[Bioperl-l] retrieving top_SeqFeatures for RefSeq proteins fails

Chris Fields cjfields at uiuc.edu
Tue Apr 11 22:27:58 EDT 2006


I got this to work as well using Mac OS X.  Looking at CVS, I noticed  
that 'no_redirect' was added about three months ago by Brian, so you  
definitely need to update to CVS (NOT v. 1.5.1).

Chris

On Apr 11, 2006, at 5:14 PM, Brian Osborne wrote:

> Eleni,
>
> I can retrieve NM_001008292, no problem:
>
>  ~>perl -e 'use Bio::DB::GenBank; $db = Bio::DB::GenBank->new(- 
> no_redirect
> => 1); $seq = $db->get_Seq_by_acc('NM_001008292');print $seq->seq;'
> CCGGCGTCCGTCCGCCGCGGGATGGCGGCTCTGAGGAGTTGGATGACTCGGAGCGTAACCTTTCTGTTCA 
> GGTACG
> GACAGCGTTTTCCTGTCTCTGCTAACTCTAAGAAACGCTGTTTCTCAGAATTGATAAGACCATGGCACAA 
> AACTAT
> GTTGACTGGATTCGGTGTGACACTGTGCGCCGTTCCTATTGCTCAGAAATCAGAGCCTCAGTCTCTCAGC 
> AACGAA
> GCACTGATGAGGAGGGCTGTGTCTTTGGTAACGGACAGCACCTCTACCTTTCTGTCTCAAACCACGTACG 
> CACTGA
> TCGAAGCCATCACCGAGTATACTAAGGCTGTCTACACGTTAGTGTCTCTGTACCGACAGTATACAAGCTT 
> GCTGGG
> GAAGATGAATTCCCAGGAGGAGGATGAGGTGTGGCAGGTGATCATAGGAGCCAGAGTTGAGATGACTTCA 
> AAGCAG
> CAGGAGTACTTGAAGCTGGAGACCACGTGGATGACAGCAGTCAGCCTTTCAGAGATGGCTGCGGAGGCTG 
> CCTATC
> AGACTGGAGCAGATCAGGCCTCTATAACCGCCAGGAATCACATCCAGTTGGTGAAGTCGCAGGTGCAGGA 
> GGTGCG
> CCAGCTCTCCCAGAAGGCGGAAACCAAGCTGGCAGAAGTGCAGACACAAGAGCTGCGCCAGAAAACACAG 
> GAAGCG
> AGCGATGAGGCAGCGGACCAGGAAGAGGAGGCCTACCTACGAGAAGATTGAGGGCTCGAGCCCAGTGCCC 
> TGTCCA
> TCCACTCTGTGGGGAAAGCAGGTGCATGACATCCACCCAGTGACGTCCCAACTGCAGAAGCTGACCGGTT 
> CTGCCA
> TTGACAGTCAGACCAGAGCCTTTGCGAGCTGCGCCTGGCCCCTTCTCTCTGCTCGCAGCCTCTCTGGGCC 
> TGGCTC
> TGCACTGTCCCTCACACAGCTTCTCTCTTGATCTTTTACCTCACTCCCAAAGCACTTCACCAACCGGGGC 
> CAATGG
> AGGAGGGGCCTTTTCTGCCACACCCTTAAGTTCAATAGCTGTTTAACTCCAGTTTTTACTGTTACTCAGA 
> TGTTCA
> AGTATGAATTACTGCTTGCTCCTCCACAGGGAAGCTTGTCTGGTTTGTAACATTTCTTTGTGTTTATAAT 
> GTCCTT
> TCTCCCTGTGAGCACAGCTCAGCTAAGGCGTTACTCAGTGTGAACAGTTCCCCTGGTGCTCCCCACAGCA 
> CCTTCT
> CCAACACGTGCTTCTTGTTCGTTCCTTTTTTGAATTTCTCTGCTGTATCCAAAGGAAGAGAAGTTTGGTG 
> TTTGCA
> TTAAAAAAAAAAAAAAAGTCAAAAAAAAAAAAAAAAAAAAA
>
> Could it be the ' ' before the string 'NM_001008292' that's causing  
> the
> problem?
>
> Brian O.
>
>
>
> On 4/11/06 3:30 AM, "Eleni Rapsomaniki"  
> <e.rapsomaniki at mail.cryst.bbk.ac.uk>
> wrote:
>
>> Hi again,
>>
>> Thank you for your reply regarding the retrieval of sequence  
>> features for
>> Refseq proteins. I have updated to bioperl 1.5 but the re-direct  
>> still does
>> not
>> work and the following code:
>>
>> my $factory = Bio::DB::GenBank->new(-no_redirect => 1);
>> my $seq = $factory->get_Seq_by_acc(' NM_001008292');
>>
>> returns:
>> MSG: [gb| NM_001008292] is not a normal sequence entry but a  
>> RefSeq entry.
>> Redirecting the request.
>>
>> -------------------- WARNING ---------------------
>> MSG: acc (gb| NM_001008292) does not exist
>> ---------------------------------------------------
>>
>> I get the same error when I replace Bio::DB::GenBank with  
>> Bio::DB::RefSeq, and
>> with many other refseq accessions.
>>
>> Could I be doing something wrong or maybe I should be using a  
>> different method
>> for parsing refseq records? I suppose the alternative is to create  
>> objects
>> from
>> files after fetching them..
>>
>> Many thanks
>> Eleni Rapsomaniki
>>
>>
>>
>> ----------------------------------------------------------------
>> This message was sent using IMP, the Internet Messaging Program.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign





More information about the Bioperl-l mailing list