[Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails

Brian Osborne osborne1 at optonline.net
Tue Apr 11 18:14:52 EDT 2006


Eleni,

I can retrieve NM_001008292, no problem:

 ~>perl -e 'use Bio::DB::GenBank; $db = Bio::DB::GenBank->new(-no_redirect
=> 1); $seq = $db->get_Seq_by_acc('NM_001008292');print $seq->seq;'
CCGGCGTCCGTCCGCCGCGGGATGGCGGCTCTGAGGAGTTGGATGACTCGGAGCGTAACCTTTCTGTTCAGGTACG
GACAGCGTTTTCCTGTCTCTGCTAACTCTAAGAAACGCTGTTTCTCAGAATTGATAAGACCATGGCACAAAACTAT
GTTGACTGGATTCGGTGTGACACTGTGCGCCGTTCCTATTGCTCAGAAATCAGAGCCTCAGTCTCTCAGCAACGAA
GCACTGATGAGGAGGGCTGTGTCTTTGGTAACGGACAGCACCTCTACCTTTCTGTCTCAAACCACGTACGCACTGA
TCGAAGCCATCACCGAGTATACTAAGGCTGTCTACACGTTAGTGTCTCTGTACCGACAGTATACAAGCTTGCTGGG
GAAGATGAATTCCCAGGAGGAGGATGAGGTGTGGCAGGTGATCATAGGAGCCAGAGTTGAGATGACTTCAAAGCAG
CAGGAGTACTTGAAGCTGGAGACCACGTGGATGACAGCAGTCAGCCTTTCAGAGATGGCTGCGGAGGCTGCCTATC
AGACTGGAGCAGATCAGGCCTCTATAACCGCCAGGAATCACATCCAGTTGGTGAAGTCGCAGGTGCAGGAGGTGCG
CCAGCTCTCCCAGAAGGCGGAAACCAAGCTGGCAGAAGTGCAGACACAAGAGCTGCGCCAGAAAACACAGGAAGCG
AGCGATGAGGCAGCGGACCAGGAAGAGGAGGCCTACCTACGAGAAGATTGAGGGCTCGAGCCCAGTGCCCTGTCCA
TCCACTCTGTGGGGAAAGCAGGTGCATGACATCCACCCAGTGACGTCCCAACTGCAGAAGCTGACCGGTTCTGCCA
TTGACAGTCAGACCAGAGCCTTTGCGAGCTGCGCCTGGCCCCTTCTCTCTGCTCGCAGCCTCTCTGGGCCTGGCTC
TGCACTGTCCCTCACACAGCTTCTCTCTTGATCTTTTACCTCACTCCCAAAGCACTTCACCAACCGGGGCCAATGG
AGGAGGGGCCTTTTCTGCCACACCCTTAAGTTCAATAGCTGTTTAACTCCAGTTTTTACTGTTACTCAGATGTTCA
AGTATGAATTACTGCTTGCTCCTCCACAGGGAAGCTTGTCTGGTTTGTAACATTTCTTTGTGTTTATAATGTCCTT
TCTCCCTGTGAGCACAGCTCAGCTAAGGCGTTACTCAGTGTGAACAGTTCCCCTGGTGCTCCCCACAGCACCTTCT
CCAACACGTGCTTCTTGTTCGTTCCTTTTTTGAATTTCTCTGCTGTATCCAAAGGAAGAGAAGTTTGGTGTTTGCA
TTAAAAAAAAAAAAAAAGTCAAAAAAAAAAAAAAAAAAAAA

Could it be the ' ' before the string 'NM_001008292' that's causing the
problem?

Brian O.



On 4/11/06 3:30 AM, "Eleni Rapsomaniki" <e.rapsomaniki at mail.cryst.bbk.ac.uk>
wrote:

> Hi again,
> 
> Thank you for your reply regarding the retrieval of sequence features for
> Refseq proteins. I have updated to bioperl 1.5 but the re-direct still does
> not
> work and the following code:
> 
> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
> my $seq = $factory->get_Seq_by_acc(' NM_001008292');
> 
> returns:
> MSG: [gb| NM_001008292] is not a normal sequence entry but a RefSeq entry.
> Redirecting the request.
> 
> -------------------- WARNING ---------------------
> MSG: acc (gb| NM_001008292) does not exist
> ---------------------------------------------------
> 
> I get the same error when I replace Bio::DB::GenBank with Bio::DB::RefSeq, and
> with many other refseq accessions.
> 
> Could I be doing something wrong or maybe I should be using a different method
> for parsing refseq records? I suppose the alternative is to create objects
> from
> files after fetching them..
> 
> Many thanks
> Eleni Rapsomaniki
> 
> 
> 
> ----------------------------------------------------------------
> This message was sent using IMP, the Internet Messaging Program.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




More information about the Bioperl-l mailing list