2CF0E42B@cshl.edu>
Message-ID: <A895E9A5-7858-4CB0-ADE8-2E4A36C160E7@uiuc.edu>

As it turns out, the script you sent me back (the one which you said  
was mine) gave me the answer.  It's the -w flag in the shebang line.   
You had modified modified my script a bit by adding -w (I used 'use  
warnings' since -w gives a ton of debugging info on Windows).  I see  
the error popping up now on Mac (I haven't tried WinXP yet but will  
tomorrow).

I'll give it a closer look tomorrow.  I don't think the fix you  
suggested is the right one for now since it doesn't address the real  
problem (the parser doesn't 'see' the end of the report), but keep it  
in if it works for you.  Another workaround, w/o modifying  
Bio::SearchIO::psl, is to do this:

my $result = $parser->next_result;
while (my $hit = $result->next_hit) {
	print $hit->name,"\n";
	while (my $hsp = $hit->next_hsp) {
		print "    ",$hsp->score,"\n";
	}
}

which calls next_report only once.  I don't get the error with this.

Chris


On Apr 4, 2006, at 10:15 AM, Albert Vernon Smith wrote:

> I deleted all of my bioperl installation, and reinstalled to be
> certain that this is a current issue.  Having done that, I am still
> seeing the issue.  I also updated IO::Handle to the most recent
> version, on the off chance that it was something coming from there.
>
> -albert
>
>
> On 1.4.2006, at 06:54, Chris Fields wrote:
>
>> Albert,
>>
>> I had no problems with this on Mac OS X (I'm running from 10.4.5,
>> perl 5.8.6).  I noticed that several fixes were made in the last 6
>> months that would potentially fix this issue, including two which
>> involve newlines (that is what seems to be hanging things up
>> here).  Have you tried a full bioperl-live install to see if that
>> fixes it?
>>
>> computer:~/searchio_test cjfields$ perl psl.pl
>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>     100.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr21
>>     90.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr5
>>     85.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr13
>>     80.00
>> /usr/local/blat/db/hg17/hg17.2bit:chr7
>>     80.00
>>
>>
>> Chris
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From ch01ph14 at uohyd.ernet.in  Thu Apr  6 01:13:02 2006
From: ch01ph14 at uohyd.ernet.in (ch01ph14 at uohyd.ernet.in)
Date: Thu, 6 Apr 2006 10:43:02 +0530 (IST)
Subject: [Bioperl-l] MeltDNA: A software to prediction of DNA duplex
 stability and thermodynamics.
Message-ID: <56986.172.16.56.11.1144300382.squirrel@172.16.1.11>

                           Announcement
                           ------------
Dear All,

We are releasing the first version of MeltDNA. This can be downloaded from.

http://meltdna.sourceforge.net

                      Overview of the software
                      -------------------------

Prediction of DNA duplex stability and thermodynamics is invaluable for
many molecular biology applications involving sequence dependent
hybridization reactions. Sequence dependent stability of duplex DNA plays
a major role in fundamental processes of the living cell, such as
replication, transcription, and recombination. Many techniques in
molecular biology depend on the oligonucleotide melting temperature (Tm),
and several formulas have been developed to estimate Tm. We have developed
a Perl based tool to predict DNA duplex hybridization & melting
thermo-dynamics.
  This tool consider all factors those determine thermodynamic values
like-Base composition,NN parameters, salt dependency (Na+, Mg++),
internal mismatch, dangling ends ,loops etc. For improve NN(nearest
neighbour) model based calculations we introduced fusion matrices.
MeltDNA provides better prediction accuracy for DNA duplex hybridization
especially its ability to handle the structural features in DNA duplex
like loops, loop size etc. It has got wide applicability in primer
selection in PCR, probe selection in Microarrays, DNA secondary
structure stability prediction, DNA computing etc.

Comments are always welcome to improve the software quality.

Best Regards,
Sunil




From sdavis2 at mail.nih.gov  Thu Apr  6 06:45:37 2006
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Thu, 06 Apr 2006 06:45:37 -0400
Subject: [Bioperl-l] MeltDNA: A software to prediction of DNA duplex
 stability and thermodynamics.
In-Reply-To: <56986.172.16.56.11.1144300382.squirrel@172.16.1.11>
Message-ID: <C05A6991.9819%sdavis2@mail.nih.gov>

Sunil,

I just looked quickly but did not see a publication describing the methods
in detail or comparison with other methods.  Is such a document available?

Sean


On 4/6/06 1:13 AM, "ch01ph14 at uohyd.ernet.in" <ch01ph14 at uohyd.ernet.in>
wrote:

>                            Announcement
>                            ------------
> Dear All,
> 
> We are releasing the first version of MeltDNA. This can be downloaded from.
> 
> http://meltdna.sourceforge.net
> 
>                       Overview of the software
>                       -------------------------
> 
> Prediction of DNA duplex stability and thermodynamics is invaluable for
> many molecular biology applications involving sequence dependent
> hybridization reactions. Sequence dependent stability of duplex DNA plays
> a major role in fundamental processes of the living cell, such as
> replication, transcription, and recombination. Many techniques in
> molecular biology depend on the oligonucleotide melting temperature (Tm),
> and several formulas have been developed to estimate Tm. We have developed
> a Perl based tool to predict DNA duplex hybridization & melting
> thermo-dynamics.
>   This tool consider all factors those determine thermodynamic values
> like-Base composition,NN parameters, salt dependency (Na+, Mg++),
> internal mismatch, dangling ends ,loops etc. For improve NN(nearest
> neighbour) model based calculations we introduced fusion matrices.
> MeltDNA provides better prediction accuracy for DNA duplex hybridization
> especially its ability to handle the structural features in DNA duplex
> like loops, loop size etc. It has got wide applicability in primer
> selection in PCR, probe selection in Microarrays, DNA secondary
> structure stability prediction, DNA computing etc.
> 
> Comments are always welcome to improve the software quality.
> 
> Best Regards,
> Sunil
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From staffa at niehs.nih.gov  Thu Apr  6 10:25:09 2006
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C])
Date: Thu, 6 Apr 2006 10:25:09 -0400
Subject: [Bioperl-l] cut_seq in Bio::Tools::RestrictionEnzyme
Message-ID: <7930EE6CD7CA354D93B444D0433C061101D0862A@NIHCESMLBX6.nih.gov>

Please help me to understand the working of 
cut_seq in 
http://doc.bioperl.org/bioperl-live/Bio/Tools/RestrictionEnzyme.html#POD7
explicitly to extract the information contained in the return variable ---
some sort of reference to something. 
Documentation says
Title     : cut_seq
 Usage     : $re->cut_seq(<sequence object>);
 Purpose   : Conceptually cut or "digest" a DNA sequence with the given enzyme.
 Example   : $string = $re->cut_seq(<sequence object>); 
 Returns   : List of strings containing the resulting fragments.
 Argument  : Reference to a Bio::PrimarySeq.pm-derived object.

Eventually I want the length of the fragments.


Thank you.


Nick Staffa
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina



From georg.otto at tuebingen.mpg.de  Thu Apr  6 10:39:43 2006
From: georg.otto at tuebingen.mpg.de (Georg Otto)
Date: Thu, 06 Apr 2006 16:39:43 +0200
Subject: [Bioperl-l] StandAloneBlast on pre-formatted GenBank nt database
Message-ID: <m1d5fuzs28.fsf@tuebingen.mpg.de>

Hi,

I apologize if this is a FAQ, but I couldn't find a solution using google.

I downloaded the pre-formatted nt blast database from GenBank which is
split in five smaller databases with file extensions like this: nt.0[0-4].* 
It also comes with an alias file nt.nal
blastall works well like this:

blastall -p blastn -d nt

But unfortunately my Perl script, which starts a blast search using

Bio::Tools::Run::StandAloneBlast

and the same parameters as the blastall command above gives a warning
and an exception:

[blastall] WARNING: Could not find index files for database /Library/WebServer/Documents/blast/db/Volumes/Seahorse_HD2/blastdb/nt
[blastall] WARNING: BI867164: Could not find index files for database /Library/WebServer/Documents/blast/db/Volumes/Seahorse_HD2/blastdb/nt

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 /usr/local/bin/blastall -p  blastn  -d  "/Library/WebServer/Documents/blast/db/Volumes/Seahorse_HD2/blastdb/nt"  -i  /tmp/Wb5ThHwjEu  -o  /tmp/zvWomE5U3U 

STACK Bio::Tools::Run::StandAloneBlast::_runblast /Library/Perl/5.8.1/Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast /Library/Perl/5.8.1/Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall /Library/Perl/5.8.1/Bio/Tools/Run/StandAloneBlast.pm:536
STACK toplevel /Users/rglab/Georg/bin/run_blast.pl:53

--------------------------------------

The perl script works well with other databases, that are not split,
so my guess is that the blast search as it is called from bioperl can
not deal with the split database while blastall can.

Does anybody have an idea how to solve this?

Best,

Georg 


From cjfields at uiuc.edu  Thu Apr  6 11:56:58 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Apr 2006 10:56:58 -0500
Subject: [Bioperl-l] problems with blast parser
In-Reply-To: <4432909A.9030107@if.sc.usp.br>
Message-ID: <001701c65992$bcb873e0$15327e82@pyrimidine>

Alessandro,

We need to know a few things first:

1)  What version of Bioperl? 
2)  BLAST version?
3)  What OS?
4)  Perl version?
5)  Exactly how large is your file?

It would also be nice to see at least a chunk of your script to rule out a
logic error there.  If you want you can also submit your script by filing
this as a bug in Bugzilla and attaching your script.  

http://www.bioperl.org/wiki/Bugs

If you have an older version of Bioperl (such as 1.4) consider upgrading to
1.5.1 or CVS.  Lots of fixes have been incorporated since 1.4, including to
SearchIO.

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Alessandro S. Nascimento
> Sent: Tuesday, April 04, 2006 10:28 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] problems with blast parser
> 
> Hi all
> 
> I'm trying to parse a blast standalone (blaspgp) result file and filter
> some sequences using length and identity. The script used to work but
> this time after several minutes working in 99.9% of my processor I have
> a "killed"message with no more information. The blast file is very
> large. Does anyone have any clue ?
> 
> Thanks in advance
> 
> Alessandro
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From golharam at umdnj.edu  Thu Apr  6 11:34:57 2006
From: golharam at umdnj.edu (Ryan Golhar)
Date: Thu, 06 Apr 2006 11:34:57 -0400
Subject: [Bioperl-l] Getting sequences by ID
In-Reply-To: <1144275241.22967.7.camel@chauvel.csse.monash.edu.au>
Message-ID: <049c01c6598f$a9ca4a40$e6028a0a@GOLHARMOBILE1>

Here's how I'm doing it with bioperl, but with large genbank files (such
as chromosomes) it take a while:

my $inseq = Bio::SeqIO->new(...);
while (my $seqobj = $inseq->next_seq) {
	next if ($seqobj->accession ne $id);

	# process the sequence here
}


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Torsten
Seemann
Sent: Wednesday, April 05, 2006 6:14 PM
To: Yuval Itan
Cc: bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] Getting sequences by ID


On Wed, 2006-04-05 at 18:03 +0100, Yuval Itan wrote:
> I would be grateful for an advice from you regarding Bioperl, after I 
> was
> fiddling around trying to write the Perl script for that from scratch.
> I have a large fasta file of about 20,000 genes, and another file
which is a 
> list of about 2,000 gene IDs (no sequences), all included in the large
file. 
> I need to create a fasta file which will include only the genes with
these 
> specific 200 IDs. I was wondering if there is a method in Bioperl that
will 
> allow me to do the following pseudocode:
> 
> For each $ID from 200_IDs_set_file
> {
> 	$my_seq = get_sequence_by_ID(from large_fasta_file, $ID)
> 	write $my_seq into file
> }

There are many possibilities involving combinations of pure Perl and
BioPerl modules, and some even involving no Perl, but rather using
commands like 'formatdb' and 'fastacmd -s'. There are probably EMBOSS
solutions too.

Using your pseudo code, you could use Bio::Index::Fasta to index your
20,000 genes. Then loop over each ID, and retrieve the Seq via the
index, and write it out using Bio::SeqIO.

Perhaps look at it from another perspective:

# put all the IDs we want into a hash (read from file)
my %want_id = .... ; 

foreach $seq (use Seq::IO to read large_fasta_file) {
  if $want_id{$seq->id} then
    use Seq::IO to write this $seq out
  end
}



-- 
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From cjfields at uiuc.edu  Thu Apr  6 12:48:56 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Apr 2006 11:48:56 -0500
Subject: [Bioperl-l] cut_seq in Bio::Tools::RestrictionEnzyme
In-Reply-To: <7930EE6CD7CA354D93B444D0433C061101D0862A@NIHCESMLBX6.nih.gov>
Message-ID: <002c01c6599a$008f8840$15327e82@pyrimidine>

I believe Bio::Tools::RestrictionEnzyme is no longer maintained
(deprecated).  Use Bio::Restriction instead.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Staffa, Nick (NIH/NIEHS) [C]
> Sent: Thursday, April 06, 2006 9:25 AM
> To: bioperl-l
> Subject: [Bioperl-l] cut_seq in Bio::Tools::RestrictionEnzyme
> 
> Please help me to understand the working of
> cut_seq in
> http://doc.bioperl.org/bioperl-live/Bio/Tools/RestrictionEnzyme.html#POD7
> explicitly to extract the information contained in the return variable ---
> some sort of reference to something.
> Documentation says
> Title     : cut_seq
>  Usage     : $re->cut_seq(<sequence object>);
>  Purpose   : Conceptually cut or "digest" a DNA sequence with the given
> enzyme.
>  Example   : $string = $re->cut_seq(<sequence object>);
>  Returns   : List of strings containing the resulting fragments.
>  Argument  : Reference to a Bio::PrimarySeq.pm-derived object.
> 
> Eventually I want the length of the fragments.
> 
> 
> Thank you.
> 
> 
> Nick Staffa
> Telephone: 919-316-4569  (NIEHS: 6-4569)
> Scientific Computing Support Group
> NIEHS Information Technology Support Services Contract
> (Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
> National Institute of Environmental Health Sciences
> National Institutes of Health
> Research Triangle Park, North Carolina
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From jason.stajich at duke.edu  Thu Apr  6 13:30:17 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Thu, 6 Apr 2006 13:30:17 -0400
Subject: [Bioperl-l] problems with blast parser
In-Reply-To: <001701c65992$bcb873e0$15327e82@pyrimidine>
References: <001701c65992$bcb873e0$15327e82@pyrimidine>
Message-ID: <7C06C583-E84D-420A-8997-CB0F5F213C60@duke.edu>

I'm pretty sure for thousands of HSPs this can be an out of memory  
problem.  I've explained workarounds before on the list, but they  
basically mean building a new listener object that creates simple  
hashes (or arrays) instead of full-blown HSP objects.  Personally I  
use a hybrid approach depending on the dataset  - SearchIO can be too  
slow and too memory intensive for the cases where I am just getting  
top hits or summary stats, but if I want the alignment strings, more  
stats, etc then I use SearchIO.


The question is - do you really want to be parsing a huge file, can  
you get away with using tabular output (-m8 or -m9) from BLAST?  If  
you are balking at re-running the blast something like blast2table is  
simple pure-perl to generate an -m 8 tabular output from BLAST report  
very efficiently.  This is discussed on the bioperl BLAST wiki page I  
believe.


-jason
On Apr 6, 2006, at 11:56 AM, Chris Fields wrote:

> Alessandro,
>
> We need to know a few things first:
>
> 1)  What version of Bioperl?
> 2)  BLAST version?
> 3)  What OS?
> 4)  Perl version?
> 5)  Exactly how large is your file?
>
> It would also be nice to see at least a chunk of your script to  
> rule out a
> logic error there.  If you want you can also submit your script by  
> filing
> this as a bug in Bugzilla and attaching your script.
>
> http://www.bioperl.org/wiki/Bugs
>
> If you have an older version of Bioperl (such as 1.4) consider  
> upgrading to
> 1.5.1 or CVS.  Lots of fixes have been incorporated since 1.4,  
> including to
> SearchIO.
>
> Chris
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>> bounces at lists.open-bio.org] On Behalf Of Alessandro S. Nascimento
>> Sent: Tuesday, April 04, 2006 10:28 AM
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] problems with blast parser
>>
>> Hi all
>>
>> I'm trying to parse a blast standalone (blaspgp) result file and  
>> filter
>> some sequences using length and identity. The script used to work but
>> this time after several minutes working in 99.9% of my processor I  
>> have
>> a "killed"message with no more information. The blast file is very
>> large. Does anyone have any clue ?
>>
>> Thanks in advance
>>
>> Alessandro
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From cjfields at uiuc.edu  Thu Apr  6 13:42:16 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Apr 2006 12:42:16 -0500
Subject: [Bioperl-l] problems with blast parser
In-Reply-To: <7C06C583-E84D-420A-8997-CB0F5F213C60@duke.edu>
Message-ID: <002d01c659a1$72602c70$15327e82@pyrimidine>

I didn't think of that, but makes sense considering he mentioned the file is
huge and the process is killed off.  I agree with Jason, that tabular output
is probably the best way to go here.  

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: Jason Stajich [mailto:jason.stajich at duke.edu]
> Sent: Thursday, April 06, 2006 12:30 PM
> To: Chris Fields; Alessandro S. Nascimento
> Cc: BioPerl list
> Subject: Re: [Bioperl-l] problems with blast parser
> 
> I'm pretty sure for thousands of HSPs this can be an out of memory
> problem.  I've explained workarounds before on the list, but they
> basically mean building a new listener object that creates simple
> hashes (or arrays) instead of full-blown HSP objects.  Personally I
> use a hybrid approach depending on the dataset  - SearchIO can be too
> slow and too memory intensive for the cases where I am just getting
> top hits or summary stats, but if I want the alignment strings, more
> stats, etc then I use SearchIO.
> 
> 
> The question is - do you really want to be parsing a huge file, can
> you get away with using tabular output (-m8 or -m9) from BLAST?  If
> you are balking at re-running the blast something like blast2table is
> simple pure-perl to generate an -m 8 tabular output from BLAST report
> very efficiently.  This is discussed on the bioperl BLAST wiki page I
> believe.
> 
> 
> -jason
> On Apr 6, 2006, at 11:56 AM, Chris Fields wrote:
> 
> > Alessandro,
> >
> > We need to know a few things first:
> >
> > 1)  What version of Bioperl?
> > 2)  BLAST version?
> > 3)  What OS?
> > 4)  Perl version?
> > 5)  Exactly how large is your file?
> >
> > It would also be nice to see at least a chunk of your script to
> > rule out a
> > logic error there.  If you want you can also submit your script by
> > filing
> > this as a bug in Bugzilla and attaching your script.
> >
> > http://www.bioperl.org/wiki/Bugs
> >
> > If you have an older version of Bioperl (such as 1.4) consider
> > upgrading to
> > 1.5.1 or CVS.  Lots of fixes have been incorporated since 1.4,
> > including to
> > SearchIO.
> >
> > Chris
> >
> > Christopher Fields
> > Postdoctoral Researcher - Switzer Lab
> > Dept. of Biochemistry
> > University of Illinois Urbana-Champaign
> >
> >
> >> -----Original Message-----
> >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> >> bounces at lists.open-bio.org] On Behalf Of Alessandro S. Nascimento
> >> Sent: Tuesday, April 04, 2006 10:28 AM
> >> To: bioperl-l at lists.open-bio.org
> >> Subject: [Bioperl-l] problems with blast parser
> >>
> >> Hi all
> >>
> >> I'm trying to parse a blast standalone (blaspgp) result file and
> >> filter
> >> some sequences using length and identity. The script used to work but
> >> this time after several minutes working in 99.9% of my processor I
> >> have
> >> a "killed"message with no more information. The blast file is very
> >> large. Does anyone have any clue ?
> >>
> >> Thanks in advance
> >>
> >> Alessandro
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12



From cjfields at uiuc.edu  Thu Apr  6 20:40:56 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Thu, 6 Apr 2006 19:40:56 -0500
Subject: [Bioperl-l] Issue with Bio::SearchIO::psl (was: Bioperl bug
	1977)
In-Reply-To: <1F76C2A9-13CE-4AA5-A6D8-ABBD307538C5@cshl.edu>
References: <001901c65446$bfb0b270$15327e82@pyrimidine>
	<9AFA96E5-79BE-4BE7-8B33-F6C28012B929@cshl.edu>
	<6E8F6494-F5C9-4763-93D3-7A9B3F238821@uiuc.edu>
	<778E9E29-FA55-4288-8C3B-E386AC6A508A@uiuc.edu>
	<930B08C3-209D-4915-B86D-82CA2CF0E42B@cshl.edu>
	<A895E9A5-7858-4CB0-ADE8-2E4A36C160E7@uiuc.edu>
	<1F76C2A9-13CE-4AA5-A6D8-ABBD307538C5@cshl.edu>
Message-ID: <501A40D5-CEF9-4619-8178-FFCAC3DDD991@uiuc.edu>

I just committed a fix to Bio::SearchIO::psl.  It may take about 20  
minutes from now to update on CVS. This seems to work with or w/o the  
-w shebang flag on Mac OS X.

Let me know if you have more problems with it.

Chris

On Apr 6, 2006, at 3:19 AM, Albert Vernon Smith wrote:

> OK.  Neither you nor I put our shebang lines or the 'use' lines.   
> I'm always putting -w on the shebang line out of habit, and trying  
> to remove associated messages.  Makes things cleaner in the long  
> run.  I had always thought that -w was the same as 'use warnings',  
> but I've now learned it is not.  I don't get the message with 'use  
> warnings', so we are on the same page now.
>
> Thanks,
> -albert
>
>
> On 6.4.2006, at 04:28, Chris Fields wrote:
>
>> As it turns out, the script you sent me back (the one which you  
>> said was mine) gave me the answer.  It's the -w flag in the  
>> shebang line.  You had modified modified my script a bit by adding  
>> -w (I used 'use warnings' since -w gives a ton of debugging info  
>> on Windows).  I see the error popping up now on Mac (I haven't  
>> tried WinXP yet but will tomorrow).
>>
>> I'll give it a closer look tomorrow.  I don't think the fix you  
>> suggested is the right one for now since it doesn't address the  
>> real problem (the parser doesn't 'see' the end of the report), but  
>> keep it in if it works for you.  Another workaround, w/o modifying  
>> Bio::SearchIO::psl, is to do this:
>>
>> my $result = $parser->next_result;
>> while (my $hit = $result->next_hit) {
>> 	print $hit->name,"\n";
>> 	while (my $hsp = $hit->next_hsp) {
>> 		print "    ",$hsp->score,"\n";
>> 	}
>> }
>>
>> which calls next_report only once.  I don't get the error with this.
>

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From torsten.seemann at infotech.monash.edu.au  Thu Apr  6 21:35:08 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Fri, 07 Apr 2006 11:35:08 +1000
Subject: [Bioperl-l] MeltDNA: A software to prediction of DNA duplex
 stability and thermodynamics.
In-Reply-To: <C05A6991.9819%sdavis2@mail.nih.gov>
References: <C05A6991.9819%sdavis2@mail.nih.gov>
Message-ID: <4435C1CC.50009@infotech.monash.edu.au>

Sean,

> I just looked quickly but did not see a publication describing the methods
> in detail or comparison with other methods.  Is such a document available?

I tracked this down:

MeltDNA: A Tool for DNA Hybridization and Melting Thermodynamics Prediction, 
Abhishek  Tiwari and Vipin Wadhwa. Bioinformatics India Journal (Issue July-Sep 
2005)

The journal web site only has listings up to the April-June 2005 though.

http://www.bioinformaticscentre.org/journal/first_journal.asp

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/

From sonmitra at gmail.com  Fri Apr  7 04:04:20 2006
From: sonmitra at gmail.com (Sonmitra Mondal)
Date: Fri, 7 Apr 2006 13:34:20 +0530
Subject: [Bioperl-l] Problem in getting sbjctseq using remote Blast
Message-ID: <be9a1be60604070104p37817fcfw790afbb52d5a37bc@mail.gmail.com>

I am having problem while running Remote blast program for getting
hsp->sbjctseq . Rest of the program is running properly , but when we
want to fetch that sequence following error is generating
.-------------------- WARNING ---------------------
MSG: <HTML>
<HEAD><TITLE>An Error Occurred</TITLE></HEAD>
<BODY>
<H1>An Error Occurred</H1>
502 Bad Gateway
</BODY>
</HTML>

---------------------------------------------------
Error return code for BlastID code 1144396008-25960-52288961349.BLASTQ4 ...


I am using the following code :
use Bio::Perl;
use Bio::Tools::Run::RemoteBlast;

use Bio::SearchIO;

open (fh,">result.txt");
my (@params, $remote_blast_object, $blast_file, $r, $rc, $database);
my $sleep_time = 2;
$database = 'swissprot';
@params = (-prog=>'blastp', -data=>'swissprot', -expect=>'1e-10');
$remote_blast_object = Bio::Tools::Run::RemoteBlast->new(@params);
$blast_file = Bio::Root::IO->catfile("roa1.fasta");
$r = $remote_blast_object->submit_blast( $blast_file);
while ( my @rids = $remote_blast_object->each_rid ) {
foreach my $rid ( @rids ) {
my$rc = $remote_blast_object->retrieve_blast($rid);
if(!ref($rc) ) { # $rc not a reference => error or job not yet finished
if( $rc < 0 ) { $remote_blast_object->remove_rid($rid);
print "Error return code for BlastID code $rid ... \n";}
sleep $sleep_time; if ($sleep_time < 120) {$sleep_time *= 2;}
} else {
$sleep_time = 2;
$remote_blast_object->remove_rid($rid);
my $count = 0;
my $index=1;
while( my $res = $rc->next_result ) {
$count++;
#print "result db is ", $res->database_name(), "\n";


while( my $hit = $res->next_hit()) {


print fh $hit->name();
#print $hit->name(),"\t",$hit->description()," \t";
while( my $hsp = $hit->next_hsp ) {
#print "\t",$hsp->bits,
print  $hsp->evalue, "\t",$hsp->score;
print  "\n",$hsp->sbjctseq;
#print fh "\n", $hsp->match;
#print fh "\n", $hsp->positive;
}
print fh "\n";
}
close(fh);
}
}
}
}
-----------------------------------------------------------------------------------------------------------------

I am facing also another problem . When i am changing the parameter -
program as 'tblastn' , there's no output .


From avilella at gmail.com  Fri Apr  7 05:39:36 2006
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 07 Apr 2006 10:39:36 +0100
Subject: [Bioperl-l] trap warnings in eval?
Message-ID: <1144402776.7427.14.camel@localhost>

Hi all,

Short question:

What is the preferred way to trap a bioperl warning inside an eval
block?

Thanks in advance,

Bests,

    Albert.


From cjfields at uiuc.edu  Fri Apr  7 08:59:51 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Apr 2006 07:59:51 -0500
Subject: [Bioperl-l] trap warnings in eval?
In-Reply-To: <1144402776.7427.14.camel@localhost>
References: <1144402776.7427.14.camel@localhost>
Message-ID: <E98A220D-94D3-407E-B9A8-EEE09BEA6DC4@uiuc.edu>

There are a few examples here:

http://www.bioperl.org/wiki/Advanced_BioPerl#Throwing_Exceptions

Some of the scripts and tests in the bioperl core distribution also  
have examples of how this works.

bioperl-live/examples/root
various root tests in t/

Chris

On Apr 7, 2006, at 4:39 AM, Albert Vilella wrote:

> Hi all,
>
> Short question:
>
> What is the preferred way to trap a bioperl warning inside an eval
> block?
>
> Thanks in advance,
>
> Bests,
>
>     Albert.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From heikki at sanbi.ac.za  Fri Apr  7 09:12:51 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Fri, 7 Apr 2006 15:12:51 +0200
Subject: [Bioperl-l] trap warnings in eval?
In-Reply-To: <1144402776.7427.14.camel@localhost>
References: <1144402776.7427.14.camel@localhost>
Message-ID: <200604071512.51938.heikki@sanbi.ac.za>

Albert,

Change the verbosity of the the object to >=2 ,e.g.  $obj->verbose(2) and 
Bio::Root::RootI::warn()  will call throw instead - and which eval will trap 
it.

	-Heikki

On Friday 07 April 2006 11:39, Albert Vilella wrote:
> Hi all,
>
> Short question:
>
> What is the preferred way to trap a bioperl warning inside an eval
> block?
>
> Thanks in advance,
>
> Bests,
>
>     Albert.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________

From n.haigh at sheffield.ac.uk  Thu Apr  6 10:28:45 2006
From: n.haigh at sheffield.ac.uk (Nathan S. Haigh)
Date: Thu, 6 Apr 2006 15:28:45 +0100
Subject: [Bioperl-l] nt frequencies at 4 fold degenerate sites
Message-ID: <004c01c65986$69505580$9c5ea78f@bmbpc196>

A colleague would like to calculate the nt frequencies of 4 fold degenerate
sites of coding regions in a GenBank file. Does anyone know if there might
ba a script that can do this, or something similar that I might be able to
rip apart in order to do accomplish this? Any pointers to particular modules
that I might find useful for doing this would be good - I've been told not
to spend too much time on this.

 

Cheers

Nathan

 

----------------------------------

Nathan S. Haigh

Bioinformatics PostDoctoral Research Associate

 

Room B2 211

Department of Animal and Plant Sciences

University of Sheffield

Western Bank

Sheffield

S10 2TN

 

Tel: +44 (0)114 22 20112

Mob: +44 (0)7742 533 569

Fax: +44 (0)114 22 20002

 

---
avast! Antivirus: Outbound message clean.
Virus Database (VPS): 0614-0, 03/04/2006
Tested on: 06/04/2006 15:28:43
avast! - copyright (c) 1988-2006 ALWIL Software.
http://www.avast.com



  
-------------- next part --------------
A non-text attachment was scrubbed...
Name: n.haigh at sheffield.ac.uk.vcf
Type: text/x-vcard
Size: 811 bytes
Desc: not available
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20060406/026fbfbb/attachment.vcf 

From swansonj at email.arizona.edu  Fri Apr  7 02:12:04 2006
From: swansonj at email.arizona.edu (Jordan Mark Swanson)
Date: Thu, 06 Apr 2006 23:12:04 -0700
Subject: [Bioperl-l] Minor Bio::Tools::Run::Alignment::Muscle update
Message-ID: <443602B4.9020802@email.arizona.edu>

The muscle alignment program accepts a variable for a gap opening 
penalty.  In order to allow the Muscle bioperl-run module accept this 
argument, one can add
GAPOPEN to the @MUSCLE_PARAMS array on line 114 of  
Bio/Tools/Run/Alignment/Muscle.pm  . 

-- 
  Jordan Swanson
  swansonj at email.arizona.edu
  Genetics Graduate Interdisciplinary Program
  University of Arizona


From y.itan at ucl.ac.uk  Thu Apr  6 11:59:06 2006
From: y.itan at ucl.ac.uk (Yuval Itan)
Date: Thu, 6 Apr 2006 16:59:06 +0100
Subject: [Bioperl-l] Getting sequences by ID
In-Reply-To: <C05A8A0D.810E%osborne1@optonline.net>
References: <C05A8A0D.810E%osborne1@optonline.net>
Message-ID: <200604061659.06709.y.itan@ucl.ac.uk>

Thanks a lot for your help guys. Problem solved, although I did it in very 
non-elegant way mixing Bioperl and too many IOs... :

my $seqio_obj = Bio::SeqIO->new(-file => 
"/home/Yuval/unproc_pseudo.build35.cdna", -format => "fasta" ); 

#file to write into
my $seq_out = Bio::SeqIO->new(-file => 
">/home/Yuval/unproc_pseudo_truncated.build35.cdna", -format => "fasta");

while (my $seq_obj = $seqio_obj->next_seq) # reading ids from each gene in big 
file
{   
    my $temp2 = $seq_obj->display_id;
    open(FILE, "/home/Yuval/Pseudo_human35like_trunctuated_IDs.txt"); 
#trunctuated Ids
    while (<FILE>) #reading wanted ids
    {
	my $temp = $_;
	if ($temp =~ /$temp2/ || $temp2 =~ /$temp/) #id match
	{
	    $seq_out->write_seq($seq_obj); #writing the fasta truncated sequence
	}
    }
    close(FILE);
}

Cheers,

Yuval

On Thursday 06 April 2006 14:04, Brian Osborne wrote:
> Yuval,
>
> See:
>
> http://www.bioperl.org/wiki/HOWTO:Beginners#Indexing_for_Fast_Retrieval
>
> Also see:
>
> http://www.bioperl.org/wiki/Bioperl_scripts
>
>
> Brian O.
>
> On 4/5/06 6:00 PM, "Yuval Itan" <y.itan at ucl.ac.uk> wrote:
> > Hi Torsten,
> >
> > I would be grateful for an advice from you regarding Bioperl, after I was
> > fiddling around trying to write the Perl script for that from scratch.
> > I have a large fasta file of about 20,000 genes, and another file which
> > is a list of about 2,000 gene IDs (no sequences), all included in the
> > large file. I need to create a fasta file which will include only the
> > genes with these specific 200 IDs. I was wondering if there is a method
> > in Bioperl that will allow me to do the following pseudocode:
> >
> > For each $ID from 200_IDs_set_file
> > {
> > $my_seq = get_sequence_by_ID(from large_fasta_file, $ID)
> > write $my_seq into file
> > }
> >
> > Many thanks for any hint!
> >
> > Yuval
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l

From cjfields at uiuc.edu  Fri Apr  7 11:48:56 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 7 Apr 2006 10:48:56 -0500
Subject: [Bioperl-l] Problem in getting sbjctseq using remote Blast
In-Reply-To: <be9a1be60604070104p37817fcfw790afbb52d5a37bc@mail.gmail.com>
Message-ID: <000f01c65a5a$c79e88d0$15327e82@pyrimidine>

I only sporadically got the error you stated ("502 Bad Gateway"), which can
happen if the remote BLAST server is extremely busy.  The main error I saw
was an message saying it did not find method 'sbjctseq':

Can't locate object method "sbjctseq" via package
"Bio::Search::HSP::GenericHSP" at C:\Perl\Scripts\blast test\test.pl line
41, <GEN7> line 1336.

The reason you can't find it is b/c there is no 'sbjctseq' method for
GenericHSP objects.  This is left over from when Bio::Tools::BPLite was used
for parsing remote BLAST reports; BPLite is now deprecated in favour of
Bio::SearchIO.  We would like to know where you found this in the
documentation so it can be changed.

Try this instead:

$hsp->hit_string;

You do have a few more problems here.  Although this script works, using
Bio::Perl in combination with Bio::Tools::Run::RemoteBlast and Bio::SearchIO
is a bit redundant; Bio::Perl 'uses' methods from
Bio::Tools::Run::RemoteBlast, which 'uses' methods from Bio::SearchIO.  

For your example you should probably not use Bio::Perl to retrieve your
sequence since you're parsing remote BLAST output.  Bio::SeqIO is more
direct; use it instead.  Try this:

use Bio::Tools::Run::RemoteBlast;
use Bio::SeqIO;

my ( @params, $remote_blast_object, $blast_file, $r, $rc, $database);
my $sleep_time = 2;
open (fh, ">result.txt");
@params = (-verbose=>1, -prog=>'blastp', -data=>'swissprot',
-expect=>'1e-10');
$remote_blast_object = Bio::Tools::Run::RemoteBlast->new(@params);
$blast_file = Bio::SeqIO->new(-file    => '< roa1.fasta',
                              -format  => 'fasta');
$r = $remote_blast_object->submit_blast($blast_file->next_seq);
while ( my  @rids = $remote_blast_object->each_rid ) {
......


One final thing: remote BLAST output breaks bioperl v 1.5.1 text parsing.
You may need to upgrade your Bio::SearchIO::blast to the latest in CVS.


Chris


Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Sonmitra Mondal
> Sent: Friday, April 07, 2006 3:04 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Problem in getting sbjctseq using remote Blast
> 
> I am having problem while running Remote blast program for getting
> hsp->sbjctseq . Rest of the program is running properly , but when we
> want to fetch that sequence following error is generating
> .-------------------- WARNING ---------------------
> MSG: <HTML>
> <HEAD><TITLE>An Error Occurred</TITLE></HEAD>
> <BODY>
> <H1>An Error Occurred</H1>
> 502 Bad Gateway
> </BODY>
> </HTML>
> 
> ---------------------------------------------------
> Error return code for BlastID code 1144396008-25960-52288961349.BLASTQ4
> ...
> 
> 
> I am using the following code :
> use Bio::Perl;
> use Bio::Tools::Run::RemoteBlast;
> 
> use Bio::SearchIO;
> 
> open (fh,">result.txt");
> my (@params, $remote_blast_object, $blast_file, $r, $rc, $database);
> my $sleep_time = 2;
> $database = 'swissprot';
> @params = (-prog=>'blastp', -data=>'swissprot', -expect=>'1e-10');
> $remote_blast_object = Bio::Tools::Run::RemoteBlast->new(@params);
> $blast_file = Bio::Root::IO->catfile("roa1.fasta");
> $r = $remote_blast_object->submit_blast( $blast_file);
> while ( my @rids = $remote_blast_object->each_rid ) {
> foreach my $rid ( @rids ) {
> my$rc = $remote_blast_object->retrieve_blast($rid);
> if(!ref($rc) ) { # $rc not a reference => error or job not yet finished
> if( $rc < 0 ) { $remote_blast_object->remove_rid($rid);
> print "Error return code for BlastID code $rid ... \n";}
> sleep $sleep_time; if ($sleep_time < 120) {$sleep_time *= 2;}
> } else {
> $sleep_time = 2;
> $remote_blast_object->remove_rid($rid);
> my $count = 0;
> my $index=1;
> while( my $res = $rc->next_result ) {
> $count++;
> #print "result db is ", $res->database_name(), "\n";
> 
> 
> while( my $hit = $res->next_hit()) {
> 
> 
> print fh $hit->name();
> #print $hit->name(),"\t",$hit->description()," \t";
> while( my $hsp = $hit->next_hsp ) {
> #print "\t",$hsp->bits,
> print  $hsp->evalue, "\t",$hsp->score;
> print  "\n",$hsp->sbjctseq;
> #print fh "\n", $hsp->match;
> #print fh "\n", $hsp->positive;
> }
> print fh "\n";
> }
> close(fh);
> }
> }
> }
> }
> --------------------------------------------------------------------------
> ---------------------------------------
> 
> I am facing also another problem . When i am changing the parameter -
> program as 'tblastn' , there's no output .
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From staffa at niehs.nih.gov  Fri Apr  7 11:44:30 2006
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C])
Date: Fri, 7 Apr 2006 11:44:30 -0400
Subject: [Bioperl-l] Bio::Restriction::Enzyme exception due to
	Bio::PrimarySeq
Message-ID: <7930EE6CD7CA354D93B444D0433C061101D08631@NIHCESMLBX6.nih.gov>

Well!
What to do when hit with this sort of message?
I am not working with any circular sequences.

line 46 is
my @frags=$ra->fragments($enz);


------------- EXCEPTION  -------------
MSG: Abstract method "Bio::PrimarySeqI::is_circular" is not implemented by package Bio::PrimarySeq::Fasta.
This is not your fault - author of Bio::PrimarySeq::Fasta should be blamed!

STACK Bio::Root::RootI::throw_not_implemented /usr/lib/perl5/site_perl/5.8.5/Bio/Root/RootI.pm:523
STACK Bio::PrimarySeqI::is_circular /usr/lib/perl5/site_perl/5.8.5/Bio/PrimarySeqI.pm:671
STACK Bio::Restriction::Analysis::_cuts /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:807
STACK Bio::Restriction::Analysis::cut /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:370
STACK Bio::Restriction::Analysis::fragments /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:443
STACK toplevel TestNew.pl:46

--------------------------------------
 <<TestNew.pl>> 


Nick Staffa
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina



-------------- next part --------------
A non-text attachment was scrubbed...
Name: TestNew.pl
Type: application/applefile
Size: 1416 bytes
Desc: TestNew.pl
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20060407/513a2f44/attachment.bin 

From jason at bioperl.org  Fri Apr  7 09:50:30 2006
From: jason at bioperl.org (Jason Stajich)
Date: Fri, 7 Apr 2006 09:50:30 -0400
Subject: [Bioperl-l] Interpretation of percentage_idendity
In-Reply-To: <44367180.8040601@agrar.hu-berlin.de>
References: <44367180.8040601@agrar.hu-berlin.de>
Message-ID: <9266E3B0-CDAD-4716-B2E5-4DED31ADAC26@bioperl.org>

These methods are really more for multiple sequence alignment than  
pairwise identities.  Although I guess we don't  have anywhere else  
that calculates percent ID for a pair of  sequences in an alignment -  
would be nice for someone to add that.

First off, percentage_identity is an alias for  
average_percentage_identity - this has to do with preserving the  
function names that existed before there where two methods.

There are only really two implementations to concentrate on.

average_percentage_identity
overall_percentage_identity

The documentation for Bio::SimpleAlign gives you some hints about how  
each works

overall is just the overall number of columns that are identical so  
it is very conservative.


Here is the pertinent documentation for average_percent_identity

Function: The function uses a fast method to calculate the average  
percentage identity of the alignment
Notes   : This method implemented by Kevin Howe calculates a figure  
that is
            designed to be similar to the average pairwise identity  
of the
            alignment (identical in the absence of gaps), without  
having to
            explicitly calculate pairwise identities proposed by  
Richard Durbin.
            Validated by Ewan Birney ad Alex Bateman.


If someone wants to put some except of this on the SimpleAlign wiki  
page that would be awesome.

-jason
On Apr 7, 2006, at 10:04 AM, Armin Schmitt wrote:

> Dear Jason,
>
> I need some help with the interpretation of
> the results from all three percentage_identity
> variants offered in the Bioperl module AlignI.pm
>
> - percentage_identity
> - average_percentage_identity
> - overall_percentage_identity
>
> Please understand that I am not a Perl expert,
> so I am not able to get the meaning from the
> source code.
>
> By percentage identity for a 2 sequence alignment
> I undertand the proportion of matching amino acids
> of the total length.
>
> But I suspect that this is different now?
>
> Thank you very much
>
> Armin Schmitt
>
> -- 
> Dr. Armin Schmitt
> Z?chtungsbiologie und molekulare Genetik
> Institut f?r Nutztierwissenschaften
> Humboldt-Universit?t zu Berlin
> Invalidenstra?e 42
> 10115 Berlin
>
> Breeding Biology and Molecular Genetics
> Institute for Animal Sciences
> Humboldt-Universit?t zu Berlin
> Invalidenstra?e 42
> 10115 Berlin
> Germany
>
> Tel:    +49 30 2093 9074
> Fax:	+49 30 2093 6397
> http://www.agrar.hu-berlin.de/nutztier/zb/
>
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12




From avilella at gmail.com  Fri Apr  7 13:11:30 2006
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 07 Apr 2006 18:11:30 +0100
Subject: [Bioperl-l] Minor Bio::Tools::Run::Alignment::Muscle update
In-Reply-To: <443602B4.9020802@email.arizona.edu>
References: <443602B4.9020802@email.arizona.edu>
Message-ID: <1144429890.6012.8.camel@localhost>

added. haven't tested at all.

    Albert.

On Thu, 2006-04-06 at 23:12 -0700, Jordan Mark Swanson wrote:
> The muscle alignment program accepts a variable for a gap opening 
> penalty.  In order to allow the Muscle bioperl-run module accept this 
> argument, one can add
> GAPOPEN to the @MUSCLE_PARAMS array on line 114 of  
> Bio/Tools/Run/Alignment/Muscle.pm  . 
> 




From osborne1 at optonline.net  Fri Apr  7 15:26:43 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri, 07 Apr 2006 15:26:43 -0400
Subject: [Bioperl-l] Bio::Restriction::Enzyme exception due to
 Bio::PrimarySeq
In-Reply-To: <7930EE6CD7CA354D93B444D0433C061101D08631@NIHCESMLBX6.nih.gov>
Message-ID: <C05C3533.815C%osborne1@optonline.net>

Nick,

Minor bug in Bio::DB::Fasta, now fixed. Either install the latest BioPerl or
copy the latest Bio/DB/Fasta.pm from CVS.

Brian O.


On 4/7/06 11:44 AM, "Staffa, Nick (NIH/NIEHS) [C]" <staffa at niehs.nih.gov>
wrote:

> Well!
> What to do when hit with this sort of message?
> I am not working with any circular sequences.
> 
> line 46 is
> my @frags=$ra->fragments($enz);
> 
> 
> ------------- EXCEPTION  -------------
> MSG: Abstract method "Bio::PrimarySeqI::is_circular" is not implemented by
> package Bio::PrimarySeq::Fasta.
> This is not your fault - author of Bio::PrimarySeq::Fasta should be blamed!
> 
> STACK Bio::Root::RootI::throw_not_implemented
> /usr/lib/perl5/site_perl/5.8.5/Bio/Root/RootI.pm:523
> STACK Bio::PrimarySeqI::is_circular
> /usr/lib/perl5/site_perl/5.8.5/Bio/PrimarySeqI.pm:671
> STACK Bio::Restriction::Analysis::_cuts
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:807
> STACK Bio::Restriction::Analysis::cut
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:370
> STACK Bio::Restriction::Analysis::fragments
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:443
> STACK toplevel TestNew.pl:46
> 
> --------------------------------------
>  <<TestNew.pl>> 
> 
> 
> Nick Staffa
> Telephone: 919-316-4569  (NIEHS: 6-4569)
> Scientific Computing Support Group
> NIEHS Information Technology Support Services Contract
> (Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
> National Institute of Environmental Health Sciences
> National Institutes of Health
> Research Triangle Park, North Carolina
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From mblanche at berkeley.edu  Fri Apr  7 21:54:21 2006
From: mblanche at berkeley.edu (Marco Blanchette)
Date: Fri, 07 Apr 2006 18:54:21 -0700
Subject: [Bioperl-l] Display of gff annotation
Message-ID: <C05C65DD.6037%mblanche@berkeley.edu>

Dear all--

I have a gff annotation in the form of:

##gff-version 2
# seqname    source    feature    start    end    score    strand    frame
attributes
AF260530 (    -    exon    262    693    .    +    .    note "1"
AF260530 (    -    exon    4450    4630    .    +    .    note "2"
AF260530 (    -    exon    13432    13776    .    +    .    note "3"
AF260530 (    -    exon    15198    15359    .    +    .    note "4.1"
AF260530 (    -    exon    15537    15698    .    +    .    note "4.2"
AF260530 (    -    exon    16060    16221    .    +    .    note "4.3"
AF260530 (    -    exon    16682    16852    .    +    .    note "4.4"
AF260530 (    -    exon    16985    17146    .    +    .    note "4.5"
AF260530 (    -    exon    16985    17146    .    +    .    note "5"


Where the value of the tag 'note' is the exon name. all exons with a decimal
annotation are alternatively spliced exon. My goal would be to display the
alternative exons in a different color (let say red) than the constitutive
exons (let say blue).

I have this script:
#!/usr/bin/perl

use strict;
use Bio::Tools::GFF;
use Bio::Graphics;
use Bio::SeqFeature::Generic;


my $gffio = Bio::Tools::GFF->new(-file => $ARGV[0],
                                 -gff_version => 2,
                                );

my $feat_o = Bio::SeqFeature::Generic->new(-name => 'aGene');

while (my $feature = $gffio->next_feature) {
        $feat_o->add_SeqFeature($feature,'EXPAND');
}

my $panel = Bio::Graphics::Panel->new(
                  -length => $feat_o->end,
                  -width  => 1500,
                  -pad_left => 10,
                  -pad_right => 10,
                 );

my $full_length = Bio::SeqFeature::Generic->new(-start=>1,
                                                -end=>$feat_o->end);

$panel->add_track($full_length,
          -glyph   => 'arrow',
          -tick    => 2,
          -fgcolor => 'black',
          -double  => 1,
                        );

$panel->add_track($feat_o,
                    -glyph=> 'segments');
print $panel->png


That does almost what I need. My questions are:
1) is there a better way to transform the GFF file into a SeqFeature object
than the while loop that I am using

2) How could I tell the Bio::Graphics::Panel object to color the exon with a
'.' in red and the others in blue.

Many thanks all

Marco



Marco Blanchette, Ph.D.

mblanche at berkeley.edu

Donald C. Rio's lab
Department of Molecular and Cell Biology
16 Barker Hall
University of California
Berkeley, CA 94720-3204

Tel: (510) 642-1084
Cell: (510) 847-0996
Fax: (510) 642-6062






From mblanche at berkeley.edu  Sat Apr  8 12:21:59 2006
From: mblanche at berkeley.edu (Marco Blanchette)
Date: Sat, 08 Apr 2006 09:21:59 -0700
Subject: [Bioperl-l] Display of gff annotation
In-Reply-To: <1144464582.28535.220.camel@localhost.localdomain>
Message-ID: <C05D3137.604B%mblanche@berkeley.edu>

Many Thanks Scott,

Everything works perfectly [although I had to change the
$feature->attributes('note') to $feature->get_tag_values('note')].

My new goal now is to add, under the gene structure, binding sites hits in
the form of a diamond glyph with their color representing the score of the
binding site.

I am trying to use:
 
my ($hits, $min, $max) = hits2feat ($hits_File);

$panel->add_track(  diamond => $hits,
                    -height => 6,
                    ############
                    #-bgcolor => sub{ my $feature = shift;
                    #                 should be able to use
                    #                 value of -score to set
                    #                 the color value
                    #
                    ############    }
                    );



Where the subroutine hits2feat() return a Bio::SeqFeature::Generic object
with the start, end and score of the feature set to the different binding
site hits and score. In addition it returns the smallest and largest score
values of the different hits.

My goal would be to set, probably using a callback, the bgcolor accordingly
to the score value in a green to red gradient where green represent the $min
and red the $max value.

Many thanks.

Marco.


On 4/7/06 7:49 PM, "Scott Cain" <cain at cshl.edu> wrote:

> Hi Marco,
> 
> In answer to your questions:
> 
> 1. You might find it easier to use Bio::DB::GFF with you gff file; you
> can use the 'memory' adaptor to have it use a file instead of a 'real'
> database.  It will give you Bio::DB::GFF::Feature objects which you can
> use in the same was as your Bio::SeqFeature::Generic objects.
> 
> 2. To color your exons differently, you can use a callback in the
> bgcolor attribute:
> 
> $panel->add_track($full_length,
>           -glyph   => 'arrow',
>           -tick    => 2,
>           -fgcolor => 'black',
>           -double  => 1,
>           -bgcolor => sub {
>                  my $feature = shift;
>                  my ($note)  = $feature->attributes('note');
>                  if ($note =~ /\./) {
>                       return 'red';
>                  }
>                  else {
>                       return 'blue';
>                  }
>             }
>        );
> 
> My only comment is that your GFF is a little funny looking: the "(   -"
> in the source column might result in some strange behavior.
> 
> Scott
> 
> 
> On Fri, 2006-04-07 at 18:54 -0700, Marco Blanchette wrote:
>> Dear all--
>> 
>> I have a gff annotation in the form of:
>> 
>> ##gff-version 2
>> # seqname    source    feature    start    end    score    strand    frame
>> attributes
>> AF260530 (    -    exon    262    693    .    +    .    note "1"
>> AF260530 (    -    exon    4450    4630    .    +    .    note "2"
>> AF260530 (    -    exon    13432    13776    .    +    .    note "3"
>> AF260530 (    -    exon    15198    15359    .    +    .    note "4.1"
>> AF260530 (    -    exon    15537    15698    .    +    .    note "4.2"
>> AF260530 (    -    exon    16060    16221    .    +    .    note "4.3"
>> AF260530 (    -    exon    16682    16852    .    +    .    note "4.4"
>> AF260530 (    -    exon    16985    17146    .    +    .    note "4.5"
>> AF260530 (    -    exon    16985    17146    .    +    .    note "5"
>> 
>> 
>> Where the value of the tag 'note' is the exon name. all exons with a decimal
>> annotation are alternatively spliced exon. My goal would be to display the
>> alternative exons in a different color (let say red) than the constitutive
>> exons (let say blue).
>> 
>> I have this script:
>> #!/usr/bin/perl
>> 
>> use strict;
>> use Bio::Tools::GFF;
>> use Bio::Graphics;
>> use Bio::SeqFeature::Generic;
>> 
>> 
>> my $gffio = Bio::Tools::GFF->new(-file => $ARGV[0],
>>                                  -gff_version => 2,
>>                                 );
>> 
>> my $feat_o = Bio::SeqFeature::Generic->new(-name => 'aGene');
>> 
>> while (my $feature = $gffio->next_feature) {
>>         $feat_o->add_SeqFeature($feature,'EXPAND');
>> }
>> 
>> my $panel = Bio::Graphics::Panel->new(
>>                   -length => $feat_o->end,
>>                   -width  => 1500,
>>                   -pad_left => 10,
>>                   -pad_right => 10,
>>                  );
>> 
>> my $full_length = Bio::SeqFeature::Generic->new(-start=>1,
>>                                                 -end=>$feat_o->end);
>> 
>> $panel->add_track($full_length,
>>           -glyph   => 'arrow',
>>           -tick    => 2,
>>           -fgcolor => 'black',
>>           -double  => 1,
>>                         );
>> 
>> $panel->add_track($feat_o,
>>                     -glyph=> 'segments');
>> print $panel->png
>> 
>> 
>> That does almost what I need. My questions are:
>> 1) is there a better way to transform the GFF file into a SeqFeature object
>> than the while loop that I am using
>> 
>> 2) How could I tell the Bio::Graphics::Panel object to color the exon with a
>> '.' in red and the others in blue.
>> 
>> Many thanks all
>> 
>> Marco
>> 
>> 
>> 
>> Marco Blanchette, Ph.D.
>> 
>> mblanche at berkeley.edu
>> 
>> Donald C. Rio's lab
>> Department of Molecular and Cell Biology
>> 16 Barker Hall
>> University of California
>> Berkeley, CA 94720-3204
>> 
>> Tel: (510) 642-1084
>> Cell: (510) 847-0996
>> Fax: (510) 642-6062
>> 
>> 
>> 
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l


Marco Blanchette, Ph.D.

mblanche at berkeley.edu

Donald C. Rio's lab
Department of Molecular and Cell Biology
16 Barker Hall
University of California
Berkeley, CA 94720-3204

Tel: (510) 642-1084
Cell: (510) 847-0996
Fax: (510) 642-6062






From iain.m.wallace at gmail.com  Sat Apr  8 12:29:08 2006
From: iain.m.wallace at gmail.com (Iain Wallace)
Date: Sat, 8 Apr 2006 17:29:08 +0100
Subject: [Bioperl-l]  SimpleAlign Question
Message-ID: <8cff3eb80604080929o5e2badf8kf31e3be48e87ea62@mail.gmail.com>

Hi all,

I am trying to extract slices out of an alignment, but sometimes the
slice I am trying to take contains a sequence that has no residues. I
would still like to add this sequence, unfortunately I am getting this
error

------------- EXCEPTION  -------------
MSG: Got a sequence with no letters in it cannot guess alphabet []
STACK Bio::PrimarySeq::_guess_alphabet
/usr/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm:837
STACK Bio::PrimarySeq::seq /usr/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm:279
STACK Bio::SimpleAlign::slice
/usr/lib/perl5/site_perl/5.8.0/Bio/SimpleAlign.pm:794

Is there a simple way I can override this behaviour, which I think is
just validating the sequence before it adds it to the alignment.

The code I am usinge is below followed by a test alignment,

Thanks for any help

Iain
--script
use strict;

use Bio::AlignIO;
#read in the initial alignment from the command line.

my $in = $ARGV[0];

my $alignio = Bio::AlignIO->new(-file=> $in);
my $out = Bio::AlignIO->new(-file=> ">test.fasta");

       my $aln = $alignio->next_aln;
       my $new_aln = new Bio::SimpleAlign;
       $new_aln=$aln->slice(1,10);
       $out->write_aln($new_aln);

--sample file

>1huma/1-7
APMGSDP---
>1b3aa/1-5
-PYSS-D---
>2eot/1-5
-----GPASV
>1rhpa/1-1
---------D
>1mgsa/1-6
----ASVATE
>1mi2a/1-6
----AVVASE
>1roda/1-4
------SAKE
>1il8a/1-3
-------AKE
>1sdf/1-6
----KPVSLS


From staffa at niehs.nih.gov  Fri Apr  7 14:38:52 2006
From: staffa at niehs.nih.gov (Staffa, Nick (NIH/NIEHS) [C])
Date: Fri, 7 Apr 2006 14:38:52 -0400
Subject: [Bioperl-l] Bio::Restriction::Enzyme exception due to
	Bio::PrimarySeq
Message-ID: <7930EE6CD7CA354D93B444D0433C061101D08635@NIHCESMLBX6.nih.gov>

Maybe this message won't have the suspicious header that got it bounced.


Well!
What to do when hit with this sort of message?
I am not working with any circular sequences.

line 46 is
my @frags=$ra->fragments($enz);


------------- EXCEPTION  -------------
MSG: Abstract method "Bio::PrimarySeqI::is_circular" is not implemented by package Bio::PrimarySeq::Fasta.
This is not your fault - author of Bio::PrimarySeq::Fasta should be blamed!

STACK Bio::Root::RootI::throw_not_implemented /usr/lib/perl5/site_perl/5.8.5/Bio/Root/RootI.pm:523
STACK Bio::PrimarySeqI::is_circular /usr/lib/perl5/site_perl/5.8.5/Bio/PrimarySeqI.pm:671
STACK Bio::Restriction::Analysis::_cuts /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:807
STACK Bio::Restriction::Analysis::cut /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:370
STACK Bio::Restriction::Analysis::fragments /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:443
STACK toplevel TestNew.pl:46

--------------------------------------
 <<TestNew.pl>> 


Nick Staffa
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Jack L. Field (field1 at niehs.nih.gov ))
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina



-------------- next part --------------
A non-text attachment was scrubbed...
Name: TestNew.pl
Type: application/octet-stream
Size: 1284 bytes
Desc: TestNew.pl
Url : http://lists.open-bio.org/pipermail/bioperl-l/attachments/20060407/f1af0cfd/attachment.obj 

From e.rapsomaniki at mail.cryst.bbk.ac.uk  Sat Apr  8 09:08:00 2006
From: e.rapsomaniki at mail.cryst.bbk.ac.uk (e.rapsomaniki at mail.cryst.bbk.ac.uk)
Date: Sat,  8 Apr 2006 14:08:00 +0100
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
Message-ID: <1144501680.4437b5b02dff4@webmail.cryst.bbk.ac.uk>


Hi

I am trying to retrieve coding sequences associated with RefSeq proteins. My
code (below) works for non-refseq proteins (e.g BAB26271) but not for refseq
(no sequence
features are retrieved although I checked the web-page and a coded_by feature
should be there). Any suggestions? I am using bioperl 1.4

Here's my code:
use Bio::Seq;
use Bio::DB::GenPept;
use Bio::DB::GenBank;
use Bio::DB::RefSeq; 
my $gb = new Bio::DB::GenBank;
my $gp = new Bio::DB::RefSeq;		
my $prot_obj = $gp->get_Seq_by_acc("NP_001008293");	
return unless defined($prot_obj);
		
# factory to turn strings into Bio::Location objects
my $loc_factory = new Bio::Factory::FTLocationFactory;
my $orf;
	
my @f=$prot_obj->top_SeqFeatures();
print "@f\n"; #returns nothing
foreach my $feat ( $prot_obj->top_SeqFeatures ) {
print  $feat->primary_tag, "\n";
	if ( $feat->primary_tag eq 'CDS' ) {
		
	   my @coded_by = $feat->each_tag_value('coded_by');
	   print @coded_by, "\n";
	   my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
	   #$nuc_acc=~ s/\..*//;
	   my $nuc_obj = $gb->get_Seq_by_acc($nuc_acc);
	   return unless defined($nuc_obj);
	   my $loc_object = $loc_factory->from_string($loc_str);
	   # create a Feature object by using a Location
	   my $feat_obj = new Bio::SeqFeature::Generic(-location =>$loc_object);
	   # associate the Feature object with the nucleotide Seq object
	   $nuc_obj->add_SeqFeature($feat_obj);
	   my $cds_obj = $feat_obj->spliced_seq;
	   $orf=$cds_obj->seq;
	}
}
print "$orf\n";


----------------------------------------------------------------
This message was sent using IMP, the Internet Messaging Program.

From cjfields at uiuc.edu  Sun Apr  9 12:26:38 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 9 Apr 2006 11:26:38 -0500
Subject: [Bioperl-l] Bio::Restriction::Enzyme exception due
	toBio::PrimarySeq
In-Reply-To: <7930EE6CD7CA354D93B444D0433C061101D08635@NIHCESMLBX6.nih.gov>
Message-ID: <000c01c65bf2$6094de20$15327e82@pyrimidine>

Nick,

I believe Brian fixed this in the last few days (after you posted this this
first time).  

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Staffa, Nick (NIH/NIEHS) [C]
> Sent: Friday, April 07, 2006 1:39 PM
> To: bioperl-l at bioperl.org
> Subject: [Bioperl-l] Bio::Restriction::Enzyme exception due
> toBio::PrimarySeq
> 
> Maybe this message won't have the suspicious header that got it bounced.
> 
> 
> Well!
> What to do when hit with this sort of message?
> I am not working with any circular sequences.
> 
> line 46 is
> my @frags=$ra->fragments($enz);
> 
> 
> ------------- EXCEPTION  -------------
> MSG: Abstract method "Bio::PrimarySeqI::is_circular" is not implemented by
> package Bio::PrimarySeq::Fasta.
> This is not your fault - author of Bio::PrimarySeq::Fasta should be
> blamed!
> 
> STACK Bio::Root::RootI::throw_not_implemented
> /usr/lib/perl5/site_perl/5.8.5/Bio/Root/RootI.pm:523
> STACK Bio::PrimarySeqI::is_circular
> /usr/lib/perl5/site_perl/5.8.5/Bio/PrimarySeqI.pm:671
> STACK Bio::Restriction::Analysis::_cuts
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:807
> STACK Bio::Restriction::Analysis::cut
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:370
> STACK Bio::Restriction::Analysis::fragments
> /usr/lib/perl5/site_perl/5.8.5/Bio/Restriction/Analysis.pm:443
> STACK toplevel TestNew.pl:46
> 
> --------------------------------------
>  <<TestNew.pl>>
> 
> 
> Nick Staffa
> Telephone: 919-316-4569  (NIEHS: 6-4569)
> Scientific Computing Support Group
> NIEHS Information Technology Support Services Contract
> (Science Task Monitor: Jack L. Field (field1 at niehs.nih.gov ))
> National Institute of Environmental Health Sciences
> National Institutes of Health
> Research Triangle Park, North Carolina
> 
> 



From cjfields at uiuc.edu  Sun Apr  9 13:22:49 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 9 Apr 2006 12:22:49 -0500
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <1144501680.4437b5b02dff4@webmail.cryst.bbk.ac.uk>
Message-ID: <000d01c65bfa$3b31f840$15327e82@pyrimidine>

That's because Bio::DB::RefSeq retrieves the data from EBI, not from NCBI.
The EBI version has no seq. features but the NCBI version does (I believe
NCBI adds them provisionally).  Retrieving via Bio::DB::GenBank is the way
to go, but you must add the -no_redirect flag to prevent Bio::DB::GenBank
from redirecting to Bio::DB::RefSeq:

my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
my $seq = $factory->get_Sec_by_acc(' NM_001008292');

As a warning, RefSeqs are nonstandard GenBank, but I believe I have parsed
them for seq features before w/o problems.  From perldoc for
Bio::DB::RefSeq:

DESCRIPTION
    Allows the dynamic retrieval of sequence objects Bio::Seq from the
    RefSeq database using the dbfetch script at EBI:
    <http://www.ebi.ac.uk/cgi-bin/dbfetch>.

    In order to make changes transparent we have host type (currently only
    ebi) and location (defaults to ebi) separated out. This allows later
    additions of more servers in different geographical locations.

    The functionality of this module is inherited from Bio::DB::DBFetch
    which implements Bio::DB::WebDBSeqI.

    This module retrieves entries from EBI although it retrives database
    entries produced at NCBI. When read into bioperl objects, the parser for
    GenBank format it used. RefSeq is a NONSTANDARD GenBank file so be ready
    for surprises.

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of
> e.rapsomaniki at mail.cryst.bbk.ac.uk
> Sent: Saturday, April 08, 2006 8:08 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
> 
> 
> Hi
> 
> I am trying to retrieve coding sequences associated with RefSeq proteins.
> My
> code (below) works for non-refseq proteins (e.g BAB26271) but not for
> refseq
> (no sequence
> features are retrieved although I checked the web-page and a coded_by
> feature
> should be there). Any suggestions? I am using bioperl 1.4
> 
> Here's my code:
> use Bio::Seq;
> use Bio::DB::GenPept;
> use Bio::DB::GenBank;
> use Bio::DB::RefSeq;
> my $gb = new Bio::DB::GenBank;
> my $gp = new Bio::DB::RefSeq;
> my $prot_obj = $gp->get_Seq_by_acc("NP_001008293");
> return unless defined($prot_obj);
> 
> # factory to turn strings into Bio::Location objects
> my $loc_factory = new Bio::Factory::FTLocationFactory;
> my $orf;
> 
> my @f=$prot_obj->top_SeqFeatures();
> print "@f\n"; #returns nothing
> foreach my $feat ( $prot_obj->top_SeqFeatures ) {
> print  $feat->primary_tag, "\n";
> 	if ( $feat->primary_tag eq 'CDS' ) {
> 
> 	   my @coded_by = $feat->each_tag_value('coded_by');
> 	   print @coded_by, "\n";
> 	   my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
> 	   #$nuc_acc=~ s/\..*//;
> 	   my $nuc_obj = $gb->get_Seq_by_acc($nuc_acc);
> 	   return unless defined($nuc_obj);
> 	   my $loc_object = $loc_factory->from_string($loc_str);
> 	   # create a Feature object by using a Location
> 	   my $feat_obj = new Bio::SeqFeature::Generic(-location
> =>$loc_object);
> 	   # associate the Feature object with the nucleotide Seq object
> 	   $nuc_obj->add_SeqFeature($feat_obj);
> 	   my $cds_obj = $feat_obj->spliced_seq;
> 	   $orf=$cds_obj->seq;
> 	}
> }
> print "$orf\n";
> 
> 
> ----------------------------------------------------------------
> This message was sent using IMP, the Internet Messaging Program.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From cjfields at uiuc.edu  Sun Apr  9 13:43:32 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Sun, 9 Apr 2006 12:43:32 -0500
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <000d01c65bfa$3b31f840$15327e82@pyrimidine>
Message-ID: <000001c65bfd$1ed2e8f0$15327e82@pyrimidine>

Forgot to add: I'm not sure when -no_redirect was added, but if this doesn't
work you might consider upgrading to 1.5.1 or CVS if possible; 1.5.1 is
stable considering it is a developer's release and CVS versions are also
pretty stable.  v. 1.4 is ~2 years old.  

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Chris Fields
> Sent: Sunday, April 09, 2006 12:23 PM
> To: e.rapsomaniki at mail.cryst.bbk.ac.uk; bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins
> fails
> 
> That's because Bio::DB::RefSeq retrieves the data from EBI, not from NCBI.
> The EBI version has no seq. features but the NCBI version does (I believe
> NCBI adds them provisionally).  Retrieving via Bio::DB::GenBank is the way
> to go, but you must add the -no_redirect flag to prevent Bio::DB::GenBank
> from redirecting to Bio::DB::RefSeq:
> 
> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> my $seq = $factory->get_Sec_by_acc(' NM_001008292');
> 
> As a warning, RefSeqs are nonstandard GenBank, but I believe I have parsed
> them for seq features before w/o problems.  From perldoc for
> Bio::DB::RefSeq:
> 
> DESCRIPTION
>     Allows the dynamic retrieval of sequence objects Bio::Seq from the
>     RefSeq database using the dbfetch script at EBI:
>     <http://www.ebi.ac.uk/cgi-bin/dbfetch>.
> 
>     In order to make changes transparent we have host type (currently only
>     ebi) and location (defaults to ebi) separated out. This allows later
>     additions of more servers in different geographical locations.
> 
>     The functionality of this module is inherited from Bio::DB::DBFetch
>     which implements Bio::DB::WebDBSeqI.
> 
>     This module retrieves entries from EBI although it retrives database
>     entries produced at NCBI. When read into bioperl objects, the parser
> for
>     GenBank format it used. RefSeq is a NONSTANDARD GenBank file so be
> ready
>     for surprises.
> 
> Chris
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> > -----Original Message-----
> > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > bounces at lists.open-bio.org] On Behalf Of
> > e.rapsomaniki at mail.cryst.bbk.ac.uk
> > Sent: Saturday, April 08, 2006 8:08 AM
> > To: bioperl-l at lists.open-bio.org
> > Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins
> fails
> >
> >
> > Hi
> >
> > I am trying to retrieve coding sequences associated with RefSeq
> proteins.
> > My
> > code (below) works for non-refseq proteins (e.g BAB26271) but not for
> > refseq
> > (no sequence
> > features are retrieved although I checked the web-page and a coded_by
> > feature
> > should be there). Any suggestions? I am using bioperl 1.4
> >
> > Here's my code:
> > use Bio::Seq;
> > use Bio::DB::GenPept;
> > use Bio::DB::GenBank;
> > use Bio::DB::RefSeq;
> > my $gb = new Bio::DB::GenBank;
> > my $gp = new Bio::DB::RefSeq;
> > my $prot_obj = $gp->get_Seq_by_acc("NP_001008293");
> > return unless defined($prot_obj);
> >
> > # factory to turn strings into Bio::Location objects
> > my $loc_factory = new Bio::Factory::FTLocationFactory;
> > my $orf;
> >
> > my @f=$prot_obj->top_SeqFeatures();
> > print "@f\n"; #returns nothing
> > foreach my $feat ( $prot_obj->top_SeqFeatures ) {
> > print  $feat->primary_tag, "\n";
> > 	if ( $feat->primary_tag eq 'CDS' ) {
> >
> > 	   my @coded_by = $feat->each_tag_value('coded_by');
> > 	   print @coded_by, "\n";
> > 	   my ($nuc_acc,$loc_str) = split /\:/, $coded_by[0];
> > 	   #$nuc_acc=~ s/\..*//;
> > 	   my $nuc_obj = $gb->get_Seq_by_acc($nuc_acc);
> > 	   return unless defined($nuc_obj);
> > 	   my $loc_object = $loc_factory->from_string($loc_str);
> > 	   # create a Feature object by using a Location
> > 	   my $feat_obj = new Bio::SeqFeature::Generic(-location
> > =>$loc_object);
> > 	   # associate the Feature object with the nucleotide Seq object
> > 	   $nuc_obj->add_SeqFeature($feat_obj);
> > 	   my $cds_obj = $feat_obj->spliced_seq;
> > 	   $orf=$cds_obj->seq;
> > 	}
> > }
> > print "$orf\n";
> >
> >
> > ----------------------------------------------------------------
> > This message was sent using IMP, the Internet Messaging Program.
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From lstein at cshl.edu  Sun Apr  9 16:37:36 2006
From: lstein at cshl.edu (Lincoln Stein)
Date: Sun, 9 Apr 2006 16:37:36 -0400
Subject: [Bioperl-l] GFF3 Validator
Message-ID: <200604091637.37674.lstein@cshl.edu>

Hi All,

I just wanted to draw your attention to a GFF3 validator put up by the NIAID 
BRC program. It checks that the GFF3 file is well formed and that only SO 
terms are used in the feature type column. It doesn't check that parent/child 
relationships follow the spec, but it is a real good start.

The documentation: http://iowg.brcdevel.org/gff3.html
Standalone script: http://iowg.brcdevel.org/gff3validator/
Web-based script:
	http://www.tigr.org/tigr-scripts/prok_manatee/brc-central/gff_validation.cgi

Lincoln

-- 
Lincoln D. Stein
Cold Spring Harbor Laboratory
1 Bungtown Road
Cold Spring Harbor, NY 11724
(516) 367-8380 (voice)
(516) 367-8389 (fax)
FOR URGENT MESSAGES & SCHEDULING, 
PLEASE CONTACT MY ASSISTANT, 
SANDRA MICHELSEN, AT michelse at cshl.edu

From cain at cshl.edu  Fri Apr  7 22:49:42 2006
From: cain at cshl.edu (Scott Cain)
Date: Fri, 07 Apr 2006 22:49:42 -0400
Subject: [Bioperl-l] Display of gff annotation
In-Reply-To: <C05C65DD.6037%mblanche@berkeley.edu>
References: <C05C65DD.6037%mblanche@berkeley.edu>
Message-ID: <1144464582.28535.220.camel@localhost.localdomain>

Hi Marco,

In answer to your questions: 

1. You might find it easier to use Bio::DB::GFF with you gff file; you
can use the 'memory' adaptor to have it use a file instead of a 'real'
database.  It will give you Bio::DB::GFF::Feature objects which you can
use in the same was as your Bio::SeqFeature::Generic objects.

2. To color your exons differently, you can use a callback in the
bgcolor attribute:

$panel->add_track($full_length,
          -glyph   => 'arrow',
          -tick    => 2,
          -fgcolor => 'black',
          -double  => 1,
          -bgcolor => sub {
                 my $feature = shift;
                 my ($note)  = $feature->attributes('note');
                 if ($note =~ /\./) {
                      return 'red';
                 }
                 else {
                      return 'blue';
                 }
            }
       );

My only comment is that your GFF is a little funny looking: the "(   -"
in the source column might result in some strange behavior.

Scott


On Fri, 2006-04-07 at 18:54 -0700, Marco Blanchette wrote:
> Dear all--
> 
> I have a gff annotation in the form of:
> 
> ##gff-version 2
> # seqname    source    feature    start    end    score    strand    frame
> attributes
> AF260530 (    -    exon    262    693    .    +    .    note "1"
> AF260530 (    -    exon    4450    4630    .    +    .    note "2"
> AF260530 (    -    exon    13432    13776    .    +    .    note "3"
> AF260530 (    -    exon    15198    15359    .    +    .    note "4.1"
> AF260530 (    -    exon    15537    15698    .    +    .    note "4.2"
> AF260530 (    -    exon    16060    16221    .    +    .    note "4.3"
> AF260530 (    -    exon    16682    16852    .    +    .    note "4.4"
> AF260530 (    -    exon    16985    17146    .    +    .    note "4.5"
> AF260530 (    -    exon    16985    17146    .    +    .    note "5"
> 
> 
> Where the value of the tag 'note' is the exon name. all exons with a decimal
> annotation are alternatively spliced exon. My goal would be to display the
> alternative exons in a different color (let say red) than the constitutive
> exons (let say blue).
> 
> I have this script:
> #!/usr/bin/perl
> 
> use strict;
> use Bio::Tools::GFF;
> use Bio::Graphics;
> use Bio::SeqFeature::Generic;
> 
> 
> my $gffio = Bio::Tools::GFF->new(-file => $ARGV[0],
>                                  -gff_version => 2,
>                                 );
> 
> my $feat_o = Bio::SeqFeature::Generic->new(-name => 'aGene');
> 
> while (my $feature = $gffio->next_feature) {
>         $feat_o->add_SeqFeature($feature,'EXPAND');
> }
> 
> my $panel = Bio::Graphics::Panel->new(
>                   -length => $feat_o->end,
>                   -width  => 1500,
>                   -pad_left => 10,
>                   -pad_right => 10,
>                  );
> 
> my $full_length = Bio::SeqFeature::Generic->new(-start=>1,
>                                                 -end=>$feat_o->end);
> 
> $panel->add_track($full_length,
>           -glyph   => 'arrow',
>           -tick    => 2,
>           -fgcolor => 'black',
>           -double  => 1,
>                         );
> 
> $panel->add_track($feat_o,
>                     -glyph=> 'segments');
> print $panel->png
> 
> 
> That does almost what I need. My questions are:
> 1) is there a better way to transform the GFF file into a SeqFeature object
> than the while loop that I am using
> 
> 2) How could I tell the Bio::Graphics::Panel object to color the exon with a
> '.' in red and the others in blue.
> 
> Many thanks all
> 
> Marco
> 
> 
> 
> Marco Blanchette, Ph.D.
> 
> mblanche at berkeley.edu
> 
> Donald C. Rio's lab
> Department of Molecular and Cell Biology
> 16 Barker Hall
> University of California
> Berkeley, CA 94720-3204
> 
> Tel: (510) 642-1084
> Cell: (510) 847-0996
> Fax: (510) 642-6062
> 
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory


From kevinvicy at gmail.com  Sun Apr  9 18:59:47 2006
From: kevinvicy at gmail.com (Kevin Victor)
Date: Sun, 9 Apr 2006 17:59:47 -0500
Subject: [Bioperl-l] primer pair sequence search
Message-ID: <d627c7db0604091559w342bf42aw6a84e16215faca10@mail.gmail.com>

Hi, I am interested to know if there is any optimal way to search for primer
pair sequences in a given set of longer sequences. I would like to do this
in batch mode. This would be more like searching for substrings in a string
where the substrings we are searching are several thousands and are known.
Any suggestions would be very helpful.

Thanks,
Kevin


From dalke at dalkescientific.com  Mon Apr 10 01:33:31 2006
From: dalke at dalkescientific.com (Andrew Dalke)
Date: Sun, 9 Apr 2006 23:33:31 -0600
Subject: [Bioperl-l] GFF3 Validator
In-Reply-To: <200604091637.37674.lstein@cshl.edu>
References: <200604091637.37674.lstein@cshl.edu>
Message-ID: <020b1642e641e08b241171a92f87bc96@dalkescientific.com>

Lincoln:
> I just wanted to draw your attention to a GFF3 validator put up by the  
> NIAID
> BRC program. It checks that the GFF3 file is well formed and that only  
> SO
> terms are used in the feature type column. It doesn't check that  
> parent/child
> relationships follow the spec, but it is a real good start.
>
> The documentation: http://iowg.brcdevel.org/gff3.html
> Standalone script: http://iowg.brcdevel.org/gff3validator/
> Web-based script:
> 	http://www.tigr.org/tigr-scripts/prok_manatee/brc-central/ 
> gff_validation.cgi

As part of the DAS2 project a couple weeks ago I wrote a basic GFF3
parser in Python.  If anyone is interested, I've put a snapshot at
   http://www.dalkescientific.com/PyGFF3-0.5.tar.gz

There's a few performance tricks which might be translatable to the
bioperl or gff3validator codes.  Mostly just tricks to optimize for
the common case.

I bring it up to point out I've implemented but not rigorously tested
the validation code to ensure that features have no cycles.  Once I
find all of the features in a set I do a topological sort on them.
If no topological sort is possible, there's a cycle and hence an error.

The code for toposort.py is very simple, with about 15 lines for
the initialization and another 15 for the recursive part.  It should
be easy to convert just that part without having to go through the
rest of the Python code.

Please note that so far I have only parsed two gff files with this
parser.  It is incomplete and not tested.  I wanted to get an idea
of how hard is to to handle GFF-like complex features.  Hard enough
that I'm going to propose a change to DAS2 to make it easier.

					Andrew
					dalke at dalkescientific.com


From akarger at CGR.Harvard.edu  Mon Apr 10 13:06:32 2006
From: akarger at CGR.Harvard.edu (Amir Karger)
Date: Mon, 10 Apr 2006 13:06:32 -0400
Subject: [Bioperl-l] Getting sequences by ID
Message-ID: <BB91E836FD4CDC4E830F628F39CDFF047EDAC3@huls5.nucleus.harvard.edu>

An embedded and charset-unspecified text was scrubbed...
Name: not available
Url: http://lists.open-bio.org/pipermail/bioperl-l/attachments/20060410/a9cade68/attachment.pl 

From donald.jackson at bms.com  Mon Apr 10 16:36:16 2006
From: donald.jackson at bms.com (Donald Jackson)
Date: Mon, 10 Apr 2006 16:36:16 -0400
Subject: [Bioperl-l] primer pair sequence search
In-Reply-To: <d627c7db0604091559w342bf42aw6a84e16215faca10@mail.gmail.com>
References: <d627c7db0604091559w342bf42aw6a84e16215faca10@mail.gmail.com>
Message-ID: <443AC1C0.6090908@bms.com>

Take a look at NCBI's E-PCR program. It can test PCR primers against a 
library of genomic or mRNA sequences and identify all predicted products 
within a given size range. It has a web interface or can be run locally.

Don Jackson

Kevin Victor wrote:

>Hi, I am interested to know if there is any optimal way to search for primer
>pair sequences in a given set of longer sequences. I would like to do this
>in batch mode. This would be more like searching for substrings in a string
>where the substrings we are searching are several thousands and are known.
>Any suggestions would be very helpful.
>
>Thanks,
>Kevin
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>  
>


From osborne1 at optonline.net  Mon Apr 10 23:32:59 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Mon, 10 Apr 2006 23:32:59 -0400
Subject: [Bioperl-l] SimpleAlign Question
In-Reply-To: <8cff3eb80604080929o5e2badf8kf31e3be48e87ea62@mail.gmail.com>
Message-ID: <C0609BAB.81B2%osborne1@optonline.net>

Iain,

You can pass a third argument to slice(), it tells the method to keep
sequences with no valid characters, e.g.:

$aln2 = $aln1->slice(22,33,1);

I'll document this a bit more...


Brian O.

On 4/8/06 12:29 PM, "Iain Wallace" <iain.m.wallace at gmail.com> wrote:

> Hi all,
> 
> I am trying to extract slices out of an alignment, but sometimes the
> slice I am trying to take contains a sequence that has no residues. I
> would still like to add this sequence, unfortunately I am getting this
> error
> 
> ------------- EXCEPTION  -------------
> MSG: Got a sequence with no letters in it cannot guess alphabet []
> STACK Bio::PrimarySeq::_guess_alphabet
> /usr/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm:837
> STACK Bio::PrimarySeq::seq
> /usr/lib/perl5/site_perl/5.8.0/Bio/PrimarySeq.pm:279
> STACK Bio::SimpleAlign::slice
> /usr/lib/perl5/site_perl/5.8.0/Bio/SimpleAlign.pm:794
> 
> Is there a simple way I can override this behaviour, which I think is
> just validating the sequence before it adds it to the alignment.
> 
> The code I am usinge is below followed by a test alignment,
> 
> Thanks for any help
> 
> Iain
> --script
> use strict;
> 
> use Bio::AlignIO;
> #read in the initial alignment from the command line.
> 
> my $in = $ARGV[0];
> 
> my $alignio = Bio::AlignIO->new(-file=> $in);
> my $out = Bio::AlignIO->new(-file=> ">test.fasta");
> 
>        my $aln = $alignio->next_aln;
>        my $new_aln = new Bio::SimpleAlign;
>        $new_aln=$aln->slice(1,10);
>        $out->write_aln($new_aln);
> 
> --sample file
> 
>> 1huma/1-7
> APMGSDP---
>> 1b3aa/1-5
> -PYSS-D---
>> 2eot/1-5
> -----GPASV
>> 1rhpa/1-1
> ---------D
>> 1mgsa/1-6
> ----ASVATE
>> 1mi2a/1-6
> ----AVVASE
>> 1roda/1-4
> ------SAKE
>> 1il8a/1-3
> -------AKE
>> 1sdf/1-6
> ----KPVSLS
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at uiuc.edu  Tue Apr 11 09:52:45 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Apr 2006 08:52:45 -0500
Subject: [Bioperl-l] BioPerl Mailing List Summaries
Message-ID: <000601c65d6f$361ed0a0$15327e82@pyrimidine>

The first of a biweekly summary of BioPerl mailing list summaries has been
posted to the wiki:

http://www.bioperl.org/wiki/BioPerl_Mailing_List_Summaries_for_April_1-11

These will likely be archived on the wiki but may be moved to a more
suitable location in the future (maybe to the news blog?).  Any suggestions
are welcome.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 



From osborne1 at optonline.net  Tue Apr 11 10:51:26 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue, 11 Apr 2006 10:51:26 -0400
Subject: [Bioperl-l] BioPerl Mailing List Summaries
In-Reply-To: <000601c65d6f$361ed0a0$15327e82@pyrimidine>
Message-ID: <C0613AAE.81C1%osborne1@optonline.net>

Chris,

That's very nice. It's always the case that there are active threads whose
details aren't always clear to me, having them summarized is very useful.

Thanks again,

Brian O.


On 4/11/06 9:52 AM, "Chris Fields" <cjfields at uiuc.edu> wrote:

> The first of a biweekly summary of BioPerl mailing list summaries has been
> posted to the wiki:
> 
> http://www.bioperl.org/wiki/BioPerl_Mailing_List_Summaries_for_April_1-11
> 
> These will likely be archived on the wiki but may be moved to a more
> suitable location in the future (maybe to the news blog?).  Any suggestions
> are welcome.
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From e.rapsomaniki at mail.cryst.bbk.ac.uk  Tue Apr 11 03:30:38 2006
From: e.rapsomaniki at mail.cryst.bbk.ac.uk (Eleni Rapsomaniki)
Date: Tue, 11 Apr 2006 08:30:38 +0100
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <000001c65bfd$1ed2e8f0$15327e82@pyrimidine>
References: <000001c65bfd$1ed2e8f0$15327e82@pyrimidine>
Message-ID: <1144740638.443b5b1ee78c9@webmail.cryst.bbk.ac.uk>

Hi again,

Thank you for your reply regarding the retrieval of sequence features for
Refseq proteins. I have updated to bioperl 1.5 but the re-direct still does not
work and the following code:

my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
my $seq = $factory->get_Seq_by_acc(' NM_001008292');

returns:
MSG: [gb| NM_001008292] is not a normal sequence entry but a RefSeq entry.
Redirecting the request.

-------------------- WARNING ---------------------
MSG: acc (gb| NM_001008292) does not exist
---------------------------------------------------

I get the same error when I replace Bio::DB::GenBank with Bio::DB::RefSeq, and
with many other refseq accessions.

Could I be doing something wrong or maybe I should be using a different method
for parsing refseq records? I suppose the alternative is to create objects from
files after fetching them..

Many thanks
Eleni Rapsomaniki



----------------------------------------------------------------
This message was sent using IMP, the Internet Messaging Program.

From cjfields at uiuc.edu  Tue Apr 11 18:06:57 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Apr 2006 17:06:57 -0500
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <1144740638.443b5b1ee78c9@webmail.cryst.bbk.ac.uk>
Message-ID: <000801c65db4$400d55b0$15327e82@pyrimidine>

I'll look into it tomorrow, but you might try updating to 1.5.1 or CVS to
see if it helps.

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Eleni Rapsomaniki
> Sent: Tuesday, April 11, 2006 2:31 AM
> To: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins
> fails
> 
> Hi again,
> 
> Thank you for your reply regarding the retrieval of sequence features for
> Refseq proteins. I have updated to bioperl 1.5 but the re-direct still
> does not
> work and the following code:
> 
> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> my $seq = $factory->get_Seq_by_acc(' NM_001008292');
> 
> returns:
> MSG: [gb| NM_001008292] is not a normal sequence entry but a RefSeq entry.
> Redirecting the request.
> 
> -------------------- WARNING ---------------------
> MSG: acc (gb| NM_001008292) does not exist
> ---------------------------------------------------
> 
> I get the same error when I replace Bio::DB::GenBank with Bio::DB::RefSeq,
> and
> with many other refseq accessions.
> 
> Could I be doing something wrong or maybe I should be using a different
> method
> for parsing refseq records? I suppose the alternative is to create objects
> from
> files after fetching them..
> 
> Many thanks
> Eleni Rapsomaniki
> 
> 
> 
> ----------------------------------------------------------------
> This message was sent using IMP, the Internet Messaging Program.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From osborne1 at optonline.net  Tue Apr 11 18:14:52 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Tue, 11 Apr 2006 18:14:52 -0400
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <1144740638.443b5b1ee78c9@webmail.cryst.bbk.ac.uk>
Message-ID: <C061A29C.81E1%osborne1@optonline.net>

Eleni,

I can retrieve NM_001008292, no problem:

 ~>perl -e 'use Bio::DB::GenBank; $db = Bio::DB::GenBank->new(-no_redirect
=> 1); $seq = $db->get_Seq_by_acc('NM_001008292');print $seq->seq;'
CCGGCGTCCGTCCGCCGCGGGATGGCGGCTCTGAGGAGTTGGATGACTCGGAGCGTAACCTTTCTGTTCAGGTACG
GACAGCGTTTTCCTGTCTCTGCTAACTCTAAGAAACGCTGTTTCTCAGAATTGATAAGACCATGGCACAAAACTAT
GTTGACTGGATTCGGTGTGACACTGTGCGCCGTTCCTATTGCTCAGAAATCAGAGCCTCAGTCTCTCAGCAACGAA
GCACTGATGAGGAGGGCTGTGTCTTTGGTAACGGACAGCACCTCTACCTTTCTGTCTCAAACCACGTACGCACTGA
TCGAAGCCATCACCGAGTATACTAAGGCTGTCTACACGTTAGTGTCTCTGTACCGACAGTATACAAGCTTGCTGGG
GAAGATGAATTCCCAGGAGGAGGATGAGGTGTGGCAGGTGATCATAGGAGCCAGAGTTGAGATGACTTCAAAGCAG
CAGGAGTACTTGAAGCTGGAGACCACGTGGATGACAGCAGTCAGCCTTTCAGAGATGGCTGCGGAGGCTGCCTATC
AGACTGGAGCAGATCAGGCCTCTATAACCGCCAGGAATCACATCCAGTTGGTGAAGTCGCAGGTGCAGGAGGTGCG
CCAGCTCTCCCAGAAGGCGGAAACCAAGCTGGCAGAAGTGCAGACACAAGAGCTGCGCCAGAAAACACAGGAAGCG
AGCGATGAGGCAGCGGACCAGGAAGAGGAGGCCTACCTACGAGAAGATTGAGGGCTCGAGCCCAGTGCCCTGTCCA
TCCACTCTGTGGGGAAAGCAGGTGCATGACATCCACCCAGTGACGTCCCAACTGCAGAAGCTGACCGGTTCTGCCA
TTGACAGTCAGACCAGAGCCTTTGCGAGCTGCGCCTGGCCCCTTCTCTCTGCTCGCAGCCTCTCTGGGCCTGGCTC
TGCACTGTCCCTCACACAGCTTCTCTCTTGATCTTTTACCTCACTCCCAAAGCACTTCACCAACCGGGGCCAATGG
AGGAGGGGCCTTTTCTGCCACACCCTTAAGTTCAATAGCTGTTTAACTCCAGTTTTTACTGTTACTCAGATGTTCA
AGTATGAATTACTGCTTGCTCCTCCACAGGGAAGCTTGTCTGGTTTGTAACATTTCTTTGTGTTTATAATGTCCTT
TCTCCCTGTGAGCACAGCTCAGCTAAGGCGTTACTCAGTGTGAACAGTTCCCCTGGTGCTCCCCACAGCACCTTCT
CCAACACGTGCTTCTTGTTCGTTCCTTTTTTGAATTTCTCTGCTGTATCCAAAGGAAGAGAAGTTTGGTGTTTGCA
TTAAAAAAAAAAAAAAAGTCAAAAAAAAAAAAAAAAAAAAA

Could it be the ' ' before the string 'NM_001008292' that's causing the
problem?

Brian O.



On 4/11/06 3:30 AM, "Eleni Rapsomaniki" <e.rapsomaniki at mail.cryst.bbk.ac.uk>
wrote:

> Hi again,
> 
> Thank you for your reply regarding the retrieval of sequence features for
> Refseq proteins. I have updated to bioperl 1.5 but the re-direct still does
> not
> work and the following code:
> 
> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> my $seq = $factory->get_Seq_by_acc(' NM_001008292');
> 
> returns:
> MSG: [gb| NM_001008292] is not a normal sequence entry but a RefSeq entry.
> Redirecting the request.
> 
> -------------------- WARNING ---------------------
> MSG: acc (gb| NM_001008292) does not exist
> ---------------------------------------------------
> 
> I get the same error when I replace Bio::DB::GenBank with Bio::DB::RefSeq, and
> with many other refseq accessions.
> 
> Could I be doing something wrong or maybe I should be using a different method
> for parsing refseq records? I suppose the alternative is to create objects
> from
> files after fetching them..
> 
> Many thanks
> Eleni Rapsomaniki
> 
> 
> 
> ----------------------------------------------------------------
> This message was sent using IMP, the Internet Messaging Program.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at uiuc.edu  Tue Apr 11 22:27:58 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 11 Apr 2006 21:27:58 -0500
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <C061A29C.81E1%osborne1@optonline.net>
References: <C061A29C.81E1%osborne1@optonline.net>
Message-ID: <FE1761FB-AB78-4FCF-82E8-75E00874A38B@uiuc.edu>

I got this to work as well using Mac OS X.  Looking at CVS, I noticed  
that 'no_redirect' was added about three months ago by Brian, so you  
definitely need to update to CVS (NOT v. 1.5.1).

Chris

On Apr 11, 2006, at 5:14 PM, Brian Osborne wrote:

> Eleni,
>
> I can retrieve NM_001008292, no problem:
>
>  ~>perl -e 'use Bio::DB::GenBank; $db = Bio::DB::GenBank->new(- 
> no_redirect
> => 1); $seq = $db->get_Seq_by_acc('NM_001008292');print $seq->seq;'
> CCGGCGTCCGTCCGCCGCGGGATGGCGGCTCTGAGGAGTTGGATGACTCGGAGCGTAACCTTTCTGTTCA 
> GGTACG
> GACAGCGTTTTCCTGTCTCTGCTAACTCTAAGAAACGCTGTTTCTCAGAATTGATAAGACCATGGCACAA 
> AACTAT
> GTTGACTGGATTCGGTGTGACACTGTGCGCCGTTCCTATTGCTCAGAAATCAGAGCCTCAGTCTCTCAGC 
> AACGAA
> GCACTGATGAGGAGGGCTGTGTCTTTGGTAACGGACAGCACCTCTACCTTTCTGTCTCAAACCACGTACG 
> CACTGA
> TCGAAGCCATCACCGAGTATACTAAGGCTGTCTACACGTTAGTGTCTCTGTACCGACAGTATACAAGCTT 
> GCTGGG
> GAAGATGAATTCCCAGGAGGAGGATGAGGTGTGGCAGGTGATCATAGGAGCCAGAGTTGAGATGACTTCA 
> AAGCAG
> CAGGAGTACTTGAAGCTGGAGACCACGTGGATGACAGCAGTCAGCCTTTCAGAGATGGCTGCGGAGGCTG 
> CCTATC
> AGACTGGAGCAGATCAGGCCTCTATAACCGCCAGGAATCACATCCAGTTGGTGAAGTCGCAGGTGCAGGA 
> GGTGCG
> CCAGCTCTCCCAGAAGGCGGAAACCAAGCTGGCAGAAGTGCAGACACAAGAGCTGCGCCAGAAAACACAG 
> GAAGCG
> AGCGATGAGGCAGCGGACCAGGAAGAGGAGGCCTACCTACGAGAAGATTGAGGGCTCGAGCCCAGTGCCC 
> TGTCCA
> TCCACTCTGTGGGGAAAGCAGGTGCATGACATCCACCCAGTGACGTCCCAACTGCAGAAGCTGACCGGTT 
> CTGCCA
> TTGACAGTCAGACCAGAGCCTTTGCGAGCTGCGCCTGGCCCCTTCTCTCTGCTCGCAGCCTCTCTGGGCC 
> TGGCTC
> TGCACTGTCCCTCACACAGCTTCTCTCTTGATCTTTTACCTCACTCCCAAAGCACTTCACCAACCGGGGC 
> CAATGG
> AGGAGGGGCCTTTTCTGCCACACCCTTAAGTTCAATAGCTGTTTAACTCCAGTTTTTACTGTTACTCAGA 
> TGTTCA
> AGTATGAATTACTGCTTGCTCCTCCACAGGGAAGCTTGTCTGGTTTGTAACATTTCTTTGTGTTTATAAT 
> GTCCTT
> TCTCCCTGTGAGCACAGCTCAGCTAAGGCGTTACTCAGTGTGAACAGTTCCCCTGGTGCTCCCCACAGCA 
> CCTTCT
> CCAACACGTGCTTCTTGTTCGTTCCTTTTTTGAATTTCTCTGCTGTATCCAAAGGAAGAGAAGTTTGGTG 
> TTTGCA
> TTAAAAAAAAAAAAAAAGTCAAAAAAAAAAAAAAAAAAAAA
>
> Could it be the ' ' before the string 'NM_001008292' that's causing  
> the
> problem?
>
> Brian O.
>
>
>
> On 4/11/06 3:30 AM, "Eleni Rapsomaniki"  
> <e.rapsomaniki at mail.cryst.bbk.ac.uk>
> wrote:
>
>> Hi again,
>>
>> Thank you for your reply regarding the retrieval of sequence  
>> features for
>> Refseq proteins. I have updated to bioperl 1.5 but the re-direct  
>> still does
>> not
>> work and the following code:
>>
>> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
>> my $seq = $factory->get_Seq_by_acc(' NM_001008292');
>>
>> returns:
>> MSG: [gb| NM_001008292] is not a normal sequence entry but a  
>> RefSeq entry.
>> Redirecting the request.
>>
>> -------------------- WARNING ---------------------
>> MSG: acc (gb| NM_001008292) does not exist
>> ---------------------------------------------------
>>
>> I get the same error when I replace Bio::DB::GenBank with  
>> Bio::DB::RefSeq, and
>> with many other refseq accessions.
>>
>> Could I be doing something wrong or maybe I should be using a  
>> different method
>> for parsing refseq records? I suppose the alternative is to create  
>> objects
>> from
>> files after fetching them..
>>
>> Many thanks
>> Eleni Rapsomaniki
>>
>>
>>
>> ----------------------------------------------------------------
>> This message was sent using IMP, the Internet Messaging Program.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From hlapp at gmx.net  Tue Apr 11 22:47:17 2006
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue, 11 Apr 2006 22:47:17 -0400
Subject: [Bioperl-l] BioPerl Mailing List Summaries
In-Reply-To: <000601c65d6f$361ed0a0$15327e82@pyrimidine>
References: <000601c65d6f$361ed0a0$15327e82@pyrimidine>
Message-ID: <4E4A73D2-3466-4A3E-A828-1C401897358E@gmx.net>

Nice read indeed!

On Apr 11, 2006, at 9:52 AM, Chris Fields wrote:

> The first of a biweekly summary of BioPerl mailing list summaries  
> has been
> posted to the wiki:
>
> http://www.bioperl.org/wiki/ 
> BioPerl_Mailing_List_Summaries_for_April_1-11
>
> These will likely be archived on the wiki but may be moved to a more
> suitable location in the future (maybe to the news blog?).  Any  
> suggestions
> are welcome.
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
----------------------------------------------------------
: Hilmar Lapp -:- San Diego, CA -:- hlapp at gmx dot net :
----------------------------------------------------------




From torsten.seemann at infotech.monash.edu.au  Tue Apr 11 22:37:20 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed, 12 Apr 2006 12:37:20 +1000
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <1144740638.443b5b1ee78c9@webmail.cryst.bbk.ac.uk>
References: <000001c65bfd$1ed2e8f0$15327e82@pyrimidine>
	<1144740638.443b5b1ee78c9@webmail.cryst.bbk.ac.uk>
Message-ID: <443C67E0.9020404@infotech.monash.edu.au>

Eleni,

> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> my $seq = $factory->get_Seq_by_acc(' NM_001008292');

You have a space character before the NM_ ?
Try removing it.

> returns:
> MSG: [gb| NM_001008292] is not a normal sequence entry but a RefSeq entry.
> Redirecting the request.

There's the space, right in the error message.

Is that the problem?

Brian's counter example didn't have the space.

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/

From e.rapsomaniki at mail.cryst.bbk.ac.uk  Wed Apr 12 04:09:57 2006
From: e.rapsomaniki at mail.cryst.bbk.ac.uk (Eleni Rapsomaniki)
Date: Wed, 12 Apr 2006 09:09:57 +0100
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <FE1761FB-AB78-4FCF-82E8-75E00874A38B@uiuc.edu>
References: <C061A29C.81E1%osborne1@optonline.net>
	<FE1761FB-AB78-4FCF-82E8-75E00874A38B@uiuc.edu>
Message-ID: <1144829397.443cb5d5047ea@webmail.cryst.bbk.ac.uk>

Hi again,

Thank you for your replies. It will sound crazy but the same code,ie.
my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
print my $seq = $factory->get_Seq_by_acc('NM_001008292');

used to work 3-4 days ago, then stopped working 2 days ago (despite updating to
1.5) and today (no more updates or changes!) it works again! Could be because I
never logged off in between the bioperl updates..
I'll try to persuade our administrator to update to CVs (life is harder without
admin rights..)

Thank you so much for your help.
Eleni




----------------------------------------------------------------
This message was sent using IMP, the Internet Messaging Program.

From osborne1 at optonline.net  Wed Apr 12 10:08:59 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Wed, 12 Apr 2006 10:08:59 -0400
Subject: [Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails
In-Reply-To: <1144829397.443cb5d5047ea@webmail.cryst.bbk.ac.uk>
Message-ID: <C062823B.81F4%osborne1@optonline.net>

Eleni,

If you have sufficient space you can install Bioperl in your home directory,
the necessary steps are explained in the INSTALL file (
http://bioperl.open-bio.org/SRC/bioperl-live/INSTALL).

Brian O.


On 4/12/06 4:09 AM, "Eleni Rapsomaniki" <e.rapsomaniki at mail.cryst.bbk.ac.uk>
wrote:

> Hi again,
> 
> Thank you for your replies. It will sound crazy but the same code,ie.
> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> print my $seq = $factory->get_Seq_by_acc('NM_001008292');
> 
> used to work 3-4 days ago, then stopped working 2 days ago (despite updating
> to
> 1.5) and today (no more updates or changes!) it works again! Could be because
> I
> never logged off in between the bioperl updates..
> I'll try to persuade our administrator to update to CVs (life is harder
> without
> admin rights..)
> 
> Thank you so much for your help.
> Eleni
> 
> 
> 
> 
> ----------------------------------------------------------------
> This message was sent using IMP, the Internet Messaging Program.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From maximilianh at gmail.com  Wed Apr 12 10:24:00 2006
From: maximilianh at gmail.com (Maximilian Haeussler)
Date: Wed, 12 Apr 2006 16:24:00 +0200
Subject: [Bioperl-l] primer pair sequence search
In-Reply-To: <d627c7db0604091559w342bf42aw6a84e16215faca10@mail.gmail.com>
References: <d627c7db0604091559w342bf42aw6a84e16215faca10@mail.gmail.com>
Message-ID: <76f031ae0604120724v5b61d8a3n85b2d3a1e0eb0264@mail.gmail.com>

if you want to test primers against LARGE sequences: have a look at
UCSC's in silico PCR program (isPcr), accessible from the browser.
They explain in their faq how to download and compile the source files
if you want to use it locally.

Max

On 10/04/06, Kevin Victor <kevinvicy at gmail.com> wrote:
> Hi, I am interested to know if there is any optimal way to search for primer
> pair sequences in a given set of longer sequences. I would like to do this
> in batch mode. This would be more like searching for substrings in a string
> where the substrings we are searching are several thousands and are known.
> Any suggestions would be very helpful.
>
> Thanks,
> Kevin
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


--
Maximilian Haeussler,
CNRS Gif-sur-Yvette, Paris
tel: +33 6 12 82 76 16
icq: 3825815  -- msn: maximilian.haeussler at hpi.uni-potsdam.de
skype: maximilianhaeussler


From cjm at fruitfly.org  Thu Apr 13 23:42:55 2006
From: cjm at fruitfly.org (chris mungall)
Date: Thu, 13 Apr 2006 20:42:55 -0700
Subject: [Bioperl-l] [SO-devel] GFF3 Validator
In-Reply-To: <eaf78a280057db22042e497368fdbe01@fruitfly.org>
References: <200604091637.37674.lstein@cshl.edu>
	<eaf78a280057db22042e497368fdbe01@fruitfly.org>
Message-ID: <0C01EE11-79C5-4C0E-AC93-DC3124BACBA0@fruitfly.org>


There's also a script in cvs/song/software/scripts/ 
validate_features.pl - it focuses purely on validating the parent/ 
child relationships w.r.t SO

It uses Bio::Tools::GFF, it should probably be updated to use the  
latest bioperl code

On Apr 13, 2006, at 8:32 PM, Suzanna Lewis wrote:

> That is nice. Thanks for the pointer.
>
> -S
>
> On Apr 9, 2006, at 1:37 PM, Lincoln Stein wrote:
>
>> Hi All,
>>
>> I just wanted to draw your attention to a GFF3 validator put up by  
>> the NIAID
>> BRC program. It checks that the GFF3 file is well formed and that  
>> only SO
>> terms are used in the feature type column. It doesn't check that  
>> parent/child
>> relationships follow the spec, but it is a real good start.
>>
>> The documentation: http://iowg.brcdevel.org/gff3.html
>> Standalone script: http://iowg.brcdevel.org/gff3validator/
>> Web-based script:
>> 	http://www.tigr.org/tigr-scripts/prok_manatee/brc-central/ 
>> gff_validation.cgi
>>
>> Lincoln
>>
>> -- 
>> Lincoln D. Stein
>> Cold Spring Harbor Laboratory
>> 1 Bungtown Road
>> Cold Spring Harbor, NY 11724
>> (516) 367-8380 (voice)
>> (516) 367-8389 (fax)
>> FOR URGENT MESSAGES & SCHEDULING,
>> PLEASE CONTACT MY ASSISTANT,
>> SANDRA MICHELSEN, AT michelse at cshl.edu
>>
>>
>> -------------------------------------------------------
>> This SF.Net email is sponsored by xPML, a groundbreaking scripting  
>> language
>> that extends applications into web and mobile media. Attend the  
>> live webcast
>> and join the prime developer group breaking into this new coding  
>> territory!
>> http://sel.as-us.falkag.net/sel? 
>> cmd=lnk&kid=110944&bid=241720&dat=121642
>> _______________________________________________
>> SOng-devel mailing list
>> SOng-devel at lists.sourceforge.net
>> https://lists.sourceforge.net/lists/listinfo/song-devel
>
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by xPML, a groundbreaking scripting  
> language
> that extends applications into web and mobile media. Attend the  
> live webcast
> and join the prime developer group breaking into this new coding  
> territory!
> http://sel.as-us.falkag.net/sel? 
> cmd=lnk&kid=110944&bid=241720&dat=121642
> _______________________________________________
> SOng-devel mailing list
> SOng-devel at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/song-devel


From kaimueller at uni-bonn.de  Thu Apr 13 20:38:00 2006
From: kaimueller at uni-bonn.de (Kai =?iso-8859-1?q?M=FCller?=)
Date: Thu, 13 Apr 2006 20:38:00 -0400
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
Message-ID: <200604132038.01568.kaimueller@uni-bonn.de>

hi,

I'm very new to BioPerl and have a maybe silly question.
when using Bio::AlignIO to load a set of sequences, the questionmarks are 
simply lost (they refer to missing characters as opposed to gap characters 
[-] or ambiguity [N]). I thought that 'missing_char()' might help, but it 
didn't (I probably used it the wrong way).

when $filename contains sequences with ????, the following snippet would 
produce an alignment with ???? lost and downstream nucleotide just shifted 
and the resulting length differnces filled by '---' @ 3' end:


my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' => 'fasta');
	my $aln = $aln_in->next_aln();
	$aln->gap_char('-');
	$aln->missing_char('?');
	
	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' => 'clustalw');
	$testout->write_aln($aln);



Can somebody give me a hint here?

thanks and all the best,

Kai M?ller





From suzi at fruitfly.org  Thu Apr 13 23:32:27 2006
From: suzi at fruitfly.org (Suzanna Lewis)
Date: Thu, 13 Apr 2006 20:32:27 -0700
Subject: [Bioperl-l] [SO-devel] GFF3 Validator
In-Reply-To: <200604091637.37674.lstein@cshl.edu>
References: <200604091637.37674.lstein@cshl.edu>
Message-ID: <eaf78a280057db22042e497368fdbe01@fruitfly.org>

That is nice. Thanks for the pointer.

-S

On Apr 9, 2006, at 1:37 PM, Lincoln Stein wrote:

> Hi All,
>
> I just wanted to draw your attention to a GFF3 validator put up by the  
> NIAID
> BRC program. It checks that the GFF3 file is well formed and that only  
> SO
> terms are used in the feature type column. It doesn't check that  
> parent/child
> relationships follow the spec, but it is a real good start.
>
> The documentation: http://iowg.brcdevel.org/gff3.html
> Standalone script: http://iowg.brcdevel.org/gff3validator/
> Web-based script:
> 	http://www.tigr.org/tigr-scripts/prok_manatee/brc-central/ 
> gff_validation.cgi
>
> Lincoln
>
> -- 
> Lincoln D. Stein
> Cold Spring Harbor Laboratory
> 1 Bungtown Road
> Cold Spring Harbor, NY 11724
> (516) 367-8380 (voice)
> (516) 367-8389 (fax)
> FOR URGENT MESSAGES & SCHEDULING,
> PLEASE CONTACT MY ASSISTANT,
> SANDRA MICHELSEN, AT michelse at cshl.edu
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by xPML, a groundbreaking scripting  
> language
> that extends applications into web and mobile media. Attend the live  
> webcast
> and join the prime developer group breaking into this new coding  
> territory!
> http://sel.as-us.falkag.net/sel? 
> cmd=lnk&kid=110944&bid=241720&dat=121642
> _______________________________________________
> SOng-devel mailing list
> SOng-devel at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/song-devel


From avilella at gmail.com  Fri Apr 14 10:01:01 2006
From: avilella at gmail.com (Albert Vilella)
Date: Fri, 14 Apr 2006 15:01:01 +0100
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <200604132038.01568.kaimueller@uni-bonn.de>
References: <200604132038.01568.kaimueller@uni-bonn.de>
Message-ID: <1145023261.12449.15.camel@localhost>

It seems like missing_char is more for SimpleAlign than for AlignIO. So
in case of fasta files with '?' chars, they will be ignores in line 113
of Bio::AlignIO::fasta.pm.

So you can add '\?' in that line of fasta.pm.

That will parse it correctly, although I am not sure whether fasta
format should or shouldn't allow '?' chars in the file.

Anyone?

Cheers,

    Albert.

On Thu, 2006-04-13 at 20:38 -0400, Kai M?ller wrote:
> hi,
> 
> I'm very new to BioPerl and have a maybe silly question.
> when using Bio::AlignIO to load a set of sequences, the questionmarks are 
> simply lost (they refer to missing characters as opposed to gap characters 
> [-] or ambiguity [N]). I thought that 'missing_char()' might help, but it 
> didn't (I probably used it the wrong way).
> 
> when $filename contains sequences with ????, the following snippet would 
> produce an alignment with ???? lost and downstream nucleotide just shifted 
> and the resulting length differnces filled by '---' @ 3' end:
> 
> 
> my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' => 'fasta');
> 	my $aln = $aln_in->next_aln();
> 	$aln->gap_char('-');
> 	$aln->missing_char('?');
> 	
> 	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' => 'clustalw');
> 	$testout->write_aln($aln);
> 
> 
> 
> Can somebody give me a hint here?
> 
> thanks and all the best,
> 
> Kai M?ller
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From dnm_a at swbell.net  Fri Apr 14 10:13:54 2006
From: dnm_a at swbell.net (David Messina)
Date: Fri, 14 Apr 2006 09:13:54 -0500
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <200604132038.01568.kaimueller@uni-bonn.de>
References: <200604132038.01568.kaimueller@uni-bonn.de>
Message-ID: <C314B52D-C4B4-4612-B796-1B631CEB4D1A@swbell.net>

Hi Kai,

I'm by no means an expert with this module, but I'll take a shot.

Running your code through a debugger, I'm seeing that  
Bio::AlignIO::fasta is gobbling the question marks:

line 66: $MATCHPATTERN = '^A-Za-z\.\-';

and then where $entry contains a line of sequence from the input file

line 118: $entry =~ s/[$MATCHPATTERN]//g;

As far as I can tell, a question mark is not a valid character for  
the FASTA format (see http://en.wikipedia.org/wiki/FASTA_format) --  
perhaps that's the reason Bio::AlignIO::fasta doesn't permit them?

And then by the time missing_char() is applied, the question marks  
are already gone.

What happens if you read in your sequence with question marks in a  
format that explicitly permits question marks?

Dave


On Apr 13, 2006, at 7:38 PM, Kai M?ller wrote:

> hi,
>
> I'm very new to BioPerl and have a maybe silly question.
> when using Bio::AlignIO to load a set of sequences, the  
> questionmarks are
> simply lost (they refer to missing characters as opposed to gap  
> characters
> [-] or ambiguity [N]). I thought that 'missing_char()' might help,  
> but it
> didn't (I probably used it the wrong way).
>
> when $filename contains sequences with ????, the following snippet  
> would
> produce an alignment with ???? lost and downstream nucleotide just  
> shifted
> and the resulting length differnces filled by '---' @ 3' end:
>
>
> my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' =>  
> 'fasta');
> 	my $aln = $aln_in->next_aln();
> 	$aln->gap_char('-');
> 	$aln->missing_char('?');
> 	
> 	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' =>  
> 'clustalw');
> 	$testout->write_aln($aln);
>
>
>
> Can somebody give me a hint here?
>
> thanks and all the best,
>
> Kai M?ller
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l





From dmessina at wustl.edu  Fri Apr 14 01:14:25 2006
From: dmessina at wustl.edu (David Messina)
Date: Fri, 14 Apr 2006 00:14:25 -0500
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <200604132038.01568.kaimueller@uni-bonn.de>
References: <200604132038.01568.kaimueller@uni-bonn.de>
Message-ID: <CA36F230-179A-41A0-8AA1-3FDAC292AC93@wustl.edu>

Hi Kai,

I'm by no means an expert with this module, but I'll take a shot.

Running your code through a debugger, I'm seeing that  
Bio::AlignIO::fasta is gobbling the question marks:

line 66: $MATCHPATTERN = '^A-Za-z\.\-';

and then where $entry contains a line of sequence from the input file

line 118: $entry =~ s/[$MATCHPATTERN]//g;

As far as I can tell, a question mark is not a valid character for  
the FASTA format (see http://en.wikipedia.org/wiki/FASTA_format) --  
perhaps that's the reason Bio::AlignIO::fasta doesn't permit them?

And then by the time missing_char() is applied, the question marks  
are already gone.

What happens if you read in your sequence with question marks in a  
format that explicitly permits question marks?

Dave


On Apr 13, 2006, at 7:38 PM, Kai M?ller wrote:

> hi,
>
> I'm very new to BioPerl and have a maybe silly question.
> when using Bio::AlignIO to load a set of sequences, the  
> questionmarks are
> simply lost (they refer to missing characters as opposed to gap  
> characters
> [-] or ambiguity [N]). I thought that 'missing_char()' might help,  
> but it
> didn't (I probably used it the wrong way).
>
> when $filename contains sequences with ????, the following snippet  
> would
> produce an alignment with ???? lost and downstream nucleotide just  
> shifted
> and the resulting length differnces filled by '---' @ 3' end:
>
>
> my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' =>  
> 'fasta');
> 	my $aln = $aln_in->next_aln();
> 	$aln->gap_char('-');
> 	$aln->missing_char('?');
> 	
> 	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' =>  
> 'clustalw');
> 	$testout->write_aln($aln);
>
>
>
> Can somebody give me a hint here?
>
> thanks and all the best,
>
> Kai M?ller
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From madhurima_b at persistent.co.in  Fri Apr 14 08:41:46 2006
From: madhurima_b at persistent.co.in (madhurima bhattacharjee)
Date: Fri, 14 Apr 2006 18:11:46 +0530
Subject: [Bioperl-l] problem with needle
Message-ID: <443F988A.5090400@persistent.co.in>

Hello,
I am new ti BioPerl.I am using the pise module to perform needle allignment.
I am using the following code:

use Bio::Tools::Run::AnalysisFactory::Pise;
my $factory = new Bio::Tools::Run::AnalysisFactory::Pise();
my $needle = $factory->program('needle');
my $job = $needle->run(-sequencea => $ARGV[0],
                       -seqall => $ARGV[1],
                       -gapopen => 5,
                       -gapextend => 1);
if ($job->error) {
    print ".............error: ",$job->error_message,".............\n";
    exit;
}
print STDERR "jobid: ", $job->jobid, "\n";
print $job->content('needletest.needle');

But it gives me the following error:
.............error: Bio::Tools::Run::PiseJob _submit: Can't connect to 
bioweb.pasteur.fr:80 (connect: timeout).............

Can anyone please point me to the problem in code.I am really stuck in this.

Thanks and Regards,
Madhurima.



From cjfields at uiuc.edu  Fri Apr 14 11:00:55 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Apr 2006 10:00:55 -0500
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <1145023261.12449.15.camel@localhost>
Message-ID: <000a01c65fd4$3b4dae90$15327e82@pyrimidine>

This has been fixed in CVS a week or two ago.  It was reported as a bug
before:

http://bioperl.org/pipermail/bioperl-guts-l/2006-April/020836.html

If you either install from CVS or replace your local Bio::AlignIO::fasta
with the CVS version; it should work then.  

I don't adding '?' necessarily think it harms anything; the intent is to
maintain the nucleotide positions in the alignment.  If you used this
alignment (from the bug above):

>seq1
AAAAAAA?A?A
>seq2
AAAAAAA?AAA
>seq3
AAAAAAAAAAA
>seq4
AAAAAAAAAAA

then you got this when passing through AlignIO before the fix:

>seq1
AAAAAAAAA--
>seq2
AAAAAAAAAA-
>seq3
AAAAAAAAAAA
>seq4
AAAAAAAAAAA

which is not good since nucleotide positions in the alignment are modified
and gaps are introduced where there shouldn't be any.  After the fix you get
what you expect (the same as input).

A few proprietary sequence analysis programs use (or formerly used) '?' to
mean 'N or gap' or 'N' and actively exported this symbol to other formats.
I think older versions of Sequencher or Strider did this but I can't be
certain; I've slept since then.  Anyway, the intent of the user here is to
maintain the integrity of the alignment, so regardless of what '?' means the
nucleotide positions in the alignment are retained.  

OT here but another issue with Sequencher is that ':' is used for gaps as
well, something that Bio::AlignIO::fasta doesn't address.  I haven't tried
this out to see what it does, but I wouldn't be surprised if it breaks
again.

My question is, how many alignment formats don't retain positional
information?  In other words, don't all alignment formats (FASTA, clustal,
MSF) have sequences that have the same length with all gaps included
(internal and at both ends) so that they retain position regardless of what
symbols are used?

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Albert Vilella
> Sent: Friday, April 14, 2006 9:01 AM
> To: Kai M?ller
> Cc: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] Bio::AlignIO ignores questionmarks?
> 
> It seems like missing_char is more for SimpleAlign than for AlignIO. So
> in case of fasta files with '?' chars, they will be ignores in line 113
> of Bio::AlignIO::fasta.pm.
> 
> So you can add '\?' in that line of fasta.pm.
> 
> That will parse it correctly, although I am not sure whether fasta
> format should or shouldn't allow '?' chars in the file.
> 
> Anyone?
> 
> Cheers,
> 
>     Albert.
> 
> On Thu, 2006-04-13 at 20:38 -0400, Kai M?ller wrote:
> > hi,
> >
> > I'm very new to BioPerl and have a maybe silly question.
> > when using Bio::AlignIO to load a set of sequences, the questionmarks
> are
> > simply lost (they refer to missing characters as opposed to gap
> characters
> > [-] or ambiguity [N]). I thought that 'missing_char()' might help, but
> it
> > didn't (I probably used it the wrong way).
> >
> > when $filename contains sequences with ????, the following snippet would
> > produce an alignment with ???? lost and downstream nucleotide just
> shifted
> > and the resulting length differnces filled by '---' @ 3' end:
> >
> >
> > my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' =>
> 'fasta');
> > 	my $aln = $aln_in->next_aln();
> > 	$aln->gap_char('-');
> > 	$aln->missing_char('?');
> >
> > 	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' =>
> 'clustalw');
> > 	$testout->write_aln($aln);
> >
> >
> >
> > Can somebody give me a hint here?
> >
> > thanks and all the best,
> >
> > Kai M?ller
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From arareko at campus.iztacala.unam.mx  Fri Apr 14 11:10:47 2006
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Fri, 14 Apr 2006 10:10:47 -0500
Subject: [Bioperl-l] problem with needle
In-Reply-To: <443F988A.5090400@persistent.co.in>
References: <443F988A.5090400@persistent.co.in>
Message-ID: <443FBB77.2080306@campus.iztacala.unam.mx>

The error means that the bioweb.pasteur.fr server was probably down in 
that moment or it couldn't be looked up. Try again later :)

Regards,
Mauricio.

madhurima bhattacharjee wrote:
> Hello,
> I am new ti BioPerl.I am using the pise module to perform needle allignment.
> I am using the following code:
> 
> use Bio::Tools::Run::AnalysisFactory::Pise;
> my $factory = new Bio::Tools::Run::AnalysisFactory::Pise();
> my $needle = $factory->program('needle');
> my $job = $needle->run(-sequencea => $ARGV[0],
>                        -seqall => $ARGV[1],
>                        -gapopen => 5,
>                        -gapextend => 1);
> if ($job->error) {
>     print ".............error: ",$job->error_message,".............\n";
>     exit;
> }
> print STDERR "jobid: ", $job->jobid, "\n";
> print $job->content('needletest.needle');
> 
> But it gives me the following error:
> .............error: Bio::Tools::Run::PiseJob _submit: Can't connect to 
> bioweb.pasteur.fr:80 (connect: timeout).............
> 
> Can anyone please point me to the problem in code.I am really stuck in this.
> 
> Thanks and Regards,
> Madhurima.
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From cjfields at uiuc.edu  Fri Apr 14 11:41:09 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Apr 2006 10:41:09 -0500
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <CA36F230-179A-41A0-8AA1-3FDAC292AC93@wustl.edu>
Message-ID: <000b01c65fd9$daa9a250$15327e82@pyrimidine>

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of David Messina
> Sent: Friday, April 14, 2006 12:14 AM
> To: Kai M?ller
> Cc: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] Bio::AlignIO ignores questionmarks?
> 
> Hi Kai,
> 
> I'm by no means an expert with this module, but I'll take a shot.
> 
> Running your code through a debugger, I'm seeing that
> Bio::AlignIO::fasta is gobbling the question marks:
> 
> line 66: $MATCHPATTERN = '^A-Za-z\.\-';
> 
> and then where $entry contains a line of sequence from the input file
> 
> line 118: $entry =~ s/[$MATCHPATTERN]//g;
> 
> As far as I can tell, a question mark is not a valid character for
> the FASTA format (see http://en.wikipedia.org/wiki/FASTA_format) --
> perhaps that's the reason Bio::AlignIO::fasta doesn't permit them?
 
I wouldn't trust wikipedia with that one.  Check out the bioperl page:

http://www.bioperl.org/wiki/FASTA_sequence_format

The problem is, there is no really well-established universal rule for FASTA
format.  These are three valid FASTA input sequences for some programs:

>xyz
X

>
-

>


It's all dependent on how a program/web interface imports the sequence.  You
don't need a description line, just '>' will do.  Some don't even reuire a
sequence, though most filters will warn you.  Even the rules for wrapping
the sequences on multiple line are different (is it 60, 80, 100, or none?).
I know, when I first started (early '90's), a quick and easy way to get
sequences ready for BLAST searches which required FASTA was copy-paste and
add '>' and CR in a line above, with no additional line breaks in the
sequence (all on one line).  Still works AFAIK...

> And then by the time missing_char() is applied, the question marks
> are already gone.
> 
> What happens if you read in your sequence with question marks in a
> format that explicitly permits question marks?
> 
> Dave
> 
> 
> On Apr 13, 2006, at 7:38 PM, Kai M?ller wrote:
> 
> > hi,
> >
> > I'm very new to BioPerl and have a maybe silly question.
> > when using Bio::AlignIO to load a set of sequences, the
> > questionmarks are
> > simply lost (they refer to missing characters as opposed to gap
> > characters
> > [-] or ambiguity [N]). I thought that 'missing_char()' might help,
> > but it
> > didn't (I probably used it the wrong way).
> >
> > when $filename contains sequences with ????, the following snippet
> > would
> > produce an alignment with ???? lost and downstream nucleotide just
> > shifted
> > and the resulting length differnces filled by '---' @ 3' end:
> >
> >
> > my $aln_in = Bio::AlignIO->new(-file => "$filename", '-format' =>
> > 'fasta');
> > 	my $aln = $aln_in->next_aln();
> > 	$aln->gap_char('-');
> > 	$aln->missing_char('?');
> >
> > 	my $testout = Bio::AlignIO->new(-fh => \*STDOUT , '-format' =>
> > 'clustalw');
> > 	$testout->write_aln($aln);
> >
> >
> >
> > Can somebody give me a hint here?
> >
> > thanks and all the best,
> >
> > Kai M?ller
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at uiuc.edu  Fri Apr 14 14:36:40 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 14 Apr 2006 13:36:40 -0500
Subject: [Bioperl-l] Bio::AlignIO ignores questionmarks?
In-Reply-To: <000a01c65fd4$3b4dae90$15327e82@pyrimidine>
Message-ID: <000001c65ff2$5ed883d0$15327e82@pyrimidine>


> I don't adding '?' necessarily think it harms anything; the intent is to
> maintain the nucleotide positions in the alignment.  If you used this
> alignment (from the bug above):
....

Oi!  Forgot to clean up my sentence there.  Should be "I don't think adding
'?' necessarily harms anything."  


Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign



From cjfields at uiuc.edu  Tue Apr 18 10:09:19 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Apr 2006 09:09:19 -0500
Subject: [Bioperl-l] FW: Bioperl PAML bug
Message-ID: <000201c662f1$afc288c0$15327e82@pyrimidine>

Jason,

There is a new bug for PAML results parsing:  

http://bugzilla.open-bio.org/show_bug.cgi?id=1983

I'll try looking into it but I can't get around to it until late tomorrow or
Thursday at the earliest; I'm forwarding this to you and the mail list in
case you or others might have ideas.  Looks like the results aren't parsed
past the third model result in the test results file (in the bug report).
Below is the email I sent to the bug submitter.

Cheers!

Chris

P.S.  Hope you're enjoying the break after your defense.  Congrats again!

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu]
> Sent: Tuesday, April 18, 2006 8:55 AM
> To: 'nivsabath at hotmail.com'
> Subject: Bioperl PAML bug
> 
> From what I have read on the HOWTO PAML page, I believe you globbed
> together two different scripts here; in other words, the submitted script
> is NOT the same as on the web page.
> 
> =====================================
> use strict;
> use Bio::Tools::Run::Phylo::PAML::Codeml;
> use Bio::Tools::Run::Alignment::Clustalw;
> 
> # for projecting alignments from protein to R/DNA space
> use Bio::Align::Utilities qw(aa_to_dna_aln);
> 
> # for input of the sequence data
> use Bio::SeqIO;
> use Bio::AlignIO;
> ...
> =====================================
> 
> should be:
> =====================================
> use strict;
> use Bio::Tools::Phylo::PAML;
> ...
> =====================================
> 
> since you're only parsing PAML output (not running PAML and parsing the
> results).
> 
> Regardless, I still get errors here; it looks like it's not parsing past
> the first three models, so it's a legit bug.  Looks like the parser
> doesn't catch the end of the model (calling the model method time_used
> gets an "Use of uninitialized value in print" error).
> 
> Also, looks like the POD and docs for using Bioperl and PAML are a bit
> out-of-date and still refer to names of older methods (I ran into a number
> of missing method calls while looking into this).  I won't be able to get
> to this today but I'll drop Jason a line to see what he thinks.
> 
> Chris
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign



From akarger at CGR.Harvard.edu  Tue Apr 18 13:30:58 2006
From: akarger at CGR.Harvard.edu (Amir Karger)
Date: Tue, 18 Apr 2006 13:30:58 -0400
Subject: [Bioperl-l] BioPerl Mailing List Summaries
Message-ID: <BB91E836FD4CDC4E830F628F39CDFF047EE42D@huls5.nucleus.harvard.edu>

Nice!

I'd suggest putting a link to (the News blog in general and) a
Mailing_List_Summaries page in the Current Events section, for those who
don't read the navbar. Mailing_List_Summaries can just be a list of
links to biweekly summary pages (which can be on the wiki or the blog,
as you prefer).

- Amir Karger
Computational Biology Group
Bauer Center for Genomics Research
Harvard University
617-496-0626

> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Tuesday, April 11, 2006 9:53 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] BioPerl Mailing List Summaries
> 
> The first of a biweekly summary of BioPerl mailing list 
> summaries has been
> posted to the wiki:
> 
> http://www.bioperl.org/wiki/BioPerl_Mailing_List_Summaries_for
> _April_1-11
> 
> These will likely be archived on the wiki but may be moved to a more
> suitable location in the future (maybe to the news blog?).  
> Any suggestions
> are welcome.
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign 
> 
> 
> 
> 


From dwaner at scitegic.com  Tue Apr 18 18:05:59 2006
From: dwaner at scitegic.com (David Waner)
Date: Tue, 18 Apr 2006 15:05:59 -0700
Subject: [Bioperl-l] PSI-BLAST parsing fails on Windows
Message-ID: <444562C7.7080506@scitegic.com>

I have found that there is a small difference in output format between 
the linux and Windows versions of NCBI blastpgp that causes parsing of 
psi-blast results to fail on Windows.  Specifically, the Windows version 
of blastpgp does not output the "Searching.done" lines between the 
results of each iteration.  For example:
---------------------------------------------------------------------------------
LINUX:

Database: C:\BioPerl\REGRES~1\Output\R517_protDB
           100 sequences; 33,683 total letters

Searching.done


Results from round 1
---------------------------------------------------------------------------------
WINDOWS:

Database: C:\BioPerl\REGRES~1\Output\R517_protDB
           100 sequences; 33,683 total letters


Results from round 1
---------------------------------------------------------------------------------
As a fix I have changed line 474 of Bio::SearchIO::blast.pm
from:
    elsif (/^Searching/) {
to:
    elsif (/^Results from round/) {

This seems to fix the problem without breaking anything, but I would 
like to see if anyone on the mailing list can run some additional test 
cases, or sees anything wrong with this proposed change before I submit 
it to bugzilla.

Thanks.

- David


Additional information:

This problem occurs with blast versions 2.2.10 and 2.2.13.
I have the latest version of blast.pm (1.92) from the bioperl-live cvs.




From cjfields at uiuc.edu  Tue Apr 18 20:19:48 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 18 Apr 2006 19:19:48 -0500
Subject: [Bioperl-l] PSI-BLAST parsing fails on Windows
In-Reply-To: <444562C7.7080506@scitegic.com>
References: <444562C7.7080506@scitegic.com>
Message-ID: <5F0C81D9-295D-4E71-A344-88DB667857B3@uiuc.edu>

Could you submit this as a bug in Bugzilla so we can track it and  
attach the blast output files if they are small enough?  If Bugzilla  
rejects the files b/c they are too large (I think the cutoff is  
100-200 KB) you can attach them to an email and send them to me  
directly.  I'll try the fix on Mac OS X and Windows, run tests, and  
commit the fix if everything passes.

Chris

On Apr 18, 2006, at 5:05 PM, David Waner wrote:

> I have found that there is a small difference in output format between
> the linux and Windows versions of NCBI blastpgp that causes parsing of
> psi-blast results to fail on Windows.  Specifically, the Windows  
> version
> of blastpgp does not output the "Searching.done" lines between the
> results of each iteration.  For example:
> ---------------------------------------------------------------------- 
> -----------
> LINUX:
>
> Database: C:\BioPerl\REGRES~1\Output\R517_protDB
>            100 sequences; 33,683 total letters
>
> Searching.done
>
>
> Results from round 1
> ---------------------------------------------------------------------- 
> -----------
> WINDOWS:
>
> Database: C:\BioPerl\REGRES~1\Output\R517_protDB
>            100 sequences; 33,683 total letters
>
>
> Results from round 1
> ---------------------------------------------------------------------- 
> -----------
> As a fix I have changed line 474 of Bio::SearchIO::blast.pm
> from:
>     elsif (/^Searching/) {
> to:
>     elsif (/^Results from round/) {
>
> This seems to fix the problem without breaking anything, but I would
> like to see if anyone on the mailing list can run some additional test
> cases, or sees anything wrong with this proposed change before I  
> submit
> it to bugzilla.
>
> Thanks.
>
> - David
>
>
> Additional information:
>
> This problem occurs with blast versions 2.2.10 and 2.2.13.
> I have the latest version of blast.pm (1.92) from the bioperl-live  
> cvs.
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From Marc.Logghe at DEVGEN.com  Fri Apr 21 04:56:02 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 21 Apr 2006 10:56:02 +0200
Subject: [Bioperl-l] Input for Bio::CodonUsage::IO
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746D0B@ANTARESIA.be.devgen.com>

Hi,
I was wondering what format Bio::CodonUsage::IO expects as input for the
-file option.
I tried to pass it a *.cut file generated by EMBOSS' cutgextract that
looks like this:
#Species: Oryza sativa
#Division: gbpln
#Release: CUTG
#CdsCount: 70050

#Coding GC 55.34%
#1st letter GC 58.41%
#2nd letter GC 46.34%
#3rd letter GC 61.29%

#Codon AA Fraction Frequency Number
GCA    A     0.185    17.382 431151
<skipped>
TGA    *     0.435     1.228  30463

Looking into the _parse() method of Bio::CodonUsage::IO it appears that
the table resembles this kind of format but is actually not exactly what
it expects. My question is: how should it really look like ? I could not
find an example in t/data.
Any clues ?
Thanks,
Marc 


From prabubio at gmail.com  Fri Apr 21 06:45:46 2006
From: prabubio at gmail.com (Prabu R)
Date: Fri, 21 Apr 2006 16:15:46 +0530
Subject: [Bioperl-l] Genbank parsing using Bioperl
Message-ID: <c27e2f070604210345r4858e074ub7cc7ae4511a7dd9@mail.gmail.com>

Dear all!

I am a novice bioperl user, trying to parse Genbank files with Bioperl
modules to get some specific features and details.

Anyone please tell me, whether we can retrive a Gene, its Transcript ID and
its Protein ID from the Genbank file.

I mainly need to extract with one to one relationship between TranscriptID
and Protein ID.

I was trying this. I was able to take these details if the gene is not
alternatively spliced.

If a gene contains multiple mRNA/CDS feature, I am not able to build the
relationship between Transcript and its Protein.

Kindly help me to find out whether this is possible in Bioperl.

Thanks in advance,

R. Prabu


From osborne1 at optonline.net  Fri Apr 21 09:09:12 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri, 21 Apr 2006 09:09:12 -0400
Subject: [Bioperl-l] Input for Bio::CodonUsage::IO
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746D0B@ANTARESIA.be.devgen.com>
Message-ID: <C06E51B8.8328%osborne1@optonline.net>

Marc,

It wants a file from the database CUTG. You can ftp them from this mirror:

ftp://ftp.ebi.ac.uk/pub/databases/cutg


Brian O.


On 4/21/06 4:56 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:

> Hi,
> I was wondering what format Bio::CodonUsage::IO expects as input for the
> -file option.
> I tried to pass it a *.cut file generated by EMBOSS' cutgextract that
> looks like this:
> #Species: Oryza sativa
> #Division: gbpln
> #Release: CUTG
> #CdsCount: 70050
> 
> #Coding GC 55.34%
> #1st letter GC 58.41%
> #2nd letter GC 46.34%
> #3rd letter GC 61.29%
> 
> #Codon AA Fraction Frequency Number
> GCA    A     0.185    17.382 431151
> <skipped>
> TGA    *     0.435     1.228  30463
> 
> Looking into the _parse() method of Bio::CodonUsage::IO it appears that
> the table resembles this kind of format but is actually not exactly what
> it expects. My question is: how should it really look like ? I could not
> find an example in t/data.
> Any clues ?
> Thanks,
> Marc 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From Marc.Logghe at DEVGEN.com  Fri Apr 21 09:26:07 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Fri, 21 Apr 2006 15:26:07 +0200
Subject: [Bioperl-l] Input for Bio::CodonUsage::IO
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746D0E@ANTARESIA.be.devgen.com>

Hi Brian
Thanks for the reply.
I might be overlooking something but I dowloaded this last week. The
tarball contained *.codon and *.spsum files and did not look at all like
as a codon usage table (kind of pseudo fasta). For that reason, I used
EMBOSS cutgextract that produced *.cut files starting from the CUTG
*.codon files. 

I finally managed to parse this *.cut files.
In order to do that I created a Bio::CodonUsage::IO::emboss module that
only contains the private _parse() method. The setup I used is a copycat
from Bio::SeqIO.
Meaning, now you can do:
my $io  = Bio::CodonUsage::IO->new( -file => shift, -format => 'emboss'
);

In case no format option is given it defaults to the
Bio::CodonUsage::IO::default module that contains the _parse() method
from the original Bio::CodonUsage::IO module. Actually, this should be
changed to a name that makes more sense but I did not know what this
default format looks like and/or where it comes from. My guess it is
coming from http://www.kazusa.or.jp but the site seems to be broken. At
least today.
Currently I continue with this setup in house, but in case you think it
is usefull to commit, just let me know.
Cheers,
Marc

 

> -----Original Message-----
> From: Brian Osborne [mailto:osborne1 at optonline.net] 
> Sent: Friday, April 21, 2006 3:09 PM
> To: Marc Logghe; bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] Input for Bio::CodonUsage::IO
> 
> Marc,
> 
> It wants a file from the database CUTG. You can ftp them from 
> this mirror:
> 
> ftp://ftp.ebi.ac.uk/pub/databases/cutg
> 
> 
> Brian O.
> 
> 
> On 4/21/06 4:56 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:
> 
> > Hi,
> > I was wondering what format Bio::CodonUsage::IO expects as 
> input for 
> > the -file option.
> > I tried to pass it a *.cut file generated by EMBOSS' 
> cutgextract that 
> > looks like this:
> > #Species: Oryza sativa
> > #Division: gbpln
> > #Release: CUTG
> > #CdsCount: 70050
> > 
> > #Coding GC 55.34%
> > #1st letter GC 58.41%
> > #2nd letter GC 46.34%
> > #3rd letter GC 61.29%
> > 
> > #Codon AA Fraction Frequency Number
> > GCA    A     0.185    17.382 431151
> > <skipped>
> > TGA    *     0.435     1.228  30463
> > 
> > Looking into the _parse() method of Bio::CodonUsage::IO it appears 
> > that the table resembles this kind of format but is actually not 
> > exactly what it expects. My question is: how should it really look 
> > like ? I could not find an example in t/data.
> > Any clues ?
> > Thanks,
> > Marc
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 


From sdavis2 at mail.nih.gov  Fri Apr 21 09:21:20 2006
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Fri, 21 Apr 2006 09:21:20 -0400
Subject: [Bioperl-l] Genbank parsing using Bioperl
In-Reply-To: <c27e2f070604210345r4858e074ub7cc7ae4511a7dd9@mail.gmail.com>
Message-ID: <C06E5490.9FE2%sdavis2@mail.nih.gov>




On 4/21/06 6:45 AM, "Prabu R" <prabubio at gmail.com> wrote:

> Dear all!
> 
> I am a novice bioperl user, trying to parse Genbank files with Bioperl
> modules to get some specific features and details.
> 
> Anyone please tell me, whether we can retrive a Gene, its Transcript ID and
> its Protein ID from the Genbank file.
> 
> I mainly need to extract with one to one relationship between TranscriptID
> and Protein ID.
> 
> I was trying this. I was able to take these details if the gene is not
> alternatively spliced.
> 
> If a gene contains multiple mRNA/CDS feature, I am not able to build the
> relationship between Transcript and its Protein.
> 
> Kindly help me to find out whether this is possible in Bioperl.

See here:

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

However, genbank is only a repository, so not every transcript is going to
necessarily have a protein annotation, I don't think.  You might want to
look into using something like the RefSeq set (from NCBI) or Ensembl, both
of which have very rich annotation associated with their
transcripts/proteins.

Sean


From prabubio at gmail.com  Fri Apr 21 09:24:56 2006
From: prabubio at gmail.com (Prabu R)
Date: Fri, 21 Apr 2006 18:54:56 +0530
Subject: [Bioperl-l] Genbank parsing using Bioperl
In-Reply-To: <C06E5490.9FE2%sdavis2@mail.nih.gov>
References: <c27e2f070604210345r4858e074ub7cc7ae4511a7dd9@mail.gmail.com>
	<C06E5490.9FE2%sdavis2@mail.nih.gov>
Message-ID: <c27e2f070604210624r5c1de58fu9545b01e2e20239f@mail.gmail.com>

Dear All,

I feel sorry for making a small mistake in my earlier mail

I am not actually using Genbank releases, But Refseq Genome build gbk files
of NCBI (ftp.ncbi.nih.gov/genomes/)

Those files are genbank formatted and contains Refseq IDs.

Kindly help.

R. Prabu

----------------------------
Dear all!

I am a novice bioperl user, trying to parse Genbank files with Bioperl
modules to get some specific features and details.

Anyone please tell me, whether we can retrive a Gene, its Transcript ID and
its Protein ID from the Genbank file.

I mainly need to extract with one to one relationship between TranscriptID
and Protein ID.

I was trying this. I was able to take these details if the gene is not
alternatively spliced.

If a gene contains multiple mRNA/CDS feature, I am not able to build the
relationship between Transcript and its Protein.

Kindly help me to find out whether this is possible in Bioperl.

Thanks in advance,

R. Prabu


From cjfields at uiuc.edu  Fri Apr 21 11:26:53 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 21 Apr 2006 10:26:53 -0500
Subject: [Bioperl-l] Genbank parsing using Bioperl
In-Reply-To: <c27e2f070604210624r5c1de58fu9545b01e2e20239f@mail.gmail.com>
Message-ID: <000601c66558$04c8e540$15327e82@pyrimidine>

I'm adding my 2c since I've got a bit of time on my hands.  I'll add that I
found most of these answers by looking through the mail list archives (now
searchable through Gmane) and the BioPerl wiki.

I believe Sean pointed out the HOWTO on the BioPerl wiki: 

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation

http://www.bioperl.org/wiki/HOWTO:Feature-Annotation#Getting_Sequences

In theory, you should be able to retrieve from the CDS feature which gene
feature or transcript each coding feature belongs to, and normally vice
versa.  I may be wrong (I work with bacterial genome sequences mainly), but
I believe this is completely dependent on how well the features are
annotated (which can vary greatly between different sequencing centers) so
can be a bit tricky depending on the source of the GenBank file.  I would,
instead, try a database that's well-curated and has a consistent interface
across different genome projects.  In other words, something like what Sean
suggested, like Ensembl:  

http://www.ensembl.org/index.html

Use can use the Ensembl Perl API to retrieve data from Ensembl databases:

http://www.ensembl.org/info/software/core/core_tutorial.html

You could also have a look at Entrez Gene; Brian's working on modules (in
CVS) for retrieving and parsing Entrez Gene's output:

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene

You'll need the Bio::ASN1 parser for Brian's modules:

http://sourceforge.net/projects/egparser

Both Ensembl and Entrez Gene are constantly updated for transcript/protein
information and are likely what you are looking for.

Chris

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Prabu R
> Sent: Friday, April 21, 2006 8:25 AM
> To: bioperl-l at lists.open-bio.org; Sean Davis
> Subject: Re: [Bioperl-l] Genbank parsing using Bioperl
> 
> Dear All,
> 
> I feel sorry for making a small mistake in my earlier mail
> 
> I am not actually using Genbank releases, But Refseq Genome build gbk
> files
> of NCBI (ftp.ncbi.nih.gov/genomes/)
> 
> Those files are genbank formatted and contains Refseq IDs.
> 
> Kindly help.
> 
> R. Prabu
> 
> ----------------------------
> Dear all!
> 
> I am a novice bioperl user, trying to parse Genbank files with Bioperl
> modules to get some specific features and details.
> 
> Anyone please tell me, whether we can retrive a Gene, its Transcript ID
> and
> its Protein ID from the Genbank file.
> 
> I mainly need to extract with one to one relationship between TranscriptID
> and Protein ID.
> 
> I was trying this. I was able to take these details if the gene is not
> alternatively spliced.
> 
> If a gene contains multiple mRNA/CDS feature, I am not able to build the
> relationship between Transcript and its Protein.
> 
> Kindly help me to find out whether this is possible in Bioperl.
> 
> Thanks in advance,
> 
> R. Prabu
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From bornmand at BATTELLE.ORG  Fri Apr 21 12:49:41 2006
From: bornmand at BATTELLE.ORG (Bornman, Daniel M)
Date: Fri, 21 Apr 2006 12:49:41 -0400
Subject: [Bioperl-l] StandAlone BLAST on Windows???
Message-ID: <DB3DE9AC61BB914B91021AA9D7DD63540153116B@WS-BEST-MSE2.milky-way.battelle.org>

Dear BioPerl Listers,

Does anyone know if the BioPerl StandAloneBlast module works on Windows?

I have a very simple script that will not work correctly.

My PATH is set to 'C:\BLASTDB\bin'
My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory

Here is the script:

## START ##

BEGIN{
$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
}
use strict;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;

my @params = (program  => 'blastn', database => 'ecoli.nt'); my
$blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
=>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj =
$report_obj->next_result; print $result_obj->num_hits;

## END ##


Here is the error message I get:

[NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
-d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z 

STACK Bio::Tools::Run::StandAloneBlast::_runblast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
STACK toplevel localblast.pl:12

--------------------------------------


Thank You,

Daniel Bornman
Researcher
Battelle Memorial Institute
505 King Ave
Columbus, OH 43201
614.424.3229


From cjfields at uiuc.edu  Fri Apr 21 13:16:00 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 21 Apr 2006 12:16:00 -0500
Subject: [Bioperl-l] StandAlone BLAST on Windows???
In-Reply-To: <DB3DE9AC61BB914B91021AA9D7DD63540153116B@WS-BEST-MSE2.milky-way.battelle.org>
Message-ID: <000e01c66567$42d72270$15327e82@pyrimidine>

Do you have the database formatted and are your env variables set correctly
in the ncbi.ini file?  From this output,

[NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin

it looks like blastall couldn't find the properly formatted database (env
variable not set correctly) or that the database doesn't exist (need to
format using formatdb).  If I remember correctly, the directory containing
your data in your ncbi.ini file (I placed mine in the C:\Windows dir) should
look something like this:

[NCBI] 
Data=C:\Research\blast\data

You might also want to try leaving out the BLASTDIR if it is already set in
ncbi.ini.  If you can't get it working I'll look into it (unless Torsten has
WinXP????). 

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Bornman, Daniel M
> Sent: Friday, April 21, 2006 11:50 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] StandAlone BLAST on Windows???
> 
> Dear BioPerl Listers,
> 
> Does anyone know if the BioPerl StandAloneBlast module works on Windows?
> 
> I have a very simple script that will not work correctly.
> 
> My PATH is set to 'C:\BLASTDB\bin'
> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
> 
> Here is the script:
> 
> ## START ##
> 
> BEGIN{
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my @params = (program  => 'blastn', database => 'ecoli.nt'); my
> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj =
> $report_obj->next_result; print $result_obj->num_hits;
> 
> ## END ##
> 
> 
> Here is the error message I get:
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
> 
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
> 
> --------------------------------------
> 
> 
> Thank You,
> 
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From bornmand at BATTELLE.ORG  Fri Apr 21 13:52:07 2006
From: bornmand at BATTELLE.ORG (Bornman, Daniel M)
Date: Fri, 21 Apr 2006 13:52:07 -0400
Subject: [Bioperl-l] StandAlone BLAST on Windows???
Message-ID: <DB3DE9AC61BB914B91021AA9D7DD6354015311DD@WS-BEST-MSE2.milky-way.battelle.org>

All that you have asked about is in place.


1) My PATH variable is set to 'C:\BLASTDB\bin\'


2) the 'ncbi.ini' file is in the C:\WINDOWS directory
The contents of this file are:

[NCBI]
Data=C:\BLASTDB\data 


3) I formatted the ecoli.nt database with the following command in the
DOS prompt...

formatdb -i ecoli.nt -p F -o T

...this generated 7 files in the C:\BLASTDB\data\ directory.
(I can generate a Blast output with the following command..."blastall -p
blastn -d ecoli.nt -i test.txt -o test.out")



4) I also tried running the script after commenting out the
"$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';" section



BUPKIS...



HAS ANYONE HERE EVER TRIED AND HAD SUCCESS USING 'StandAloneBlast' ON
WINDOWS?







-----Original Message-----
From: Chris Fields [mailto:cjfields at uiuc.edu] 
Sent: Friday, April 21, 2006 1:16 PM
To: Bornman, Daniel M; bioperl-l at lists.open-bio.org
Subject: RE: [Bioperl-l] StandAlone BLAST on Windows???

Do you have the database formatted and are your env variables set
correctly in the ncbi.ini file?  From this output,

[NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin

it looks like blastall couldn't find the properly formatted database
(env variable not set correctly) or that the database doesn't exist
(need to format using formatdb).  If I remember correctly, the directory
containing your data in your ncbi.ini file (I placed mine in the
C:\Windows dir) should look something like this:

[NCBI]
Data=C:\Research\blast\data

You might also want to try leaving out the BLASTDIR if it is already set
in ncbi.ini.  If you can't get it working I'll look into it (unless
Torsten has WinXP????). 

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- 
> bounces at lists.open-bio.org] On Behalf Of Bornman, Daniel M
> Sent: Friday, April 21, 2006 11:50 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] StandAlone BLAST on Windows???
> 
> Dear BioPerl Listers,
> 
> Does anyone know if the BioPerl StandAloneBlast module works on
Windows?
> 
> I have a very simple script that will not work correctly.
> 
> My PATH is set to 'C:\BLASTDB\bin'
> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
> 
> Here is the script:
> 
> ## START ##
> 
> BEGIN{
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my @params = (program  => 'blastn', database => 'ecoli.nt'); my 
> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq 
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj = 
> $report_obj->next_result; print $result_obj->num_hits;
> 
> ## END ##
> 
> 
> Here is the error message I get:
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn

> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o 
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
> 
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
> 
> --------------------------------------
> 
> 
> Thank You,
> 
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From bornmand at BATTELLE.ORG  Fri Apr 21 14:10:15 2006
From: bornmand at BATTELLE.ORG (Bornman, Daniel M)
Date: Fri, 21 Apr 2006 14:10:15 -0400
Subject: [Bioperl-l] StandAlone BLAST on Windows???
Message-ID: <DB3DE9AC61BB914B91021AA9D7DD6354015311F9@WS-BEST-MSE2.milky-way.battelle.org>

Barry's suggestion has apparently fixed the problem.

My simple script only asked for number of hits which returns "35" and I
am not getting an error msg.

Further testing will say for sure but it looks pretty good.

Thanks Barry!

-Dan 

-----Original Message-----
From: Barry Moore [mailto:barry.moore at genetics.utah.edu] 
Sent: Friday, April 21, 2006 2:01 PM
To: Bornman, Daniel M
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] StandAlone BLAST on Windows???

Change

> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
to
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\;
or set
>
> $ENV{BLASTDB} = 'C:\\BLASTDB\\data';
and when you do a blastp search don't forget to add
> $ENV{BLASTMAT} = 'C:\\BLASTDB\\data';

BLASTDIR points to your blast executables, and assumes a data directory
underneath that for databases and matrix files.  If you have the
standard setup with the executable in one directory and the databases
and matrix files in a subdirectory 'data'  can set BLASTDIR to take care
of everything.  If you've put that executables, databases, or matrix
files in different locations then you'll want to set BLASTDB to point
directly to the database, and BLASTMAT to the matrix files (probably the
same directory).  I know the ncbi.ini file is supposed to take care of
all of this, but it seems like I had trouble with that approach in the
past, and just went back to setting ENV variables.

Barry

On Apr 21, 2006, at 10:49 AM, Bornman, Daniel M wrote:

> Dear BioPerl Listers,
>
> Does anyone know if the BioPerl StandAloneBlast module works on 
> Windows?
>
> I have a very simple script that will not work correctly.
>
> My PATH is set to 'C:\BLASTDB\bin'
> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
>
> Here is the script:
>
> ## START ##
>
> BEGIN{
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
>
> my @params = (program  => 'blastn', database => 'ecoli.nt'); my 
> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq 
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj = 
> $report_obj->next_result; print $result_obj->num_hits;
>
> ## END ##
>
>
> Here is the error message I get:
>
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
>
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn

> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o 
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
>
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
>
> --------------------------------------
>
>
> Thank You,
>
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From barry.moore at genetics.utah.edu  Fri Apr 21 14:00:38 2006
From: barry.moore at genetics.utah.edu (Barry Moore)
Date: Fri, 21 Apr 2006 12:00:38 -0600
Subject: [Bioperl-l] StandAlone BLAST on Windows???
In-Reply-To: <DB3DE9AC61BB914B91021AA9D7DD63540153116B@WS-BEST-MSE2.milky-way.battelle.org>
References: <DB3DE9AC61BB914B91021AA9D7DD63540153116B@WS-BEST-MSE2.milky-way.battelle.org>
Message-ID: <AD07ED78-4037-457C-822B-ED9A67F556A0@genetics.utah.edu>

Change

> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
to
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\;
or set
>
> $ENV{BLASTDB} = 'C:\\BLASTDB\\data';
and when you do a blastp search don't forget to add
> $ENV{BLASTMAT} = 'C:\\BLASTDB\\data';

BLASTDIR points to your blast executables, and assumes a data  
directory underneath that for databases and matrix files.  If you  
have the standard setup with the executable in one directory and the  
databases and matrix files in a subdirectory 'data'  can set BLASTDIR  
to take care of everything.  If you've put that executables,  
databases, or matrix files in different locations then you'll want to  
set BLASTDB to point directly to the database, and BLASTMAT to the  
matrix files (probably the same directory).  I know the ncbi.ini file  
is supposed to take care of all of this, but it seems like I had  
trouble with that approach in the past, and just went back to setting  
ENV variables.

Barry

On Apr 21, 2006, at 10:49 AM, Bornman, Daniel M wrote:

> Dear BioPerl Listers,
>
> Does anyone know if the BioPerl StandAloneBlast module works on  
> Windows?
>
> I have a very simple script that will not work correctly.
>
> My PATH is set to 'C:\BLASTDB\bin'
> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
>
> Here is the script:
>
> ## START ##
>
> BEGIN{
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
>
> my @params = (program  => 'blastn', database => 'ecoli.nt'); my
> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj =
> $report_obj->next_result; print $result_obj->num_hits;
>
> ## END ##
>
>
> Here is the error message I get:
>
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
>
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
>
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
>
> --------------------------------------
>
>
> Thank You,
>
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From bornmand at BATTELLE.ORG  Fri Apr 21 10:13:03 2006
From: bornmand at BATTELLE.ORG (Bornman, Daniel M)
Date: Fri, 21 Apr 2006 10:13:03 -0400
Subject: [Bioperl-l] StandAloneBlast in Windows
Message-ID: <DB3DE9AC61BB914B91021AA9D7DD6354015310BB@WS-BEST-MSE2.milky-way.battelle.org>


Dear BioPerl,


Does anyone know how to use "Bio::Tools::Run::StandAloneBlast" in
Windows?

I am able to query my own stand alone blast database from the command
line directly without perl so I know its installed correctly but I am
unable to get my BioPerl script to work.  Here is a very simple program
example and the error message I get.  
My Path (Environmental Variable) is set to 'C:\BLASTDB\bin'



## START ##
BEGIN{
	$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
}

use strict;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;

my @params = (program  => 'blastn', database => 'ecoli.nt');
my $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
=>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
my $report_obj = $blast_obj->blastall($seq_obj);
my $result_obj = $report_obj->next_result;
print $result_obj->num_hits;
## END ##


## ERROR MESSAGE START ##

[NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
-d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z 

STACK Bio::Tools::Run::StandAloneBlast::_runblast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
STACK toplevel localblast.pl:12

--------------------------------------

## ERROR MESSAGE END ##


Any help would be greatly appreciated.

Thanks,
Dan



Daniel Bornman
Researcher
Battelle Memorial Institute
505 King Ave
Columbus, OH 43201
614.424.3229


From cjfields at uiuc.edu  Fri Apr 21 14:23:01 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 21 Apr 2006 13:23:01 -0500
Subject: [Bioperl-l] StandAlone BLAST on Windows???
In-Reply-To: <44491EE4.7030908@atgc.org>
Message-ID: <001b01c66570$9fb13090$15327e82@pyrimidine>




> -----Original Message-----
> From: Alexander Kozik [mailto:akozik at atgc.org]
> Sent: Friday, April 21, 2006 1:05 PM
> To: Bornman, Daniel M
> Cc: Chris Fields; bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] StandAlone BLAST on Windows???
> 
> It looks as a query file was located on
> -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx
> "Documents and Settings" Windows directory.
> NCBI BLAST on windows does not understand white spaces in file names and
> folders/directories. Removing of white space(s) from file names and
> directories may solve the problem. Also, pay attention to the short
> style "DOCUME~1" of these names in this particular report.
> 
> Alexander Kozik
> Bioinformatics Specialist
> Genome and Biomedical Sciences Facility
> 451 East Health Sciences Drive
> University of California
> Davis, CA 95616-8816
> Phone: (530) 754-9127
> email#1: akozik at atgc.org
> email#2: akozik at gmail.com
> web: http://www.atgc.org/
> 
> 
> Bornman, Daniel M wrote:
> > All that you have asked about is in place.
> >
> >
> > 1) My PATH variable is set to 'C:\BLASTDB\bin\'
> >
> >
> > 2) the 'ncbi.ini' file is in the C:\WINDOWS directory
> > The contents of this file are:
> >
> > [NCBI]
> > Data=C:\BLASTDB\data
> >
> >
> > 3) I formatted the ecoli.nt database with the following command in the
> > DOS prompt...
> >
> > formatdb -i ecoli.nt -p F -o T
> >
> > ...this generated 7 files in the C:\BLASTDB\data\ directory.
> > (I can generate a Blast output with the following command..."blastall -p
> > blastn -d ecoli.nt -i test.txt -o test.out")
> >
> >
> >
> > 4) I also tried running the script after commenting out the
> > "$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';" section
> >
> >
> >
> > BUPKIS...
> >
> >
> >
> > HAS ANYONE HERE EVER TRIED AND HAD SUCCESS USING 'StandAloneBlast' ON
> > WINDOWS?
> >

Really not the best way to go about asking for help.  I'm looking into it.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign


From cjfields at uiuc.edu  Fri Apr 21 14:23:41 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 21 Apr 2006 13:23:41 -0500
Subject: [Bioperl-l] StandAloneBlast in Windows
In-Reply-To: <DB3DE9AC61BB914B91021AA9D7DD6354015310BB@WS-BEST-MSE2.milky-way.battelle.org>
Message-ID: <001c01c66570$b78fe080$15327e82@pyrimidine>

And don't spam the mail list with repeated requests.  It shows a lack of
respect.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Bornman, Daniel M
> Sent: Friday, April 21, 2006 9:13 AM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] StandAloneBlast in Windows
> 
> 
> Dear BioPerl,
> 
> 
> Does anyone know how to use "Bio::Tools::Run::StandAloneBlast" in
> Windows?
> 
> I am able to query my own stand alone blast database from the command
> line directly without perl so I know its installed correctly but I am
> unable to get my BioPerl script to work.  Here is a very simple program
> example and the error message I get.
> My Path (Environmental Variable) is set to 'C:\BLASTDB\bin'
> 
> 
> 
> ## START ##
> BEGIN{
> 	$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> 
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my @params = (program  => 'blastn', database => 'ecoli.nt');
> my $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj);
> my $result_obj = $report_obj->next_result;
> print $result_obj->num_hits;
> ## END ##
> 
> 
> ## ERROR MESSAGE START ##
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
> 
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
> 
> --------------------------------------
> 
> ## ERROR MESSAGE END ##
> 
> 
> Any help would be greatly appreciated.
> 
> Thanks,
> Dan
> 
> 
> 
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From akozik at atgc.org  Fri Apr 21 14:05:24 2006
From: akozik at atgc.org (Alexander Kozik)
Date: Fri, 21 Apr 2006 11:05:24 -0700
Subject: [Bioperl-l] StandAlone BLAST on Windows???
In-Reply-To: <DB3DE9AC61BB914B91021AA9D7DD6354015311DD@WS-BEST-MSE2.milky-way.battelle.org>
References: <DB3DE9AC61BB914B91021AA9D7DD6354015311DD@WS-BEST-MSE2.milky-way.battelle.org>
Message-ID: <44491EE4.7030908@atgc.org>

It looks as a query file was located on
-i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx
"Documents and Settings" Windows directory.
NCBI BLAST on windows does not understand white spaces in file names and 
folders/directories. Removing of white space(s) from file names and 
directories may solve the problem. Also, pay attention to the short 
style "DOCUME~1" of these names in this particular report.

Alexander Kozik
Bioinformatics Specialist
Genome and Biomedical Sciences Facility
451 East Health Sciences Drive
University of California
Davis, CA 95616-8816
Phone: (530) 754-9127
email#1: akozik at atgc.org
email#2: akozik at gmail.com
web: http://www.atgc.org/


Bornman, Daniel M wrote:
> All that you have asked about is in place.
> 
> 
> 1) My PATH variable is set to 'C:\BLASTDB\bin\'
> 
> 
> 2) the 'ncbi.ini' file is in the C:\WINDOWS directory
> The contents of this file are:
> 
> [NCBI]
> Data=C:\BLASTDB\data 
> 
> 
> 3) I formatted the ecoli.nt database with the following command in the
> DOS prompt...
> 
> formatdb -i ecoli.nt -p F -o T
> 
> ...this generated 7 files in the C:\BLASTDB\data\ directory.
> (I can generate a Blast output with the following command..."blastall -p
> blastn -d ecoli.nt -i test.txt -o test.out")
> 
> 
> 
> 4) I also tried running the script after commenting out the
> "$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';" section
> 
> 
> 
> BUPKIS...
> 
> 
> 
> HAS ANYONE HERE EVER TRIED AND HAD SUCCESS USING 'StandAloneBlast' ON
> WINDOWS?
> 
> 
> 
> 
> 
> 
> 
> -----Original Message-----
> From: Chris Fields [mailto:cjfields at uiuc.edu] 
> Sent: Friday, April 21, 2006 1:16 PM
> To: Bornman, Daniel M; bioperl-l at lists.open-bio.org
> Subject: RE: [Bioperl-l] StandAlone BLAST on Windows???
> 
> Do you have the database formatted and are your env variables set
> correctly in the ncbi.ini file?  From this output,
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> it looks like blastall couldn't find the properly formatted database
> (env variable not set correctly) or that the database doesn't exist
> (need to format using formatdb).  If I remember correctly, the directory
> containing your data in your ncbi.ini file (I placed mine in the
> C:\Windows dir) should look something like this:
> 
> [NCBI]
> Data=C:\Research\blast\data
> 
> You might also want to try leaving out the BLASTDIR if it is already set
> in ncbi.ini.  If you can't get it working I'll look into it (unless
> Torsten has WinXP????). 
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign 
> 
> 
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- 
>> bounces at lists.open-bio.org] On Behalf Of Bornman, Daniel M
>> Sent: Friday, April 21, 2006 11:50 AM
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] StandAlone BLAST on Windows???
>>
>> Dear BioPerl Listers,
>>
>> Does anyone know if the BioPerl StandAloneBlast module works on
> Windows?
>> I have a very simple script that will not work correctly.
>>
>> My PATH is set to 'C:\BLASTDB\bin'
>> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
>>
>> Here is the script:
>>
>> ## START ##
>>
>> BEGIN{
>> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
>> }
>> use strict;
>> use Bio::Seq;
>> use Bio::Tools::Run::StandAloneBlast;
>>
>> my @params = (program  => 'blastn', database => 'ecoli.nt'); my 
>> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
>> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq 
>> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
>> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj = 
>> $report_obj->next_result; print $result_obj->num_hits;
>>
>> ## END ##
>>
>>
>> Here is the error message I get:
>>
>> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
>>
>> ------------- EXCEPTION  -------------
>> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> 
>> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o 
>> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
>>
>> STACK Bio::Tools::Run::StandAloneBlast::_runblast
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
>> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
>> STACK Bio::Tools::Run::StandAloneBlast::blastall
>> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
>> STACK toplevel localblast.pl:12
>>
>> --------------------------------------
>>
>>
>> Thank You,
>>
>> Daniel Bornman
>> Researcher
>> Battelle Memorial Institute
>> 505 King Ave
>> Columbus, OH 43201
>> 614.424.3229
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From bornmand at BATTELLE.ORG  Fri Apr 21 11:57:48 2006
From: bornmand at BATTELLE.ORG (Bornman, Daniel M)
Date: Fri, 21 Apr 2006 11:57:48 -0400
Subject: [Bioperl-l] StandAlone BLAST on Windows
Message-ID: <DB3DE9AC61BB914B91021AA9D7DD635401531144@WS-BEST-MSE2.milky-way.battelle.org>

Does anyone know if the BioPerl StandAloneBlast module works on Windows?

I have a very simple script that will not work correctly.

My PATH is set to 'C:\BLASTDB\bin'
My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory

Here is the script:

## START ##

BEGIN{
$ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
}
use strict;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;

my @params = (program  => 'blastn', database => 'ecoli.nt'); 
my $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
=>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
my $report_obj = $blast_obj->blastall($seq_obj); 
my $result_obj = $report_obj->next_result; 
print $result_obj->num_hits;

## END ##


Here is the error message I get:

[NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin

------------- EXCEPTION  -------------
MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
-d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z 

STACK Bio::Tools::Run::StandAloneBlast::_runblast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
STACK Bio::Tools::Run::StandAloneBlast::blastall
C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
STACK toplevel localblast.pl:12

--------------------------------------



From osborne1 at optonline.net  Fri Apr 21 17:29:54 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri, 21 Apr 2006 17:29:54 -0400
Subject: [Bioperl-l] StandAlone BLAST on Windows???
In-Reply-To: <DB3DE9AC61BB914B91021AA9D7DD63540153116B@WS-BEST-MSE2.milky-way.battelle.org>
Message-ID: <C06EC712.8347%osborne1@optonline.net>

Daniel,

Yes, it runs on Windows, no problem. Some questions: did you run formatdb?
Can you run blastall from the commandline using these same files?

Brian O.


On 4/21/06 12:49 PM, "Bornman, Daniel M" <bornmand at battelle.org> wrote:

> Dear BioPerl Listers,
> 
> Does anyone know if the BioPerl StandAloneBlast module works on Windows?
> 
> I have a very simple script that will not work correctly.
> 
> My PATH is set to 'C:\BLASTDB\bin'
> My database, 'ecoli.nt' is in 'C:\BLASTDB\data' directory
> 
> Here is the script:
> 
> ## START ##
> 
> BEGIN{
> $ENV{BLASTDIR} = 'C:\\BLASTDB\\data';
> }
> use strict;
> use Bio::Seq;
> use Bio::Tools::Run::StandAloneBlast;
> 
> my @params = (program  => 'blastn', database => 'ecoli.nt'); my
> $blast_obj = Bio::Tools::Run::StandAloneBlast->new(@params);
> my $seq_obj = Bio::Seq->new(-id  =>"testquery", -seq
> =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
> my $report_obj = $blast_obj->blastall($seq_obj); my $result_obj =
> $report_obj->next_result; print $result_obj->num_hits;
> 
> ## END ##
> 
> 
> Here is the error message I get:
> 
> [NULL_Caption] WARNING: testquery: Unable to open ecoli.nt.nin
> 
> ------------- EXCEPTION  -------------
> MSG: blastall call crashed: 256 C:\BLASTDB\bin\blastall.exe -p  blastn
> -d  "\ecoli.nt"  -i  C:\DOCUME~1\Home\LOCALS~1\Temp\QZwYdo9eKx  -o
> C:\DOCUME~1\Home\LOCALS~1\Temp\ADP2OcZw8z
> 
> STACK Bio::Tools::Run::StandAloneBlast::_runblast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:732
> STACK Bio::Tools::Run::StandAloneBlast::_generic_local_blast
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:680
> STACK Bio::Tools::Run::StandAloneBlast::blastall
> C:/Perl/site/lib/Bio/Tools/Run/StandAloneBlast.pm:536
> STACK toplevel localblast.pl:12
> 
> --------------------------------------
> 
> 
> Thank You,
> 
> Daniel Bornman
> Researcher
> Battelle Memorial Institute
> 505 King Ave
> Columbus, OH 43201
> 614.424.3229
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From osborne1 at optonline.net  Fri Apr 21 18:00:11 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri, 21 Apr 2006 18:00:11 -0400
Subject: [Bioperl-l] Input for Bio::CodonUsage::IO
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746D0E@ANTARESIA.be.devgen.com>
Message-ID: <C06ECE2B.834A%osborne1@optonline.net>

Marc,

I spoke too soon, looking at IO.pm's _parse method shows clearly that it's
meant to parse the same format it writes, something like what's shown below.
As you noted, this doesn't look anything like the *codon files, which have a
fasta-style header followed by 64 numbers, clearly these are the counts of
codons in the sequence that's referenced.

In addition IO.pm wouldn't have worked anyway, it was missing a basic "use"
statement, fixed now. Like you I can't connect to Codon at Kasuza, when I
can I'll see if it can provide us with a file formatted something like the
text below.

Brian O.


WDW311031#4\AJ311031\complement(1717..2511)\795\CAC84661.1\Wheat dwarf virus
- [unknown]  1  CDS's

AmAcid   Codon             Number       /1000    Fraction

Gly      GGG                 0.00        0.00        0.00
Gly      GGA                 0.00        0.00        0.00
Gly      GGT                 0.00        0.00        0.00
Gly      GGC                 0.00        0.00        0.00

Glu      GAG                 0.00        0.00        0.00
Glu      GAA                 0.00        0.00        0.00
Asp      GAT                 0.00        0.00        0.00
Asp      GAC                 0.00        0.00        0.00

Val      GTG                 0.00        0.00        0.00
Val      GTA                 0.00        0.00        0.00
Val      GTT                 0.00        0.00        0.00
Val      GTC                 0.00        0.00        0.00

Ala      GCG                 0.00        0.00        0.00
Ala      GCA                 0.00        0.00        0.00
Ala      GCT                 0.00        0.00        0.00
Ala      GCC                 0.00        0.00        0.00

Arg      AGG                 0.00        0.00        0.00
Arg      AGA                 0.00        0.00        0.00
Ser      AGT                 0.00        0.00        0.00
Ser      AGC                 0.00        0.00        0.00

Lys      AAG                 0.00        0.00        0.00
Lys      AAA                 0.00        0.00        0.00
Asn      AAT                 0.00        0.00        0.00
Asn      AAC                 0.00        0.00        0.00

Met      ATG                 0.00        0.00        0.00
Ile      ATA                 0.00        0.00        0.00
Ile      ATT                 0.00        0.00        0.00
Ile      ATC                 0.00        0.00        0.00

Thr      ACG                 0.00        0.00        0.00
Thr      ACA                 0.00        0.00        0.00
Thr      ACT                 0.00        0.00        0.00
Thr      ACC                 0.00        0.00        0.00

Trp      TGG                 0.00        0.00        0.00
Ter      TGA                 0.00        0.00        0.00
Cys      TGT                 0.00        0.00        0.00
Cys      TGC                 0.00        0.00        0.00

Ter      TAG                 0.00        0.00        0.00
Ter      TAA                 0.00        0.00        0.00
Tyr      TAT                 0.00        0.00        0.00
Tyr      TAC                 0.00        0.00        0.00

Leu      TTG                 0.00        0.00        0.00
Leu      TTA                 0.00        0.00        0.00
Phe      TTT                 0.00        0.00        0.00
Phe      TTC                 0.00        0.00        0.00

Ser      TCG                 0.00        0.00        0.00
Ser      TCA                 0.00        0.00        0.00
Ser      TCT                 0.00        0.00        0.00
Ser      TCC                 0.00        0.00        0.00

Arg      CGG                 0.00        0.00        0.00
Arg      CGA                 0.00        0.00        0.00
Arg      CGT                 0.00        0.00        0.00
Arg      CGC                 0.00        0.00        0.00

Gln      CAG                 0.00        0.00        0.00
Gln      CAA                 0.00        0.00        0.00
His      CAT                 0.00        0.00        0.00
His      CAC                 0.00        0.00        0.00

Leu      CTG                 0.00        0.00        0.00
Leu      CTA                 0.00        0.00        0.00
Leu      CTT                 0.00        0.00        0.00
Leu      CTC                 0.00        0.00        0.00

Pro      CCG                 0.00        0.00        0.00
Pro      CCA                 0.00        0.00        0.00
Pro      CCT                 0.00        0.00        0.00
Pro      CCC                 0.00        0.00        0.00



Coding GC 0%
1st letter GC 0%
2nd letter GC 0%
3rd letter GC 0%
Genetic code 1




On 4/21/06 9:26 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:

> Hi Brian
> Thanks for the reply.
> I might be overlooking something but I dowloaded this last week. The
> tarball contained *.codon and *.spsum files and did not look at all like
> as a codon usage table (kind of pseudo fasta). For that reason, I used
> EMBOSS cutgextract that produced *.cut files starting from the CUTG
> *.codon files. 
> 
> I finally managed to parse this *.cut files.
> In order to do that I created a Bio::CodonUsage::IO::emboss module that
> only contains the private _parse() method. The setup I used is a copycat
> from Bio::SeqIO.
> Meaning, now you can do:
> my $io  = Bio::CodonUsage::IO->new( -file => shift, -format => 'emboss'
> );
> 
> In case no format option is given it defaults to the
> Bio::CodonUsage::IO::default module that contains the _parse() method
> from the original Bio::CodonUsage::IO module. Actually, this should be
> changed to a name that makes more sense but I did not know what this
> default format looks like and/or where it comes from. My guess it is
> coming from http://www.kazusa.or.jp but the site seems to be broken. At
> least today.
> Currently I continue with this setup in house, but in case you think it
> is usefull to commit, just let me know.
> Cheers,
> Marc
> 
>  
> 
>> -----Original Message-----
>> From: Brian Osborne [mailto:osborne1 at optonline.net]
>> Sent: Friday, April 21, 2006 3:09 PM
>> To: Marc Logghe; bioperl-l at lists.open-bio.org
>> Subject: Re: [Bioperl-l] Input for Bio::CodonUsage::IO
>> 
>> Marc,
>> 
>> It wants a file from the database CUTG. You can ftp them from
>> this mirror:
>> 
>> ftp://ftp.ebi.ac.uk/pub/databases/cutg
>> 
>> 
>> Brian O.
>> 
>> 
>> On 4/21/06 4:56 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:
>> 
>>> Hi,
>>> I was wondering what format Bio::CodonUsage::IO expects as
>> input for 
>>> the -file option.
>>> I tried to pass it a *.cut file generated by EMBOSS'
>> cutgextract that
>>> looks like this:
>>> #Species: Oryza sativa
>>> #Division: gbpln
>>> #Release: CUTG
>>> #CdsCount: 70050
>>> 
>>> #Coding GC 55.34%
>>> #1st letter GC 58.41%
>>> #2nd letter GC 46.34%
>>> #3rd letter GC 61.29%
>>> 
>>> #Codon AA Fraction Frequency Number
>>> GCA    A     0.185    17.382 431151
>>> <skipped>
>>> TGA    *     0.435     1.228  30463
>>> 
>>> Looking into the _parse() method of Bio::CodonUsage::IO it appears
>>> that the table resembles this kind of format but is actually not
>>> exactly what it expects. My question is: how should it really look
>>> like ? I could not find an example in t/data.
>>> Any clues ?
>>> Thanks,
>>> Marc
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From sdavis2 at mail.nih.gov  Fri Apr 21 18:06:04 2006
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Fri, 21 Apr 2006 18:06:04 -0400
Subject: [Bioperl-l] Genbank parsing using Bioperl
In-Reply-To: <c27e2f070604210624r5c1de58fu9545b01e2e20239f@mail.gmail.com>
References: <c27e2f070604210345r4858e074ub7cc7ae4511a7dd9@mail.gmail.com>	
	<C06E5490.9FE2%sdavis2@mail.nih.gov>
	<c27e2f070604210624r5c1de58fu9545b01e2e20239f@mail.gmail.com>
Message-ID: <4449574C.7050208@mail.nih.gov>

Prabu R wrote:
> Dear All,
> 
> I feel sorry for making a small mistake in my earlier mail
> 
> I am not actually using Genbank releases, But Refseq Genome build gbk 
> files of NCBI (ftp.ncbi.nih.gov/genomes/ <http://ftp.ncbi.nih.gov/genomes/>)
> 
> Those files are genbank formatted and contains Refseq IDs.
> 
> Kindly help.
> 
> R. Prabu
> 
> ----------------------------
> Dear all!
> 
> I am a novice bioperl user, trying to parse Genbank files with Bioperl 
> modules to get some specific features and details.
> 
> Anyone please tell me, whether we can retrive a Gene, its Transcript ID 
> and its Protein ID from the Genbank file.
> 
> I mainly need to extract with one to one relationship between 
> TranscriptID and Protein ID.

Just grab this file:

ftp://ftp.ncbi.nih.gov/gene/DATA/gene2refseq.gz

It contains the one-to-one mapping you are looking for in a 
tab-delimited format.

Sean

From osborne1 at optonline.net  Fri Apr 21 18:07:13 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Fri, 21 Apr 2006 18:07:13 -0400
Subject: [Bioperl-l] Input for Bio::CodonUsage::IO
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746D0E@ANTARESIA.be.devgen.com>
Message-ID: <C06ECFD1.834C%osborne1@optonline.net>

Marc,

An example input file for Bio::CodonUsage::IO is t/data/MmCT.

Brian O.


On 4/21/06 9:26 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:

> Hi Brian
> Thanks for the reply.
> I might be overlooking something but I dowloaded this last week. The
> tarball contained *.codon and *.spsum files and did not look at all like
> as a codon usage table (kind of pseudo fasta). For that reason, I used
> EMBOSS cutgextract that produced *.cut files starting from the CUTG
> *.codon files. 
> 
> I finally managed to parse this *.cut files.
> In order to do that I created a Bio::CodonUsage::IO::emboss module that
> only contains the private _parse() method. The setup I used is a copycat
> from Bio::SeqIO.
> Meaning, now you can do:
> my $io  = Bio::CodonUsage::IO->new( -file => shift, -format => 'emboss'
> );
> 
> In case no format option is given it defaults to the
> Bio::CodonUsage::IO::default module that contains the _parse() method
> from the original Bio::CodonUsage::IO module. Actually, this should be
> changed to a name that makes more sense but I did not know what this
> default format looks like and/or where it comes from. My guess it is
> coming from http://www.kazusa.or.jp but the site seems to be broken. At
> least today.
> Currently I continue with this setup in house, but in case you think it
> is usefull to commit, just let me know.
> Cheers,
> Marc
> 
>  
> 
>> -----Original Message-----
>> From: Brian Osborne [mailto:osborne1 at optonline.net]
>> Sent: Friday, April 21, 2006 3:09 PM
>> To: Marc Logghe; bioperl-l at lists.open-bio.org
>> Subject: Re: [Bioperl-l] Input for Bio::CodonUsage::IO
>> 
>> Marc,
>> 
>> It wants a file from the database CUTG. You can ftp them from
>> this mirror:
>> 
>> ftp://ftp.ebi.ac.uk/pub/databases/cutg
>> 
>> 
>> Brian O.
>> 
>> 
>> On 4/21/06 4:56 AM, "Marc Logghe" <Marc.Logghe at DEVGEN.com> wrote:
>> 
>>> Hi,
>>> I was wondering what format Bio::CodonUsage::IO expects as
>> input for 
>>> the -file option.
>>> I tried to pass it a *.cut file generated by EMBOSS'
>> cutgextract that
>>> looks like this:
>>> #Species: Oryza sativa
>>> #Division: gbpln
>>> #Release: CUTG
>>> #CdsCount: 70050
>>> 
>>> #Coding GC 55.34%
>>> #1st letter GC 58.41%
>>> #2nd letter GC 46.34%
>>> #3rd letter GC 61.29%
>>> 
>>> #Codon AA Fraction Frequency Number
>>> GCA    A     0.185    17.382 431151
>>> <skipped>
>>> TGA    *     0.435     1.228  30463
>>> 
>>> Looking into the _parse() method of Bio::CodonUsage::IO it appears
>>> that the table resembles this kind of format but is actually not
>>> exactly what it expects. My question is: how should it really look
>>> like ? I could not find an example in t/data.
>>> Any clues ?
>>> Thanks,
>>> Marc
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From torsten.seemann at infotech.monash.edu.au  Fri Apr 21 20:59:43 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Sat, 22 Apr 2006 10:59:43 +1000
Subject: [Bioperl-l] Speed of bioperl mailing list distribution
Message-ID: <44497FFF.7000801@infotech.monash.edu.au>

Hi,

I've noticed that we often get repeated posts on the Bioperl lists,
as well as multiple duplicate responses that are hours apart in post time.

I just thought I should mention that a post to bioperl-l (or an appearance in 
bioperl-guts-l after a CVS commit), from my point of view, can take up to 10 
hours to appear, at best 30 minutes. I'm not sure where the delay is but I 
don't think it is at my end (?).

So a new poster may post multiple times under the assumption that the first 
ones didn't work because the didn't appear in a timely fashion (for their 
definition of timely :-). And responders will respond because they haven't yet 
received the previous response which already answered the post.

Just thought I'd mention it - any one else have this problem?

-- 
Torsten Seemann
Victorian Bioinformatics Consortium, Monash University, Australia
http://www.vicbioinformatics.com/

From cjfields at uiuc.edu  Fri Apr 21 22:05:54 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 21 Apr 2006 21:05:54 -0500
Subject: [Bioperl-l] Speed of bioperl mailing list distribution
In-Reply-To: <44497FFF.7000801@infotech.monash.edu.au>
Message-ID: <000301c665b1$497503a0$15327e82@pyrimidine>

This problem was mentioned by Daniel Bornman earlier today (the one I sniped
at for repeated posts).  He sent three emails which didn't make it through
until this afternoon.  I originally thought it might be the changeover to
the new server.  However, personally, I haven't seen any problems today,
though I have seen slowdowns before.  A post to the list went through just
fine this morning around the same time that Daniel sent an email to the list
(my post to the list was at 10:27 AM and I received it through the list at
10:34 AM).  It could be a server problem on his end.  If your running into
the same problem it could be coincidence, but it likely is something else.
Bad timing?  

I also made CVS commits which showed up pretty quickly on bioperl-guts-l
yesterday.  

I believe Chris D. mentioned at some point that the mail to the list goes
through virus-checking and a spam-filters so that explains a slight delay,
but not several hours.  

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 


> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Torsten Seemann
> Sent: Friday, April 21, 2006 8:00 PM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] Speed of bioperl mailing list distribution
> 
> Hi,
> 
> I've noticed that we often get repeated posts on the Bioperl lists,
> as well as multiple duplicate responses that are hours apart in post time.
> 
> I just thought I should mention that a post to bioperl-l (or an appearance
> in
> bioperl-guts-l after a CVS commit), from my point of view, can take up to
> 10
> hours to appear, at best 30 minutes. I'm not sure where the delay is but I
> don't think it is at my end (?).
> 
> So a new poster may post multiple times under the assumption that the
> first
> ones didn't work because the didn't appear in a timely fashion (for their
> definition of timely :-). And responders will respond because they haven't
> yet
> received the previous response which already answered the post.
> 
> Just thought I'd mention it - any one else have this problem?
> 
> --
> Torsten Seemann
> Victorian Bioinformatics Consortium, Monash University, Australia
> http://www.vicbioinformatics.com/
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From jason.stajich at duke.edu  Sat Apr 22 09:11:53 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Sat, 22 Apr 2006 09:11:53 -0400
Subject: [Bioperl-l] Speed of bioperl mailing list distribution
In-Reply-To: <000301c665b1$497503a0$15327e82@pyrimidine>
References: <000301c665b1$497503a0$15327e82@pyrimidine>
Message-ID: <64CE332B-6B2D-486E-A858-1610E3C460D5@duke.edu>

(ChrisD will probably be offline for a few days with some server  
issues for his company.)

One reason for the slowdown can be greylisting.  See http:// 
en.wikipedia.org/wiki/Greylisting  - We have enabled greylisting so  
mails to the list from new IP addresses will take longer the first  
time a message is sent because the server requires the sender's SMTP  
server to reconnect to the OBF server a second time.  This cuts down  
dramatically on spam that is sent by transient IPs or by spammers and  
we feel that the short delay is better than the reams of spam we had  
to moderate in the past.  The CVS commits come from an internal  
server so they will be already okayed without a retry.  Posts from  
non-subscribers must wait in purgatory for a list admin to okay them  
via the mailman software.  Currently myself and a few other people  
monitor this and try and authorize posts as soon as possible.

There have been a few problems on the new mailing list and web server  
due mostly to it not having a lot of memory installed.  This has  
usually been the delay when the machine locked up and for us to do  
our remote-reset of the box.   You would have also noticed that the  
website was unreachable during that time.  It appears that Chris has  
installed the new mem yesterday so we hope this will be less of an  
issue in the future but we are still trying to investigate whether  
there is a memory leak in some of the software or if this was all due  
to the low-memory conditions.  This usual the problem with long  
mailing delays are a server problem and nothing particular that a  
user has to worry about.


-jason
On Apr 21, 2006, at 10:05 PM, Chris Fields wrote:

> This problem was mentioned by Daniel Bornman earlier today (the one  
> I sniped
> at for repeated posts).  He sent three emails which didn't make it  
> through
> until this afternoon.  I originally thought it might be the  
> changeover to
> the new server.  However, personally, I haven't seen any problems  
> today,
> though I have seen slowdowns before.  A post to the list went  
> through just
> fine this morning around the same time that Daniel sent an email to  
> the list
> (my post to the list was at 10:27 AM and I received it through the  
> list at
> 10:34 AM).  It could be a server problem on his end.  If your  
> running into
> the same problem it could be coincidence, but it likely is  
> something else.
> Bad timing?
>
> I also made CVS commits which showed up pretty quickly on bioperl- 
> guts-l
> yesterday.
>
> I believe Chris D. mentioned at some point that the mail to the  
> list goes
> through virus-checking and a spam-filters so that explains a slight  
> delay,
> but not several hours.
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>> bounces at lists.open-bio.org] On Behalf Of Torsten Seemann
>> Sent: Friday, April 21, 2006 8:00 PM
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] Speed of bioperl mailing list distribution
>>
>> Hi,
>>
>> I've noticed that we often get repeated posts on the Bioperl lists,
>> as well as multiple duplicate responses that are hours apart in  
>> post time.
>>
>> I just thought I should mention that a post to bioperl-l (or an  
>> appearance
>> in
>> bioperl-guts-l after a CVS commit), from my point of view, can  
>> take up to
>> 10
>> hours to appear, at best 30 minutes. I'm not sure where the delay  
>> is but I
>> don't think it is at my end (?).
>>
>> So a new poster may post multiple times under the assumption that the
>> first
>> ones didn't work because the didn't appear in a timely fashion  
>> (for their
>> definition of timely :-). And responders will respond because they  
>> haven't
>> yet
>> received the previous response which already answered the post.
>>
>> Just thought I'd mention it - any one else have this problem?
>>
>> --
>> Torsten Seemann
>> Victorian Bioinformatics Consortium, Monash University, Australia
>> http://www.vicbioinformatics.com/
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From robertemurphy at hotmail.com  Sun Apr 23 23:13:21 2006
From: robertemurphy at hotmail.com (Robert Murphy)
Date: Sun, 23 Apr 2006 22:13:21 -0500
Subject: [Bioperl-l] BLAST and parsing question
Message-ID: <BAY106-DAV28B43A01909FCB14D9F96BDBE0@phx.gbl>

#!/usr/bin/perl; 

use strict;
Hi, I have a sequence and db I made myself. I have to run blast on
subsequences of length 20 and identify the ones that are unique to my
sequence. Any suggestion on how to go about doing this? I can get blast
to "blast" my sequence, at length 20, but I'm having lots of trouble
with parsing. There are so many parameters to set up. Any suggstions on
which ones I need to accomplish my goal. The current code I'm using
gives me 1000's of OUT files. There has to be a better way than having
to read get of the OUT files. Below is the code I'm using. Thank you in
advance.

# installed bioperl locally, use local bioperl lib
#use lib="/home/murphyr/lib/";

use Bio::Seq; 
use Bio::SeqIO::fasta; 
use Bio::Tools::Blast; 
use Bio::Tools::Run::StandAloneBlast; 
use Bio::Tools::SeqStats; 
use Data::Dumper; 
print "Program to blast subsequences \n"; 

print "Enter File name of Sequence in FASTA Format \n";
my $inputfile = <STDIN>;
print "$inputfile \n";
my $inseq1 = Bio::SeqIO ->new('-file' => "$inputfile", '-format'=>
'fasta');
my $outseq1 = new Bio::SeqIO (-fh  => \*STDOUT, -format => 'fasta');
my $seq1 = $inseq1 -> next_seq();
my $seq_stats1 = Bio::Tools::SeqStats->new(-seq=>$seq1);
my $monomer_ref = $seq_stats1 -> count_monomers();
my @k = keys %$monomer_ref;
my @v = values %$monomer_ref;
print "@k\n";
print "@v\n";
my $mytotal = 0;
foreach my $value (@v) {
    $mytotal = $mytotal + $value;
}

# print "$seq1 -> seq()\n";
my $did = $seq1 -> display_id();

print "$did\n";

print "Here \n";
# print $outseq1 -> write_seq($seq1);

my $start_pos = 0;
my $end_pos = 24;  

while ($end_pos != $mytotal) { 

$start_pos = $start_pos + 1;
$end_pos = $end_pos + 1; 

my $subseq = $seq1 -> subseq($start_pos, $end_pos);

print "$subseq \n"; 

print "Now doing blast on $subseq \n"; 

my @params = ('program'  => 'blastn',
             'database' => 'virus-db',
             'outfile' => "$subseq.out"); 

my $factory = Bio::Tools::Run::StandAloneBlast->new(@params);
my $subinput = Bio::Seq->new('-id'=>"sub test query",
                         '-seq'=>"$subseq");
my $blast_report = $factory->blastall($subinput);

# Get the report
my $searchio = new Bio::SearchIO ('-format' => 'blast',
                                 '-file'   => "$subseq.out");
my $result = $searchio->next_result;
# Get info about the entire report
$result->database_name;
my $algorithm_type =  $result->algorithm;
# get info about the first hit
my $hit = $result->next_hit;
my $hit_name = $hit->name ;
# get info about the first hsp of the first hit
my $hsp = $hit->next_hsp;
my $hsp_start = $hsp->query->start;

print "Now parsing the blast reports using SearchIO \n"; 
#
# Not being selective here ... print the whole she-bang! ...
#
print "Algorithm Type \n";  
print "$algorithm_type \n";

while ( (my $khit, my $vhit) = each %{$hit}) { 
     print "$khit => $vhit \n"; 
      } 

print Dumper(\%$hit); 

print "Hit Name \n"; 
print "$hit_name\n";

while ( (my $khit,my $vhit) = each %{$hsp}) {
      if ($khit eq "_evalue") {   
      print "$khit => $vhit \n";
      }  
      }

From torsten.seemann at infotech.monash.edu.au  Mon Apr 24 00:28:36 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 24 Apr 2006 14:28:36 +1000
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <000b01c6674d$0ac56850$0501a8c0@bert>
References: <000b01c6674d$0ac56850$0501a8c0@bert>
Message-ID: <1145852916.793.18.camel@chauvel.csse.monash.edu.au>

> Hi, I have a sequence and db I made myself. I have to run blast on
> subsequences of length 20 and identify the ones that are unique to my
> sequence. Any suggestion on how to go about doing this? 

So you want all length 20 subsequences (derived using a sliding window
from some set of sequences) which are do not appear in some other set of
sequences (virus-db) ? 

-- 
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From ste.ghi at libero.it  Mon Apr 24 09:48:24 2006
From: ste.ghi at libero.it (Stefano Ghignone)
Date: Mon, 24 Apr 2006 15:48:24 +0200
Subject: [Bioperl-l] invalid species name error handling
Message-ID: <IY8BOO$F505B1E101CBB2E94E3ABA0ACE38B082@libero.it>

Hi all.
I have a problem with a script that extracts the species name from GenPept flat files, querying the database with a list of acc.no. When it encounters an invalid species name (e.g. Cryptococcus neoformans var. neoformans JEC21), it exits definitely with an exception error. I don't know how to handle this error, and make the script pass to the next value. I suppose I have to use Bio::Root::Exception and Bio::Root::Root but I don't know how to start.
Who can help me with some hints?
stefano



From arareko at campus.iztacala.unam.mx  Mon Apr 24 10:17:51 2006
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Mon, 24 Apr 2006 09:17:51 -0500
Subject: [Bioperl-l] invalid species name error handling
In-Reply-To: <IY8BOO$F505B1E101CBB2E94E3ABA0ACE38B082@libero.it>
References: <IY8BOO$F505B1E101CBB2E94E3ABA0ACE38B082@libero.it>
Message-ID: <444CDE0F.5070309@campus.iztacala.unam.mx>

Maybe I can help you. Can you post your script?

Mauricio.

Stefano Ghignone wrote:
> Hi all.
> I have a problem with a script that extracts the species name from GenPept flat files, querying the database with a list of acc.no. When it encounters an invalid species name (e.g. Cryptococcus neoformans var. neoformans JEC21), it exits definitely with an exception error. I don't know how to handle this error, and make the script pass to the next value. I suppose I have to use Bio::Root::Exception and Bio::Root::Root but I don't know how to start.
> Who can help me with some hints?
> stefano
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From cjfields at uiuc.edu  Mon Apr 24 13:58:46 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Apr 2006 12:58:46 -0500
Subject: [Bioperl-l] RSS feed weirdness from the wiki
Message-ID: <005201c667c8$bb8a21f0$15327e82@pyrimidine>

Jason,

I'm getting this error when trying the rss feed from the "Recent Changes"
page on the wiki using Firefox 1.5.0.2.  It looks like FireFox doesn't like
the extra empty line before the xml declaration, which is a common problem
apparently from checking (Googled it).  I think this may be a Firefox issue
with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't tried with
Safari yet.

XML Parsing Error: xml declaration not at start of external entity
Location:
http://www.bioperl.org/w/index.php?title=Special:Recentchanges&feed=rss
Line Number 2, Column 1:

<?xml version="1.0" encoding="utf-8"?>
^

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 



From arareko at campus.iztacala.unam.mx  Mon Apr 24 14:21:43 2006
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Mon, 24 Apr 2006 13:21:43 -0500
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <005201c667c8$bb8a21f0$15327e82@pyrimidine>
References: <005201c667c8$bb8a21f0$15327e82@pyrimidine>
Message-ID: <444D1737.3030707@campus.iztacala.unam.mx>

Seems to me like the problem is the new line character at the start of 
the XML files. The <?xml ...> tag must be in the first line, not at the 
second. Are these files auto-generated from some template which may 
contain the error?

Mauricio.

Chris Fields wrote:
> Jason,
> 
> I'm getting this error when trying the rss feed from the "Recent Changes"
> page on the wiki using Firefox 1.5.0.2.  It looks like FireFox doesn't like
> the extra empty line before the xml declaration, which is a common problem
> apparently from checking (Googled it).  I think this may be a Firefox issue
> with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't tried with
> Safari yet.
> 
> XML Parsing Error: xml declaration not at start of external entity
> Location:
> http://www.bioperl.org/w/index.php?title=Special:Recentchanges&feed=rss
> Line Number 2, Column 1:
> 
> <?xml version="1.0" encoding="utf-8"?>
> ^
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From cjfields at uiuc.edu  Mon Apr 24 15:06:18 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Mon, 24 Apr 2006 14:06:18 -0500
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <444D1737.3030707@campus.iztacala.unam.mx>
Message-ID: <005601c667d2$2b3b56a0$15327e82@pyrimidine>

That's the problem.  When I removed the extra line from the saved XML and
threw it into my newsreader (Sage in Firefox) everything looks fine.  Trying
to access the feed directly in Sage gets the same XML error message as
before.  Directly accessing the RSS feed from Firefox (not using Sage) also
gives the same error.  The fact that it works in IE doesn't surprise me too
much; probably looser in how strict XML is validated.

When I Googled this before, it comes up as a common error associated with
WordPress and plugins.  

http://www.stepanoff.org/wordpress/2006/01/03/be-careful-with-new-plugins/

I'm guessing that some XML validators (including those with Firefox) are so
strict that docs containing extra empty space before the XML declaration are
declared invalid.  Maybe the plugin generating the output is to blame?

Chris

> -----Original Message-----
> From: Mauricio Herrera Cuadra [mailto:arareko at campus.iztacala.unam.mx]
> Sent: Monday, April 24, 2006 1:22 PM
> To: Chris Fields
> Cc: bioperl-l at lists.open-bio.org; 'Jason Stajich'
> Subject: Re: [Bioperl-l] RSS feed weirdness from the wiki
> 
> Seems to me like the problem is the new line character at the start of
> the XML files. The <?xml ...> tag must be in the first line, not at the
> second. Are these files auto-generated from some template which may
> contain the error?
> 
> Mauricio.
> 
> Chris Fields wrote:
> > Jason,
> >
> > I'm getting this error when trying the rss feed from the "Recent
> Changes"
> > page on the wiki using Firefox 1.5.0.2.  It looks like FireFox doesn't
> like
> > the extra empty line before the xml declaration, which is a common
> problem
> > apparently from checking (Googled it).  I think this may be a Firefox
> issue
> > with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't tried
> with
> > Safari yet.
> >
> > XML Parsing Error: xml declaration not at start of external entity
> > Location:
> > http://www.bioperl.org/w/index.php?title=Special:Recentchanges&feed=rss
> > Line Number 2, Column 1:
> >
> > <?xml version="1.0" encoding="utf-8"?>
> > ^
> >
> > Christopher Fields
> > Postdoctoral Researcher - Switzer Lab
> > Dept. of Biochemistry
> > University of Illinois Urbana-Champaign
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> --
> MAURICIO HERRERA CUADRA
> arareko at campus.iztacala.unam.mx
> Laboratorio de Gen?tica
> Unidad de Morfofisiolog?a y Funci?n
> Facultad de Estudios Superiores Iztacala, UNAM



From hwang at uga.edu  Mon Apr 24 15:02:02 2006
From: hwang at uga.edu (Haiming Wang)
Date: Mon, 24 Apr 2006 15:02:02 -0400
Subject: [Bioperl-l] How to merge mulitple genbank records into one record
Message-ID: <444D20AA.1050009@uga.edu>

Hi,

I am wondering if there is a script or tool can merge several genbank 
records into one record with all features' coordinates updated 
accordingly. For example, I have multiple Fugu scaffold_1 genbank files 
which are arbitrarily cut by 1000000 bps. I'd like to merge them into 
one big scaffold_1 genbank file.

Thanks in advance!

-Haiming

p.s. example data
genbank record 1:
LOCUS   scaffold_1 1000000 bp DNA HTG 8-FEB-2006
DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial sequence 
1..1000000  reannotated via EnsEMBL
ACCESSION   scaffold:FUGU4:scaffold_1:1:1000000:1
......
//

genbank record 2:
LOCUS  scaffold_1 1000000 bp DNA HTG 8-FEB-2006
DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial 
sequence1000001..2000000 reannotated via EnsEMBL
ACCESSION   scaffold:FUGU4:scaffold_1:1000001:2000000:1
......
//


From jason.stajich at duke.edu  Mon Apr 24 15:10:58 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Mon, 24 Apr 2006 15:10:58 -0400
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <005201c667c8$bb8a21f0$15327e82@pyrimidine>
References: <005201c667c8$bb8a21f0$15327e82@pyrimidine>
Message-ID: <F412EA2F-90F6-440D-A88D-F1DD520E3394@duke.edu>

hmm yes I see it too -- this seems to be a problem with the GeSHi  
syntax highlighting extension. Will let you know when I've got it  
fixed or will just disable syntax highlighting...

-j
On Apr 24, 2006, at 1:58 PM, Chris Fields wrote:

> Jason,
>
> I'm getting this error when trying the rss feed from the "Recent  
> Changes"
> page on the wiki using Firefox 1.5.0.2.  It looks like FireFox  
> doesn't like
> the extra empty line before the xml declaration, which is a common  
> problem
> apparently from checking (Googled it).  I think this may be a  
> Firefox issue
> with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't  
> tried with
> Safari yet.
>
> XML Parsing Error: xml declaration not at start of external entity
> Location:
> http://www.bioperl.org/w/index.php? 
> title=Special:Recentchanges&feed=rss
> Line Number 2, Column 1:
>
> <?xml version="1.0" encoding="utf-8"?>
> ^
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From heikki at sanbi.ac.za  Mon Apr 24 14:53:25 2006
From: heikki at sanbi.ac.za (Heikki Lehvaslaiho)
Date: Mon, 24 Apr 2006 20:53:25 +0200
Subject: [Bioperl-l] invalid species name error handling
In-Reply-To: <IY8BOO$F505B1E101CBB2E94E3ABA0ACE38B082@libero.it>
References: <IY8BOO$F505B1E101CBB2E94E3ABA0ACE38B082@libero.it>
Message-ID: <200604242053.25395.heikki@sanbi.ac.za>

Stefano,

If you want to ignore the error, you need to put the offending line(s) inside 
an eval block. 

The following example is from 'perldoc -f eval':

eval {
    $answer = $a / $b;
};
warn $@ if $@;


Note the ';' after the curly bracket closing teh eval block.


	-Heikki

On Monday 24 April 2006 15:48, Stefano Ghignone wrote:
> Hi all.
> I have a problem with a script that extracts the species name from GenPept
> flat files, querying the database with a list of acc.no. When it encounters
> an invalid species name (e.g. Cryptococcus neoformans var. neoformans
> JEC21), it exits definitely with an exception error. I don't know how to
> handle this error, and make the script pass to the next value. I suppose I
> have to use Bio::Root::Exception and Bio::Root::Root but I don't know how
> to start. Who can help me with some hints?
> stefano
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
______ _/      _/_____________________________________________________
      _/      _/
     _/  _/  _/  Heikki Lehvaslaiho    heikki at_sanbi _ac _za
    _/_/_/_/_/  Associate Professor    skype: heikki_lehvaslaiho
   _/  _/  _/  SANBI, South African National Bioinformatics Institute
  _/  _/  _/  University of Western Cape, South Africa
     _/      Phone: +27 21 959 2096   FAX: +27 21 959 2512
___ _/_/_/_/_/________________________________________________________

From osborne1 at optonline.net  Mon Apr 24 16:35:01 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Mon, 24 Apr 2006 16:35:01 -0400
Subject: [Bioperl-l] How to merge mulitple genbank records into one
	record
In-Reply-To: <444D20AA.1050009@uga.edu>
Message-ID: <C072AEB5.839B%osborne1@optonline.net>

Haiming,

Do the locations of the features refer to the individual 1000000 bp
sub-sequences or are they actually locations on the merged sequence, the
"chromosome"?

Brian O.


On 4/24/06 3:02 PM, "Haiming Wang" <hwang at uga.edu> wrote:

> Hi,
> 
> I am wondering if there is a script or tool can merge several genbank
> records into one record with all features' coordinates updated
> accordingly. For example, I have multiple Fugu scaffold_1 genbank files
> which are arbitrarily cut by 1000000 bps. I'd like to merge them into
> one big scaffold_1 genbank file.
> 
> Thanks in advance!
> 
> -Haiming
> 
> p.s. example data
> genbank record 1:
> LOCUS   scaffold_1 1000000 bp DNA HTG 8-FEB-2006
> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial sequence
> 1..1000000  reannotated via EnsEMBL
> ACCESSION   scaffold:FUGU4:scaffold_1:1:1000000:1
> ......
> //
> 
> genbank record 2:
> LOCUS  scaffold_1 1000000 bp DNA HTG 8-FEB-2006
> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial
> sequence1000001..2000000 reannotated via EnsEMBL
> ACCESSION   scaffold:FUGU4:scaffold_1:1000001:2000000:1
> ......
> //
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From hwang at uga.edu  Mon Apr 24 16:50:10 2006
From: hwang at uga.edu (Haiming Wang)
Date: Mon, 24 Apr 2006 16:50:10 -0400
Subject: [Bioperl-l] How to merge mulitple genbank records into one
	record
In-Reply-To: <C072AEB5.839B%osborne1@optonline.net>
References: <C072AEB5.839B%osborne1@optonline.net>
Message-ID: <444D3A02.4080003@uga.edu>

The locations of the features refer to the individual 1000000 bp 
sub-sequences. For example, in the second genbank record 
'scaffold:FUGU4:scaffold_1:1000001:2000000:1', the location of a gene is 
1760..4580. It is supposed to be 1001760..1004580 on the chromosome.

Thanks
-Haiming


Brian Osborne wrote:
> Haiming,
>
> Do the locations of the features refer to the individual 1000000 bp
> sub-sequences or are they actually locations on the merged sequence, the
> "chromosome"?
>
> Brian O.
>
>
> On 4/24/06 3:02 PM, "Haiming Wang" <hwang at uga.edu> wrote:
>
>   
>> Hi,
>>
>> I am wondering if there is a script or tool can merge several genbank
>> records into one record with all features' coordinates updated
>> accordingly. For example, I have multiple Fugu scaffold_1 genbank files
>> which are arbitrarily cut by 1000000 bps. I'd like to merge them into
>> one big scaffold_1 genbank file.
>>
>> Thanks in advance!
>>
>> -Haiming
>>
>> p.s. example data
>> genbank record 1:
>> LOCUS   scaffold_1 1000000 bp DNA HTG 8-FEB-2006
>> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial sequence
>> 1..1000000  reannotated via EnsEMBL
>> ACCESSION   scaffold:FUGU4:scaffold_1:1:1000000:1
>> ......
>> //
>>
>> genbank record 2:
>> LOCUS  scaffold_1 1000000 bp DNA HTG 8-FEB-2006
>> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial
>> sequence1000001..2000000 reannotated via EnsEMBL
>> ACCESSION   scaffold:FUGU4:scaffold_1:1000001:2000000:1
>> ......
>> //
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>     
>
>
>   


From hwang at uga.edu  Mon Apr 24 20:59:40 2006
From: hwang at uga.edu (Haiming Wang)
Date: Mon, 24 Apr 2006 20:59:40 -0400
Subject: [Bioperl-l] How to merge mulitple genbank records into one
	record
In-Reply-To: <444D53FB.4090909@colibase.bham.ac.uk>
References: <444D20AA.1050009@uga.edu> <444D53FB.4090909@colibase.bham.ac.uk>
Message-ID: <444D747C.1000905@uga.edu>

Hi Roy,

Thanks a lot for pointing it out. This is exactly what I need and it 
works fine for me. Again, your helps are highly appreciated!

-Haiming

Roy Chaudhuri wrote:
>> The locations of the features refer to the individual 1000000 bp 
>> sub-sequences. For example, in the second genbank record 
>> 'scaffold:FUGU4:scaffold_1:1000001:2000000:1', the location of a gene
>> is 1760..4580. It is supposed to be 1001760..1004580 on the
>> chromosome.
>>     
>
> Hi Haiming,
>
> a couple of months ago I wrote a cat function for Bio::Seq objects that
> should do what you want-
> http://bioperl.org/pipermail/bioperl-l/2006-January/020675.html
>
> I think Heikki commited it to the Bio::SeqUtils version in cvs. The
> function will automatically adjust the coordinates so should work for
> your situation. The syntax is:
> Bio::SeqUtils->cat($firstseq, @otherseqs)
>
> Hope this helps.
> Roy.
>
> --
> Dr. Roy Chaudhuri
> Bioinformatics Research Fellow
> Division of Immunity and Infection
> University of Birmingham, U.K.
>
> http://xbase.bham.ac.uk
>
>
>   


From hwang at uga.edu  Mon Apr 24 21:08:37 2006
From: hwang at uga.edu (Haiming Wang)
Date: Mon, 24 Apr 2006 21:08:37 -0400
Subject: [Bioperl-l] How to merge mulitple genbank records into
	one	record
In-Reply-To: <C072AEB5.839B%osborne1@optonline.net>
References: <C072AEB5.839B%osborne1@optonline.net>
Message-ID: <444D7695.5070700@uga.edu>

Hi Brian,

Thanks for the quick reply. Dr. Roy Chaudhuri has suggested to use the 
cat function in Bio::SeqUtils to do the concatenation. It works well for 
me. Appreciate your efforts in looking into the question.

Cheers,
Haiming

Brian Osborne wrote:
> Haiming,
>
> Do the locations of the features refer to the individual 1000000 bp
> sub-sequences or are they actually locations on the merged sequence, the
> "chromosome"?
>
> Brian O.
>
>
> On 4/24/06 3:02 PM, "Haiming Wang" <hwang at uga.edu> wrote:
>
>   
>> Hi,
>>
>> I am wondering if there is a script or tool can merge several genbank
>> records into one record with all features' coordinates updated
>> accordingly. For example, I have multiple Fugu scaffold_1 genbank files
>> which are arbitrarily cut by 1000000 bps. I'd like to merge them into
>> one big scaffold_1 genbank file.
>>
>> Thanks in advance!
>>
>> -Haiming
>>
>> p.s. example data
>> genbank record 1:
>> LOCUS   scaffold_1 1000000 bp DNA HTG 8-FEB-2006
>> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial sequence
>> 1..1000000  reannotated via EnsEMBL
>> ACCESSION   scaffold:FUGU4:scaffold_1:1:1000000:1
>> ......
>> //
>>
>> genbank record 2:
>> LOCUS  scaffold_1 1000000 bp DNA HTG 8-FEB-2006
>> DEFINITION  Fugu rubripes scaffold scaffold_1 FUGU4 partial
>> sequence1000001..2000000 reannotated via EnsEMBL
>> ACCESSION   scaffold:FUGU4:scaffold_1:1000001:2000000:1
>> ......
>> //
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>     
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   


From jason.stajich at duke.edu  Tue Apr 25 00:06:33 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Tue, 25 Apr 2006 00:06:33 -0400
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <F412EA2F-90F6-440D-A88D-F1DD520E3394@duke.edu>
References: <005201c667c8$bb8a21f0$15327e82@pyrimidine>
	<F412EA2F-90F6-440D-A88D-F1DD520E3394@duke.edu>
Message-ID: <DD989992-2666-4FF0-AD84-E203F9B124FE@duke.edu>

Should be fixed now, trailing newline in one of the php scripts was  
the culprit.

Thanks for pointing that out.

-jason
On Apr 24, 2006, at 3:10 PM, Jason Stajich wrote:

> hmm yes I see it too -- this seems to be a problem with the GeSHi
> syntax highlighting extension. Will let you know when I've got it
> fixed or will just disable syntax highlighting...
>
> -j
> On Apr 24, 2006, at 1:58 PM, Chris Fields wrote:
>
>> Jason,
>>
>> I'm getting this error when trying the rss feed from the "Recent
>> Changes"
>> page on the wiki using Firefox 1.5.0.2.  It looks like FireFox
>> doesn't like
>> the extra empty line before the xml declaration, which is a common
>> problem
>> apparently from checking (Googled it).  I think this may be a
>> Firefox issue
>> with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't
>> tried with
>> Safari yet.
>>
>> XML Parsing Error: xml declaration not at start of external entity
>> Location:
>> http://www.bioperl.org/w/index.php?
>> title=Special:Recentchanges&feed=rss
>> Line Number 2, Column 1:
>>
>> <?xml version="1.0" encoding="utf-8"?>
>> ^
>>
>> Christopher Fields
>> Postdoctoral Researcher - Switzer Lab
>> Dept. of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12



From torsten.seemann at infotech.monash.edu.au  Tue Apr 25 01:55:52 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Tue, 25 Apr 2006 15:55:52 +1000
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <BAY106-F124A189C38B133908A281FBDBE0@phx.gbl>
References: <BAY106-F124A189C38B133908A281FBDBE0@phx.gbl>
Message-ID: <444DB9E8.9080802@infotech.monash.edu.au>

Robert,

>> So you want all length 20 subsequences (derived using a sliding window
>> from some set of sequences) which are do not appear in some other set of
>> sequences (virus-db) ?

> Yes, that's basically it.  Find out which 20 unit long subsequences of 
> my sequence are not found in my database.

Well, using BLAST is probably not the most appropriate tool for this 
problem as it will find 'high scoring' matches, not exact matches.

Perhaps simply using Perl's "index()" function, which tests if one 
string is in another string, would be simpler?

You could even concatenate all your database sequences into one big 
sequence, inserting 20 "N" (if DNA) or "X" (if nucletotide) between each 
(or any other char you don't have in your sequences). Then you could 
simply loop through your 20-length subsequences using the sliding window 
as before, and do a "index()" for each against the one big database 
string. If index() returns a negative value, it wasn't found.

Hope this helps,

Torsten Seemann.

From robertemurphy at hotmail.com  Mon Apr 24 10:12:09 2006
From: robertemurphy at hotmail.com (Robert Murphy)
Date: Mon, 24 Apr 2006 14:12:09 +0000
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <1145852916.793.18.camel@chauvel.csse.monash.edu.au>
Message-ID: <BAY106-F124A189C38B133908A281FBDBE0@phx.gbl>

Yes, that's basically it.  Find out which 20 unit long subsequences of my 
sequence are not found in my database.

-Robert


So you want all length 20 subsequences (derived using a sliding window
from some set of sequences) which are do not appear in some other set of
sequences (virus-db) ?

--
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From arareko at campus.iztacala.unam.mx  Tue Apr 25 02:40:17 2006
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Tue, 25 Apr 2006 01:40:17 -0500
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <DD989992-2666-4FF0-AD84-E203F9B124FE@duke.edu>
References: <005201c667c8$bb8a21f0$15327e82@pyrimidine>	<F412EA2F-90F6-440D-A88D-F1DD520E3394@duke.edu>
	<DD989992-2666-4FF0-AD84-E203F9B124FE@duke.edu>
Message-ID: <444DC451.9010707@campus.iztacala.unam.mx>

Yes, the XML files are now properly generated. Did you also disabled the 
syntax highlighting plugin? (it doesn't work in the HOWTO:Trees examples).

Mauricio.

Jason Stajich wrote:
> Should be fixed now, trailing newline in one of the php scripts was  
> the culprit.
> 
> Thanks for pointing that out.
> 
> -jason
> On Apr 24, 2006, at 3:10 PM, Jason Stajich wrote:
> 
>> hmm yes I see it too -- this seems to be a problem with the GeSHi
>> syntax highlighting extension. Will let you know when I've got it
>> fixed or will just disable syntax highlighting...
>>
>> -j
>> On Apr 24, 2006, at 1:58 PM, Chris Fields wrote:
>>
>>> Jason,
>>>
>>> I'm getting this error when trying the rss feed from the "Recent
>>> Changes"
>>> page on the wiki using Firefox 1.5.0.2.  It looks like FireFox
>>> doesn't like
>>> the extra empty line before the xml declaration, which is a common
>>> problem
>>> apparently from checking (Googled it).  I think this may be a
>>> Firefox issue
>>> with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't
>>> tried with
>>> Safari yet.
>>>
>>> XML Parsing Error: xml declaration not at start of external entity
>>> Location:
>>> http://www.bioperl.org/w/index.php?
>>> title=Special:Recentchanges&feed=rss
>>> Line Number 2, Column 1:
>>>
>>> <?xml version="1.0" encoding="utf-8"?>
>>> ^
>>>
>>> Christopher Fields
>>> Postdoctoral Researcher - Switzer Lab
>>> Dept. of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>
>>>
>> --
>> Jason Stajich
>> Duke University
>> http://www.duke.edu/~jes12
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> --
> Jason Stajich
> Duke University
> http://www.duke.edu/~jes12
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From Marc.Logghe at DEVGEN.com  Tue Apr 25 02:58:56 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Tue, 25 Apr 2006 08:58:56 +0200
Subject: [Bioperl-l] BLAST and parsing question
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746D18@ANTARESIA.be.devgen.com>

Hi Robert,
It should be possible to do it with blast also by fiddling with the
blast options. You could set the word size to 20 as you are not
interested in smaller hits for instance. Also, the hits are ranked so
you easily can check the best hit (taking first line of tabular blast
output) and check whether the hit length is 20 as well. Enlarging the
word size and producing tabular output will definitely increase the
speed.
My $0.02
Regards,
Marc 


  

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org 
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
> Robert Murphy
> Sent: Monday, April 24, 2006 4:12 PM
> To: torsten.seemann at infotech.monash.edu.au
> Subject: Re: [Bioperl-l] BLAST and parsing question
> 
> Yes, that's basically it.  Find out which 20 unit long 
> subsequences of my sequence are not found in my database.
> 
> -Robert
> 
> 
> So you want all length 20 subsequences (derived using a 
> sliding window from some set of sequences) which are do not 
> appear in some other set of sequences (virus-db) ?
> 
> --
> Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
> Victorian Bioinformatics Consortium
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From reenayadav at gmail.com  Tue Apr 25 04:48:45 2006
From: reenayadav at gmail.com (Reena Yadav)
Date: Tue, 25 Apr 2006 14:18:45 +0530
Subject: [Bioperl-l] Installation problem
Message-ID: <76f897dd0604250148v59357b9apeed2e2352e480c8c@mail.gmail.com>

Linux: Bioperl was installed using root privileges.
Tried using the first script, from:
http://bioperl.org/Core/Latest/bptutorial.html#i_2_quick_getting_started_scripts
Internet is connected and is accessible.
 I got the following reply.

------------- EXCEPTION  -------------
MSG: WebDBSeqI Request Error:
501 Protocol scheme 'webproxyap1.inbg.astrazeneca.net' is not supported
Content-Type: text/plain
Client-Date: Tue, 25 Apr 2006 08:24:19 GMT
Client-Warning: Internal response

501 Protocol scheme 'webproxyap1.inbg.astrazeneca.net' is not supported

STACK Bio::DB::WebDBSeqI::_stream_request
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/WebDBSeqI.pm:728
STACK Bio::DB::WebDBSeqI::get_seq_stream
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/WebDBSeqI.pm:460
STACK Bio::DB::WebDBSeqI::get_Stream_by_id
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/WebDBSeqI.pm:287
STACK Bio::DB::WebDBSeqI::get_Seq_by_id
/usr/lib/perl5/site_perl/5.8.5/Bio/DB/WebDBSeqI.pm:153
STACK Bio::Perl::get_sequence /usr/lib/perl5/site_perl/5.8.5/Bio/Perl.pm:511
STACK toplevel bp.pl:7

--------------------------------------

-------------------- WARNING ---------------------
MSG: id (ROA1_HUMAN) does not exist
---------------------------------------------------
You have a non object [] passed to write_sequence. It maybe that you want to
use new_sequence to make this string into a sequence object? at
/usr/lib/perl5/site_perl/5.8.5/Bio/Perl.pm line 283
        Bio::Perl::write_sequence('>roa1.fasta', 'fasta', 'undef') called at
bp.pl line 9

Win:    activestate of perl was downloaded and installed.
then in ppm..

ppm> rep add Bioperl http://bioperl.org/DIST

ppm> rep add Kobes http://theoryx5.uwinnipeg.ca/ppms

ppm> rep add Bribes http://www.Bribes.org/perl/ppm

ppm> search Bioperl
searching in active Repositories.
no matches for 'Bioperl' ; see 'help search'

Where am not going wrong..please point out the experiences.
Reena Yadav.


From jason.stajich at duke.edu  Tue Apr 25 08:17:02 2006
From: jason.stajich at duke.edu (Jason Stajich)
Date: Tue, 25 Apr 2006 08:17:02 -0400
Subject: [Bioperl-l] RSS feed weirdness from the wiki
In-Reply-To: <444DC451.9010707@campus.iztacala.unam.mx>
References: <005201c667c8$bb8a21f0$15327e82@pyrimidine>	<F412EA2F-90F6-440D-A88D-F1DD520E3394@duke.edu>
	<DD989992-2666-4FF0-AD84-E203F9B124FE@duke.edu>
	<444DC451.9010707@campus.iztacala.unam.mx>
Message-ID: <DC1B8187-CCD1-4588-B360-3E662D2A712B@duke.edu>

Apparently I had not quite tweaked the highlight script correctly -  
everything should be copacetic now.

-j

On Apr 25, 2006, at 2:40 AM, Mauricio Herrera Cuadra wrote:

> Yes, the XML files are now properly generated. Did you also  
> disabled the syntax highlighting plugin? (it doesn't work in the  
> HOWTO:Trees examples).
>
> Mauricio.
>
> Jason Stajich wrote:
>> Should be fixed now, trailing newline in one of the php scripts  
>> was  the culprit.
>> Thanks for pointing that out.
>> -jason
>> On Apr 24, 2006, at 3:10 PM, Jason Stajich wrote:
>>> hmm yes I see it too -- this seems to be a problem with the GeSHi
>>> syntax highlighting extension. Will let you know when I've got it
>>> fixed or will just disable syntax highlighting...
>>>
>>> -j
>>> On Apr 24, 2006, at 1:58 PM, Chris Fields wrote:
>>>
>>>> Jason,
>>>>
>>>> I'm getting this error when trying the rss feed from the "Recent
>>>> Changes"
>>>> page on the wiki using Firefox 1.5.0.2.  It looks like FireFox
>>>> doesn't like
>>>> the extra empty line before the xml declaration, which is a common
>>>> problem
>>>> apparently from checking (Googled it).  I think this may be a
>>>> Firefox issue
>>>> with RSS feeds as I don't see it on (ick) IE on Windows.  Haven't
>>>> tried with
>>>> Safari yet.
>>>>
>>>> XML Parsing Error: xml declaration not at start of external entity
>>>> Location:
>>>> http://www.bioperl.org/w/index.php?
>>>> title=Special:Recentchanges&feed=rss
>>>> Line Number 2, Column 1:
>>>>
>>>> <?xml version="1.0" encoding="utf-8"?>
>>>> ^
>>>>
>>>> Christopher Fields
>>>> Postdoctoral Researcher - Switzer Lab
>>>> Dept. of Biochemistry
>>>> University of Illinois Urbana-Champaign
>>>>
>>>>
>>> --
>>> Jason Stajich
>>> Duke University
>>> http://www.duke.edu/~jes12
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> --
>> Jason Stajich
>> Duke University
>> http://www.duke.edu/~jes12
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> -- 
> MAURICIO HERRERA CUADRA
> arareko at campus.iztacala.unam.mx
> Laboratorio de Gen?tica
> Unidad de Morfofisiolog?a y Funci?n
> Facultad de Estudios Superiores Iztacala, UNAM
>

--
Jason Stajich
Duke University
http://www.duke.edu/~jes12




From cjfields at uiuc.edu  Tue Apr 25 11:47:29 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Apr 2006 10:47:29 -0500
Subject: [Bioperl-l] ListSummaries for April 12-25
Message-ID: <006f01c6687f$8f41fe80$15327e82@pyrimidine>

The newest summary of the BioPerl mailing lists has been posted to the wiki:

http://www.bioperl.org/wiki/ListSummary:April_12-25%2C2006

Post gripes, harrassments, and faint praises here.

Christopher Fields
Postdoctoral Researcher - Switzer Lab
Dept. of Biochemistry
University of Illinois Urbana-Champaign 




From iamvela at yahoo.com  Tue Apr 25 12:07:36 2006
From: iamvela at yahoo.com (Raghunath Verabelli)
Date: Tue, 25 Apr 2006 09:07:36 -0700 (PDT)
Subject: [Bioperl-l] blast program to run locally on windows
In-Reply-To: <000501c638a7$c2802630$15327e82@pyrimidine>
Message-ID: <20060425160736.48121.qmail@web36612.mail.mud.yahoo.com>

Hi All,

I am looking for a blast program ('blastp') that I can
run locally on windows platform instead of using
NCBI's blast over web.

Do you know any such programs?

I checked Washington University's blast program, but
looks like they do not support it on windows platform:
http://blast.wustl.edu/blast/README.html#platforms


Any other alternatives?

Please let me know if you are aware of any 'blastp'
program equivalent to WU blast for Windows.

Thanks in advance,
Raghu



__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 

From arareko at campus.iztacala.unam.mx  Tue Apr 25 12:14:28 2006
From: arareko at campus.iztacala.unam.mx (Mauricio Herrera Cuadra)
Date: Tue, 25 Apr 2006 11:14:28 -0500
Subject: [Bioperl-l] ListSummaries for April 12-25
In-Reply-To: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
References: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
Message-ID: <444E4AE4.1000004@campus.iztacala.unam.mx>

Nice job Chris! :)

Chris Fields wrote:
> The newest summary of the BioPerl mailing lists has been posted to the wiki:
> 
> http://www.bioperl.org/wiki/ListSummary:April_12-25%2C2006
> 
> Post gripes, harrassments, and faint praises here.
> 
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
MAURICIO HERRERA CUADRA
arareko at campus.iztacala.unam.mx
Laboratorio de Gen?tica
Unidad de Morfofisiolog?a y Funci?n
Facultad de Estudios Superiores Iztacala, UNAM


From cjfields at uiuc.edu  Tue Apr 25 12:14:46 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Tue, 25 Apr 2006 11:14:46 -0500
Subject: [Bioperl-l] blast program to run locally on windows
In-Reply-To: <20060425160736.48121.qmail@web36612.mail.mud.yahoo.com>
Message-ID: <007c01c66883$61f29490$15327e82@pyrimidine>

Use the NCBI win32 binaries and either download your database from NCBI or
build your own custom databases using formatdb:

http://www.ncbi.nih.gov/BLAST/download.shtml

More up-to-date help is available here:

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/pc_setup.html

Instructions on how to format your own databases is here:

http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/formatdb_fastacmd.html

Chris

> -----Original Message-----
> From: Raghunath Verabelli [mailto:iamvela at yahoo.com]
> Sent: Tuesday, April 25, 2006 11:08 AM
> To: Chris Fields; 'Jason Stajich'
> Cc: bioperl-l at lists.open-bio.org
> Subject: blast program to run locally on windows
> 
> Hi All,
> 
> I am looking for a blast program ('blastp') that I can
> run locally on windows platform instead of using
> NCBI's blast over web.
> 
> Do you know any such programs?
> 
> I checked Washington University's blast program, but
> looks like they do not support it on windows platform:
> http://blast.wustl.edu/blast/README.html#platforms
> 
> 
> Any other alternatives?
> 
> Please let me know if you are aware of any 'blastp'
> program equivalent to WU blast for Windows.
> 
> Thanks in advance,
> Raghu
> 
> 
> 
> __________________________________________________
> Do You Yahoo!?
> Tired of spam?  Yahoo! Mail has the best spam protection around
> http://mail.yahoo.com


From hlapp at gmx.net  Tue Apr 25 13:14:52 2006
From: hlapp at gmx.net (Hilmar Lapp)
Date: Tue, 25 Apr 2006 10:14:52 -0700
Subject: [Bioperl-l] ListSummaries for April 12-25
In-Reply-To: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
References: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
Message-ID: <60D44839-E52A-420C-95CE-EA4B9DB674BE@gmx.net>

BTW the OBO parser mentioned as me having committed is work by Sohel  
Merchant and I haven't announced it yet b/c Sohel is going to do some  
more reshuffling of code when he gets his CVS account, so I don't  
really want anyone using it quite yet just in case one of these  
impending changes causes an API change.

	-hilmar

On Apr 25, 2006, at 8:47 AM, Chris Fields wrote:

> The newest summary of the BioPerl mailing lists has been posted to  
> the wiki:
>
> http://www.bioperl.org/wiki/ListSummary:April_12-25%2C2006
>
> Post gripes, harrassments, and faint praises here.
>
> Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

-- 
----------------------------------------------------------
: Hilmar Lapp -:- San Diego, CA -:- hlapp at gmx dot net :
----------------------------------------------------------




From roy at colibase.bham.ac.uk  Tue Apr 25 12:45:31 2006
From: roy at colibase.bham.ac.uk (Roy Chaudhuri)
Date: Tue, 25 Apr 2006 17:45:31 +0100
Subject: [Bioperl-l] ListSummaries for April 12-25
In-Reply-To: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
References: <006f01c6687f$8f41fe80$15327e82@pyrimidine>
Message-ID: <444E522B.3030103@colibase.bham.ac.uk>

> Post gripes, harrassments, and faint praises here.

Slight gripe- I replied to Haiming Wang by pressing the reply all 
button, like a good little mailing-lister, so a copy should have gone to 
the list. I was sending from my home ISP, though, so I'm guessing the 
message is suffering from the greylisting problem that Jason mentioned.

Still, plenty of non-faint praise, excellent job with the summary.

Roy.
--
Dr. Roy Chaudhuri
Bioinformatics Research Fellow
Division of Immunity and Infection
University of Birmingham, U.K.

http://xbase.bham.ac.uk

From robertemurphy at hotmail.com  Tue Apr 25 13:14:37 2006
From: robertemurphy at hotmail.com (Robert Murphy)
Date: Tue, 25 Apr 2006 17:14:37 +0000
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746D18@ANTARESIA.be.devgen.com>
Message-ID: <BAY106-F16566D37154723FDF80318BDBF0@phx.gbl>

Question, is there a program that will search all my out files for just ones 
that have exact matches?  That might just slove my problem.

Thanks!



From iamvela at yahoo.com  Tue Apr 25 17:54:33 2006
From: iamvela at yahoo.com (Raghunath Verabelli)
Date: Tue, 25 Apr 2006 14:54:33 -0700 (PDT)
Subject: [Bioperl-l] blast program to run locally on windows
In-Reply-To: <007c01c66883$61f29490$15327e82@pyrimidine>
Message-ID: <20060425215433.35436.qmail@web36613.mail.mud.yahoo.com>

Thanks Chris.

I have installed everything, but unable to get the
blast hits from the database file. I get this message:

BLASTP 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden,
Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of
protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= target48
         (115 letters)

Database: temp 
           2,093,771 sequences; 757,160,754 total
letters



 ***** No hits found ******

  Database: temp
    Posted date:  Nov 11, 2005  3:50 PM
  Number of letters in database: 757,160,754
  Number of sequences in database:  2,093,771




I also see following error messages:

[NULL_Caption] WARNING:  [000.000]  target48: Unable
to open BLOSUM62
[NULL_Caption] WARNING:  [000.000]  target48:
BlastScoreBlkMatFill returned non-zero status
[NULL_Caption] WARNING:  [000.000]  target48:
SetUpBlastSearch failed.


Any ideas how to resolve this issue?

thanks,
Raghu


--- Chris Fields <cjfields at uiuc.edu> wrote:

> Use the NCBI win32 binaries and either download your
> database from NCBI or
> build your own custom databases using formatdb:
> 
> http://www.ncbi.nih.gov/BLAST/download.shtml
> 
> More up-to-date help is available here:
> 
> http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/
> 
>
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/pc_setup.html
> 
> Instructions on how to format your own databases is
> here:
> 
>
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/formatdb_fastacmd.html
> 
> Chris
> 
> > -----Original Message-----
> > From: Raghunath Verabelli
> [mailto:iamvela at yahoo.com]
> > Sent: Tuesday, April 25, 2006 11:08 AM
> > To: Chris Fields; 'Jason Stajich'
> > Cc: bioperl-l at lists.open-bio.org
> > Subject: blast program to run locally on windows
> > 
> > Hi All,
> > 
> > I am looking for a blast program ('blastp') that I
> can
> > run locally on windows platform instead of using
> > NCBI's blast over web.
> > 
> > Do you know any such programs?
> > 
> > I checked Washington University's blast program,
> but
> > looks like they do not support it on windows
> platform:
> > http://blast.wustl.edu/blast/README.html#platforms
> > 
> > 
> > Any other alternatives?
> > 
> > Please let me know if you are aware of any
> 'blastp'
> > program equivalent to WU blast for Windows.
> > 
> > Thanks in advance,
> > Raghu
> > 
> > 
> > 
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around
> > http://mail.yahoo.com
> 
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com 

From torsten.seemann at infotech.monash.edu.au  Tue Apr 25 19:55:30 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed, 26 Apr 2006 09:55:30 +1000
Subject: [Bioperl-l] Installation problem
In-Reply-To: <76f897dd0604250148v59357b9apeed2e2352e480c8c@mail.gmail.com>
References: <76f897dd0604250148v59357b9apeed2e2352e480c8c@mail.gmail.com>
Message-ID: <1146009330.6028.1.camel@chauvel.csse.monash.edu.au>

> http://bioperl.org/Core/Latest/bptutorial.html#i_2_quick_getting_started_scripts
> Internet is connected and is accessible.
>  I got the following reply.
> ------------- EXCEPTION  -------------
> MSG: WebDBSeqI Request Error:
> 501 Protocol scheme 'webproxyap1.inbg.astrazeneca.net' is not supported

Are you using a web proxy?
If so, what is your $http_proxy environmental variable set to?

-- 
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From torsten.seemann at infotech.monash.edu.au  Tue Apr 25 19:57:18 2006
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Wed, 26 Apr 2006 09:57:18 +1000
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <BAY106-F16566D37154723FDF80318BDBF0@phx.gbl>
References: <BAY106-F16566D37154723FDF80318BDBF0@phx.gbl>
Message-ID: <1146009438.6028.2.camel@chauvel.csse.monash.edu.au>

On Tue, 2006-04-25 at 17:14 +0000, Robert Murphy wrote:
> Question, is there a program that will search all my out files for just ones 
> that have exact matches?  That might just slove my problem.

The EMBOSS set of tools comes with a few options, perhaps 'wordmatch' ?
http://bioweb.pasteur.fr/docs/EMBOSS/wordmatch.html

-- 
Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Victorian Bioinformatics Consortium


From Marc.Logghe at DEVGEN.com  Wed Apr 26 03:07:34 2006
From: Marc.Logghe at DEVGEN.com (Marc Logghe)
Date: Wed, 26 Apr 2006 09:07:34 +0200
Subject: [Bioperl-l] BLAST and parsing question
Message-ID: <0C528E3670D8CE4B8E013F6749231AA6746D1E@ANTARESIA.be.devgen.com>

Have you already looked into MUMmer ? I believe you even don't need a
sliding window approach. Given the complete query sequence, the
application will just show the stretches of exact matches.
It is based on suffix trees. Disadvantage however, is that currently
there is no possibility to store the indexes to the suffix trees, e.g.
you can not 'formatdb' your sequences into a 'MUMmer database'. The
suffix tree datastructures for the 'database' are generated in every run
and stored into memory.
Check it out at http://mummer.sourceforge.net/.
Cheers,
Marc


Marc Logghe, PhD
Expert Scientist Bioinformatics
deVGen NV
Technologiepark 30
B - 9052 Ghent-Zwijnaarde
Tel. +32 9 324 24 83 
Fax. +32 9 324 24 25 
Web: www.devgen.com

 --- Disclaimer start ---
This e-mail and any attachments thereto may contain information which is
confidential and/or which is proprietary to the sender. Accordingly,
this e-mail and any attachments thereto, as well as any and all
information contained therein, are intended for the sole use of the
recipient or recipients designated above. Any use of this e-mail, of any
attachments thereto, of any and all information contained therein,
and/or of any part(s) thereof (including, without limitation, total or
partial reproduction, communication and/or distribution in any form) by
persons other than the designated recipient(s) is prohibited. If you
have received this e-mail in error, please notify the sender either by
telephone or by e-mail and delete the material from any computer. 
Thank you for your cooperation.
--- Disclaimer end ---
  

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org 
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
> Torsten Seemann
> Sent: Wednesday, April 26, 2006 1:57 AM
> To: Robert Murphy
> Cc: bioperl-l at lists.open-bio.org
> Subject: Re: [Bioperl-l] BLAST and parsing question
> 
> On Tue, 2006-04-25 at 17:14 +0000, Robert Murphy wrote:
> > Question, is there a program that will search all my out files for 
> > just ones that have exact matches?  That might just slove 
> my problem.
> 
> The EMBOSS set of tools comes with a few options, perhaps 
> 'wordmatch' ?
> http://bioweb.pasteur.fr/docs/EMBOSS/wordmatch.html
> 
> --
> Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
> Victorian Bioinformatics Consortium
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From robertemurphy at hotmail.com  Wed Apr 26 11:33:53 2006
From: robertemurphy at hotmail.com (Robert Murphy)
Date: Wed, 26 Apr 2006 10:33:53 -0500
Subject: [Bioperl-l] BLAST and parsing question
In-Reply-To: <0C528E3670D8CE4B8E013F6749231AA6746D1E@ANTARESIA.be.devgen.com>
Message-ID: <BAY106-DAV13C0E12FC8D41C69A74ECCBDBC0@phx.gbl>

Thanks for all the great ideas.  Now I just need to try them out!

-Rob


From mark_gosink at yahoo.com  Wed Apr 26 20:15:29 2006
From: mark_gosink at yahoo.com (Mark Gosink)
Date: Wed, 26 Apr 2006 20:15:29 -0400
Subject: [Bioperl-l] Using bioperl to convert gene predictions to gff
Message-ID: <000301c6698f$b17a4d20$0202a8c0@GosinkFranklin>

I'd like to reformat gene predictions from several different programs
(genscan, glimmerhmm, fgenesh) to gff format. I know bioperl can parse the
output from these and other predictors and that it can export into GFF. But
I'm not clear on how to string the two together.

 

Can anyone point me at any example code?

 

Thanks,

Mark

 

Mark Gosink

Scripps Florida


From richmond.todd at gmail.com  Wed Apr 26 21:47:52 2006
From: richmond.todd at gmail.com (Todd Richmond)
Date: Wed, 26 Apr 2006 20:47:52 -0500
Subject: [Bioperl-l] GI identifier missing when using Bio::Index::GenBank?
Message-ID: <8f47ebe60604261847n340402e3h57e72bcf2dcc53a5@mail.gmail.com>

I've got an application where I grab the daily updates from NCBI, pull
out just the plant sequences and store them in a separate flat file.
Then I use Bio::Index::GenBank to index the plant flat file so I can
pull out my sequences of interest. I'm in the midst of converting my
scripts to using bioperl-db/biosql so I can push those sequences into
the database. The problem is that the NCBI GI identifier isn't
returned when using the index file.

When I run the following test script:
***
use Bio::Index::GenBank;
use Bio::SeqIO;
use strict;
my $Index_File_Name = 'nc0425.idx';
my $inx = Bio::Index::GenBank->new('-filename' => $Index_File_Name);

my $seqio = new Bio::SeqIO( '-format' => 'genbank' );
my $seq = $inx->get_Seq_by_acc('CJ521890');
$seqio->write_seq($seq);
***

Diffing to the original GenBank record, the only difference is the GI
identifier:

diff CJ521890_orig.out CJ521890_seqio.out
5c5
< VERSION     CJ521890.1  GI:93266243
---
> VERSION     CJ521890.1

Is this expected behaviour? If so, is there a workaround that will
allow me to retrieve the GI from the index file so I can store it in
the bioentry table?

Thanks, Todd


--
Todd Richmond
richmond.todd at gmail.com


From osborne1 at optonline.net  Thu Apr 27 12:29:43 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Thu, 27 Apr 2006 12:29:43 -0400
Subject: [Bioperl-l] GI identifier missing when using
	Bio::Index::GenBank?
In-Reply-To: <8f47ebe60604261847n340402e3h57e72bcf2dcc53a5@mail.gmail.com>
Message-ID: <C07669B7.841E%osborne1@optonline.net>

Todd,

Can't you go directly from the daily update to the database?

Brian O.


On 4/26/06 9:47 PM, "Todd Richmond" <richmond.todd at gmail.com> wrote:

> I've got an application where I grab the daily updates from NCBI, pull
> out just the plant sequences and store them in a separate flat file.
> Then I use Bio::Index::GenBank to index the plant flat file so I can
> pull out my sequences of interest. I'm in the midst of converting my
> scripts to using bioperl-db/biosql so I can push those sequences into
> the database. The problem is that the NCBI GI identifier isn't
> returned when using the index file.
> 
> When I run the following test script:
> ***
> use Bio::Index::GenBank;
> use Bio::SeqIO;
> use strict;
> my $Index_File_Name = 'nc0425.idx';
> my $inx = Bio::Index::GenBank->new('-filename' => $Index_File_Name);
> 
> my $seqio = new Bio::SeqIO( '-format' => 'genbank' );
> my $seq = $inx->get_Seq_by_acc('CJ521890');
> $seqio->write_seq($seq);
> ***
> 
> Diffing to the original GenBank record, the only difference is the GI
> identifier:
> 
> diff CJ521890_orig.out CJ521890_seqio.out
> 5c5
> < VERSION     CJ521890.1  GI:93266243
> ---
>> VERSION     CJ521890.1
> 
> Is this expected behaviour? If so, is there a workaround that will
> allow me to retrieve the GI from the index file so I can store it in
> the bioentry table?
> 
> Thanks, Todd
> 
> 
> --
> Todd Richmond
> richmond.todd at gmail.com
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From osborne1 at optonline.net  Thu Apr 27 14:04:18 2006
From: osborne1 at optonline.net (Brian Osborne)
Date: Thu, 27 Apr 2006 14:04:18 -0400
Subject: [Bioperl-l] GI identifier missing when using
	Bio::Index::GenBank?
In-Reply-To: <8f47ebe60604271056v7074c52atb1a86b2debb78280@mail.gmail.com>
Message-ID: <C0767FE2.8424%osborne1@optonline.net>

Todd,

No, I don't think so, I think this is a bug. Can you put this into Bugzilla
along with that Genbank file, CJ521890, that shows it? Then I'll take a
closer look...

Brian O.


On 4/27/06 1:56 PM, "Todd Richmond" <richmond.todd at gmail.com> wrote:

> I could, but I don't want to store all that information. For instance,
> in the past two weeks, 387000 plant sequences have been added to
> GenBank. I'm interested in storing complete information for the ~600
> sequences from that set that are related to the gene families I'm
> interested in.
> 
> I can certainly come up with a workaround myself by implementing a
> hash of accession/gi numbers or modifiying the load script supplied by
> bioperl to accept a list of accession numbers as a filter. I was just
> wondering if I'm missing something obvious...
> 
> Todd
> 
> 
> On 4/27/06, Brian Osborne <osborne1 at optonline.net> wrote:
>> Todd,
>> 
>> Can't you go directly from the daily update to the database?
>> 
>> Brian O.
>> 
>> 
>> On 4/26/06 9:47 PM, "Todd Richmond" <richmond.todd at gmail.com> wrote:
>> 
>>> I've got an application where I grab the daily updates from NCBI, pull
>>> out just the plant sequences and store them in a separate flat file.
>>> Then I use Bio::Index::GenBank to index the plant flat file so I can
>>> pull out my sequences of interest. I'm in the midst of converting my
>>> scripts to using bioperl-db/biosql so I can push those sequences into
>>> the database. The problem is that the NCBI GI identifier isn't
>>> returned when using the index file.
>>> 
>>> When I run the following test script:
>>> ***
>>> use Bio::Index::GenBank;
>>> use Bio::SeqIO;
>>> use strict;
>>> my $Index_File_Name = 'nc0425.idx';
>>> my $inx = Bio::Index::GenBank->new('-filename' => $Index_File_Name);
>>> 
>>> my $seqio = new Bio::SeqIO( '-format' => 'genbank' );
>>> my $seq = $inx->get_Seq_by_acc('CJ521890');
>>> $seqio->write_seq($seq);
>>> ***
>>> 
>>> Diffing to the original GenBank record, the only difference is the GI
>>> identifier:
>>> 
>>> diff CJ521890_orig.out CJ521890_seqio.out
>>> 5c5
>>> < VERSION     CJ521890.1  GI:93266243
>>> ---
>>>> VERSION     CJ521890.1
>>> 
>>> Is this expected behaviour? If so, is there a workaround that will
>>> allow me to retrieve the GI from the index file so I can store it in
>>> the bioentry table?
>>> 
>>> Thanks, Todd
>>> 
>>> 
>>> --
>>> Todd Richmond
>>> richmond.todd at gmail.com
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> 
> 
> 
> --
> Todd Richmond
> richmond.todd at gmail.com



From richmond.todd at gmail.com  Thu Apr 27 13:56:31 2006
From: richmond.todd at gmail.com (Todd Richmond)
Date: Thu, 27 Apr 2006 12:56:31 -0500
Subject: [Bioperl-l] GI identifier missing when using
	Bio::Index::GenBank?
In-Reply-To: <C07669B7.841E%osborne1@optonline.net>
References: <8f47ebe60604261847n340402e3h57e72bcf2dcc53a5@mail.gmail.com>
	<C07669B7.841E%osborne1@optonline.net>
Message-ID: <8f47ebe60604271056v7074c52atb1a86b2debb78280@mail.gmail.com>

I could, but I don't want to store all that information. For instance,
in the past two weeks, 387000 plant sequences have been added to
GenBank. I'm interested in storing complete information for the ~600
sequences from that set that are related to the gene families I'm
interested in.

I can certainly come up with a workaround myself by implementing a
hash of accession/gi numbers or modifiying the load script supplied by
bioperl to accept a list of accession numbers as a filter. I was just
wondering if I'm missing something obvious...

Todd


On 4/27/06, Brian Osborne <osborne1 at optonline.net> wrote:
> Todd,
>
> Can't you go directly from the daily update to the database?
>
> Brian O.
>
>
> On 4/26/06 9:47 PM, "Todd Richmond" <richmond.todd at gmail.com> wrote:
>
> > I've got an application where I grab the daily updates from NCBI, pull
> > out just the plant sequences and store them in a separate flat file.
> > Then I use Bio::Index::GenBank to index the plant flat file so I can
> > pull out my sequences of interest. I'm in the midst of converting my
> > scripts to using bioperl-db/biosql so I can push those sequences into
> > the database. The problem is that the NCBI GI identifier isn't
> > returned when using the index file.
> >
> > When I run the following test script:
> > ***
> > use Bio::Index::GenBank;
> > use Bio::SeqIO;
> > use strict;
> > my $Index_File_Name = 'nc0425.idx';
> > my $inx = Bio::Index::GenBank->new('-filename' => $Index_File_Name);
> >
> > my $seqio = new Bio::SeqIO( '-format' => 'genbank' );
> > my $seq = $inx->get_Seq_by_acc('CJ521890');
> > $seqio->write_seq($seq);
> > ***
> >
> > Diffing to the original GenBank record, the only difference is the GI
> > identifier:
> >
> > diff CJ521890_orig.out CJ521890_seqio.out
> > 5c5
> > < VERSION     CJ521890.1  GI:93266243
> > ---
> >> VERSION     CJ521890.1
> >
> > Is this expected behaviour? If so, is there a workaround that will
> > allow me to retrieve the GI from the index file so I can store it in
> > the bioentry table?
> >
> > Thanks, Todd
> >
> >
> > --
> > Todd Richmond
> > richmond.todd at gmail.com
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>


--
Todd Richmond
richmond.todd at gmail.com


From pjm at sanger.ac.uk  Fri Apr 28 06:41:03 2006
From: pjm at sanger.ac.uk (Paul Mooney)
Date: Fri, 28 Apr 2006 11:41:03 +0100
Subject: [Bioperl-l] Bio::Tools::GFF
Message-ID: <1ae5268519a170870d2de3daa52ed163@sanger.ac.uk>

Hi,

I've modified one line in my local copy of Bio::Tools::GFF so it takes  
into account *all* of the special tags defined here;
http://song.sourceforge.net/gff3.shtml

Current CVS version;
$tag= lcfirst($tag) unless ($tag =~/^ID|Name|Alias|Parent|Gap|Target$/);

My version;
$tag= lcfirst($tag) unless ($tag  
=~/ 
^ID|Name|Alias|Parent|Gap|Target|Derives_from|Note|Dbxref|Ontology_term$ 
/);

Could someone update cvs please?
Paul.


From cjfields at uiuc.edu  Fri Apr 28 09:03:36 2006
From: cjfields at uiuc.edu (Chris Fields)
Date: Fri, 28 Apr 2006 08:03:36 -0500
Subject: [Bioperl-l] Bio::Tools::GFF
In-Reply-To: <1ae5268519a170870d2de3daa52ed163@sanger.ac.uk>
References: <1ae5268519a170870d2de3daa52ed163@sanger.ac.uk>
Message-ID: <70C6614D-27AF-4B5D-A4FB-19981F97F05B@uiuc.edu>

Lincoln's working on GFF3 integration into BioPerl at the moment  
which will not use Bio::DB::GFF, so there's a bit of reluctance at  
the moment to commit this unless Lincoln signals that it's fine.

http://article.gmane.org/gmane.comp.lang.perl.bio.general/10691/match=

http://www.bioperl.org/wiki/ListSummary:April_12-25%2C2006#Bioperl- 
guts_.28for_the_die-hards.29

If you look in CVS in Bio::DB, several new modules have been added  
(also in the ListSummary above).  You could try those out but I have  
no idea what kind of working condition they are in and how stable the  
API is at the moment.

You could email the GMOD lists as well (I get the GBrowse, which  
Scott Cain and Lincoln regularly post to).  Info here:

https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

Chris

On Apr 28, 2006, at 5:41 AM, Paul Mooney wrote:

> Hi,
>
> I've modified one line in my local copy of Bio::Tools::GFF so it takes
> into account *all* of the special tags defined here;
> http://song.sourceforge.net/gff3.shtml
>
> Current CVS version;
> $tag= lcfirst($tag) unless ($tag =~/^ID|Name|Alias|Parent|Gap|Target 
> $/);
>
> My version;
> $tag= lcfirst($tag) unless ($tag
> =~/
> ^ID|Name|Alias|Parent|Gap|Target|Derives_from|Note|Dbxref| 
> Ontology_term$
> /);
>
> Could someone update cvs please?
> Paul.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign




From cain at cshl.edu  Fri Apr 28 09:14:35 2006
From: cain at cshl.edu (Scott Cain)
Date: Fri, 28 Apr 2006 09:14:35 -0400
Subject: [Bioperl-l] Bio::Tools::GFF
In-Reply-To: <70C6614D-27AF-4B5D-A4FB-19981F97F05B@uiuc.edu>
References: <1ae5268519a170870d2de3daa52ed163@sanger.ac.uk>
	<70C6614D-27AF-4B5D-A4FB-19981F97F05B@uiuc.edu>
Message-ID: <1146230076.2770.219.camel@localhost.localdomain>

Hi Chris and Paul,

I committed the change--Paul is right, the list was really out of date.
Thanks for pointing it out.

Scott


On Fri, 2006-04-28 at 08:03 -0500, Chris Fields wrote:
> Lincoln's working on GFF3 integration into BioPerl at the moment  
> which will not use Bio::DB::GFF, so there's a bit of reluctance at  
> the moment to commit this unless Lincoln signals that it's fine.
> 
> http://article.gmane.org/gmane.comp.lang.perl.bio.general/10691/match=
> 
> http://www.bioperl.org/wiki/ListSummary:April_12-25%2C2006#Bioperl- 
> guts_.28for_the_die-hards.29
> 
> If you look in CVS in Bio::DB, several new modules have been added  
> (also in the ListSummary above).  You could try those out but I have  
> no idea what kind of working condition they are in and how stable the  
> API is at the moment.
> 
> You could email the GMOD lists as well (I get the GBrowse, which  
> Scott Cain and Lincoln regularly post to).  Info here:
> 
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
> 
> Chris
> 
> On Apr 28, 2006, at 5:41 AM, Paul Mooney wrote:
> 
> > Hi,
> >
> > I've modified one line in my local copy of Bio::Tools::GFF so it takes
> > into account *all* of the special tags defined here;
> > http://song.sourceforge.net/gff3.shtml
> >
> > Current CVS version;
> > $tag= lcfirst($tag) unless ($tag =~/^ID|Name|Alias|Parent|Gap|Target 
> > $/);
> >
> > My version;
> > $tag= lcfirst($tag) unless ($tag
> > =~/
> > ^ID|Name|Alias|Parent|Gap|Target|Derives_from|Note|Dbxref| 
> > Ontology_term$
> > /);
> >
> > Could someone update cvs please?
> > Paul.
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> Christopher Fields
> Postdoctoral Researcher
> Lab of Dr. Robert Switzer
> Dept of Biochemistry
> University of Illinois Urbana-Champaign
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                         cain at cshl.edu
GMOD Coordinator (http://www.gmod.org/)                     216-392-3087
Cold Spring Harbor Laboratory