[Bioperl-l] FW: A bio-perl networking problem

Brian Osborne osborne1 at optonline.net
Sun Aug 6 11:38:11 EDT 2006


------ Forwarded Message
From: deepak shingan <deep_ans at yahoo.com>
Date: Sun, 06 Aug 2006 01:09:42 -0700 (PDT)
To: <osborne1 at optonline.net>
Subject: A bio-perl networking problem

Hello Sir, 
I am in a greate trouble and I really want your help.
  
I am using SearchIO algorithm for parsing the blast result file in the
xml-rpc environment.
  
I have a client and server written in perl. The very first request that
I am sending is getting executed and I am able to see the output result
at the client side.
But for the second request I am sending is not getting executed
succesfully. Even it dose not throw any exception.
I think the problem is with "->next_result" statement which can not collect
result on the second request even the file contains many hits.
Can you give some light on this. I am really sorry for disturbing you
but I am not  able to make out anything.
So please help me. 
  
Here , I am sending the source code for testClient and testParser and
also a tempoaray Blast result file for testing.
  

 
  
Thanks and egoursly waiting for your responce.
Deepak 
  
 
  

 
  
#fileName :: TestServer.pl
  
use warnings; 
use strict; 
use Frontier::Daemon;
  
use Bio::SimpleAlign;
use Bio::SearchIO; 
use Bio::AlignIO; 
use Error qw(:try);
  
#**************************************************************************­
***** 
# start the daemon 
Frontier::Daemon->new(
LocalPort => 8901, 
methods => { 
'blastParser'=>\&blastParser,
  
} 

  
) 
or die "Failed to start daemon: $!\n";
#**************************************************************************­
***** 
# Methods 
#**************************************************************************­
***** 
  
sub blastParser 
{ 
try{ 
print "\nInside...";
my @outputArray; 
my $arrayCntr = 0; 
#This is the file that is transfered by ftp to the current working
#directory 
#but for testing just hardcoded
my $file = "tempBlastFile";
print "\n$file"; 
#hardcoded just for testing
my $recordCounts = 10;
my $in = new Bio::SearchIO(-format => 'blast',
# comment out the next line to read STDIN
-file => $file ); 
  
#for the second request its not entering into the while loop
#even though the file has many hits
while ( my $result = $in->next_result )
{ 
print "\nInside result..";
my @stats = $result->available_statistics;
my @params = $result->available_parameters;
while ( my $hit = $result->next_hit and $recordCounts)
{ 
print "\n\nRecordcount ::\t$recordCounts\n\n";
$recordCounts--; 
my $id = $hit->matches('id');
my $cons = $hit->matches('cons');
my @accs = $hit->each_accession_number;
my @qidentical = $hit->seq_inds('query','identical');
my @qconserved = $hit->seq_inds('query','conserved');
my @hidentical = $hit->seq_inds('hit','identical');
my @hconserved = $hit->seq_inds('hit','conserved');
$outputArray[$arrayCntr] = $hit->name;
$arrayCntr++; 
$outputArray[$arrayCntr] = $hit->accession;
$arrayCntr++; 
$outputArray[$arrayCntr] = $hit->raw_score;
$arrayCntr++; 
$outputArray[$arrayCntr] = $hit->bits;
$arrayCntr++; 
$outputArray[$arrayCntr] = $hit->gaps;
$arrayCntr++; 
while ( my $hsp = $hit->next_hsp )
{ 
my ($qid,$qcons) = $hsp->matches('hit');
my ($id,$cons) = $hsp->matches('query');
@qidentical = $hsp->seq_inds('query','identical');
@qconserved = $hsp->seq_inds('query','conserved');
@hidentical = $hsp->seq_inds('hit','identical');
@hconserved = $hsp->seq_inds('hit','conserved');
my @hrange = $hsp->range('hit');
my @qrange = $hsp->range('query');
my $aln = $hsp->get_aln;
my $alnIO = 
Bio::AlignIO->new(-format=>"clustalw",-file=>'>tempHitFile');
$outputArray[$arrayCntr] = $hsp->evalue;
$arrayCntr++; 
$outputArray[$arrayCntr] = $hsp->percent_identity;
$arrayCntr++; 
$alnIO->write_aln($aln);
open hitFile, "tempHitFile" or die "Can't read file";
undef $/; 
my $allignMent = <hitFile>;
$outputArray[$arrayCntr] = $allignMent;
$arrayCntr++; 
close hitFile; $logger->debug("Allignment :",$allignMent);
undef $hsp; 
  
}#hsp while ends 
undef $hit; 
}#hit while ends 
}#result while end 

  
print "\nReturning Output Array...\n";
undef $in; 
return \@outputArray;
  
} catch Error with 

  
{ 
my $ex = shift; 
print "Exception...!: $ex";
  
  
} 
} 

  
#fileName : testClient
  
use Frontier::Client;
# Make an object to represent the XML-RPC server.
$server_url = 'http://localhost:8901/RPC2';
<http://www.google.com/url?sa=D&amp;q=http://localhost:8901/RPC2%27%3B>
$server = Frontier::Client->new(url => $server_url);
# Call the remote server and get our result.
$result = $server->call('blastParser');
print "Got the result back\n". @$result ;


  
  
  
  
  
Behind every successful man, there is a woman
And behind every unsuccessful man, there are two...!!!
  
  

  
 
  
 
 

Yahoo! Messenger with Voice. Make PC-to-Phone Calls
<http://us.rd.yahoo.com/mail_us/taglines/postman1/*http://us.rd.yahoo.com/ev
t=39663/*http://voice.yahoo.com>  to the US (and 30+ countries) for 2¢/min
or less.

BLASTN 2.2.11 [Jun-05-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1_636_39
         (844 letters)

Database: Chimp_Genome_With_GeneID_coordinates_BUILD1.fasta
           40,517 sequences; 3,089,631,664 total letters

Searching...................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits)
Value

112104-112105: 22707394-23965543                                      224
7e-56
113895-113896: 10715500-10725880                                      176
1e-41
110427-110428: 29765264-29902644                                      145
5e-32
108622-108623: 129300340-130310706                                    141
8e-31
111131: 144643645-144703036                                           111
7e-22
122818-122819: 145994494-147531331                                     88
1e-14

>112104-112105: 22707394-23965543
          Length = 1258150

 Score =  224 bits (113), Expect = 7e-56
 Identities = 237/278 (85%), Gaps = 4/278 (1%)
 Strand = Plus / Minus

                   
Query: 20    ggccttgttcaattaagcactctattcttaatttactgctaaatcctccttggactctca 79
             |||| ||||||| ||||||||||| ||||| ||||||||||||||| |||| ||| || |
Sbjct: 44216 ggccctgttcaactaagcactctactcttagtttactgctaaatccaccttcgaccctta
44157

                   
Query: 80    ggtttcatgagagttatcgtgggttttctaggatagaaaatgtagcccatctttttccgt
139
             |||||||| || ||||||||   |||  | || ||||||||||||||||| | || ||
Sbjct: 44156 ggtttcataagggttatcgtaattttcatggggtagaaaatgtagcccatttcttgccac
44097

                   
Query: 140   ctcataggctacaccttgacctaacgtttttgcgaaaaggggtacttgcgctcactttgt
199
             ||||| ||||||||||||||||||||| ||| ||     ||||||||||||| |||||||
Sbjct: 44096 ctcatgggctacaccttgacctaacgtctttacgt----gggtacttgcgcttactttgt
44041

                   
Query: 200   gacctttatcagggtttgctgaagatggcggtatataggctgagcaagagagggtagggt
259
              ||||| |||||||||||||||||||||||||||||||||||||||||||  |||  |||
Sbjct: 44040 aaccttcatcagggtttgctgaagatggcggtatataggctgagcaagaggtggtgaggt
43981

                   
Query: 260   ggatcggggtttatcgattatgggacaggctcctctag 297
              |||||||||||||||||||  | ||||||||||||||
Sbjct: 43980 tgatcggggtttatcgattacagaacaggctcctctag 43943


>113895-113896: 10715500-10725880
          Length = 10381

 Score =  176 bits (89), Expect = 1e-41
 Identities = 230/274 (83%), Gaps = 6/274 (2%)
 Strand = Plus / Plus

                   
Query: 25   tgttcaattaagcactctattcttaatttactgctaaatcctccttggactctcaggttt 84
            ||||||| ||||||||||| ||||| ||||||||||||||| |||| ||| || |  |||
Sbjct: 4798 tgttcaactaagcactctactcttagtttactgctaaatccaccttcgacccttaaattt
4857

                   
Query: 85   catgagagttatcgtgggttttctaggatagaaaatgtagcccatctttttccgtctcat 144
            ||| || |||||||| | ||||||    ||||||||||||||||| | || ||  |||||
Sbjct: 4858 cataagggttatcgtag-ttttctgaagtagaaaatgtagcccatttcttgccacctcat
4916

                   
Query: 145  aggctacaccttgacctaacgtttttgcgaaaaggggtacttgcgctcactttgtgacct 204
             ||||||||||||||||||||| ||| ||     ||||||||||||| |||||| | |||
Sbjct: 4917 gggctacaccttgacctaacgtctttacgt----gggtacttgcgcttactttgcggcct
4972

                   
Query: 205  ttatcagggtttgctgaagatggcggtatataggctgagcaagagag-ggtagggtggat 263
            |  |||||||||||||||||||||||||||||||||||||||||| | |||  ||| |||
Sbjct: 4973 tcgtcagggtttgctgaagatggcggtatataggctgagcaagagggtggtgaggttgat
5032

                   
Query: 264  cggggtttatcgattatgggacaggctcctctag 297
            ||||||||||||||||  | |||||| |||||||
Sbjct: 5033 cggggtttatcgattacagaacaggcccctctag 5066


>110427-110428: 29765264-29902644
          Length = 137381

 Score =  145 bits (73), Expect = 5e-32
 Identities = 137/158 (86%), Gaps = 4/158 (2%)
 Strand = Plus / Minus

                   
Query: 140    ctcataggctacaccttgacctaacgtttttgcgaaaaggggtacttgcgctcactttgt
199
              ||||| ||||||||||||||||||||| ||| ||     ||||||||||||| ||||||
Sbjct: 126023 ctcatgggctacaccttgacctaacgtctttacgt----gggtacttgcgcttactttgc
125968

                   
Query: 200    gacctttatcagggtttgctgaagatggcggtatataggctgagcaagagagggtagggt
259
                |||| |||||||||||||||||||||||||||||||||||||||||||  |||  |||
Sbjct: 125967 agccttcatcagggtttgctgaagatggcggtatataggctgagcaagaggtggtgaggt
125908

                   
Query: 260    ggatcggggtttatcgattatgggacaggctcctctag 297
               |||||||||||||||||||  | ||||||||||||||
Sbjct: 125907 tgatcggggtttatcgattacagaacaggctcctctag 125870


>108622-108623: 129300340-130310706
          Length = 1010367

 Score =  141 bits (71), Expect = 8e-31
 Identities = 195/232 (84%), Gaps = 7/232 (3%)
 Strand = Plus / Minus

                   
Query: 20     ggccttgttcaattaagcactctattcttaatttactgctaaatcctccttggactctca
79
              |||||| ||||||||||||||||  || ||||||||||||||||||||||||| | || |
Sbjct: 110910 ggccttattcaattaagcactctgctcctaatttactgctaaatcctccttgggccctta
110851

                   
Query: 80     ggtttcatgagagttatcgtg-ggttttctagga-tagaaaatgtagcccatctttttcc
137
              |||||||| || ||| | ||| | |||||||||| |||||||| |||||||| | || ||
Sbjct: 110850 ggtttcataagggttgttgtgagattttctaggagtagaaaatatagcccatttcttacc
110791

                   
Query: 138    gtctcataggctacaccttgacctaacgtttttgcgaaaaggggtacttgcgctcacttt
197
                ||||| ||||||| ||||||||||||||||| || |    | |||||||||| |||||
Sbjct: 110790 acctcatgggctacaacttgacctaacgtttttacgta----gatacttgcgcttacttt
110735

                   
Query: 198    gtgacctttatcagggtttgctgaagatggcggtatataggctgagcaagag 249
              |  | | |||  ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 110734 g-cagccttactagggtttgctgaagatggcagtatataggctgagcaagag 110684


>111131: 144643645-144703036
          Length = 59392

 Score =  111 bits (56), Expect = 7e-22
 Identities = 153/185 (82%), Gaps = 4/185 (2%)
 Strand = Plus / Minus

                   
Query: 113  tagaaaatgtagcccatctttttccgtctcataggctacaccttgacctaacgtttttgc 172
            ||||||||||||||||| | || ||  ||||| |||||||||||||||||| ||||||
Sbjct: 9254 tagaaaatgtagcccatttcttaccacctcatgggctacaccttgacctaatgtttttat
9195

                   
Query: 173  gaaaaggggtacttgcgctcactttgtgacctttatcagggtttgctgaagatggcggta 232
            | | |    |||||| ||| |||||||||| ||||  |||||||||||||||||  ||||
Sbjct: 9194 gtaga----tacttgtgcttactttgtgacttttactagggtttgctgaagatgatggta
9139

                   
Query: 233  tataggctgagcaagagagggtagggtggatcggggtttatcgattatgggacaggctcc 292
            |||||||||||||||||  |||  |||  || |||||||||| ||||| | |||||||||
Sbjct: 9138 tataggctgagcaagaggtggtgaggtaaattggggtttatccattatagaacaggctcc
9079

                 
Query: 293  tctag 297
            |||||
Sbjct: 9078 tctag 9074


>122818-122819: 145994494-147531331
          Length = 1536838

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 111/132 (84%), Gaps = 1/132 (0%)
 Strand = Plus / Minus

                   
Query: 39      ctctattcttaatttactgctaaatcctccttggactctcaggtttcatgagagttatcg
98
               |||||||||| ||||||| ||||||||||||| |||  | | |||||||||| ||| ||
Sbjct: 1324540 ctctattcttgatttactactaaatcctcctttgacctttaagtttcatgagggttgtca
1324481

                   
Query: 99      tgggttttctaggat-agaaaatgtagcccatctttttccgtctcataggctacaccttg
157
               ||||| ||||||  | ||||||||| |||||| | ||||| |||||| ||||||||||||
Sbjct: 1324480 tgggtgttctagatttagaaaatgtggcccatttctttccatctcatgggctacaccttg
1324421

                   
Query: 158     acctaacgtttt 169
               | ||||| ||||
Sbjct: 1324420 atctaacatttt 1324409


  Database: Chimp_Genome_With_GeneID_coordinates_BUILD1.fasta
    Posted date:  Nov 16, 2005  5:29 PM
  Number of letters in database: 3,089,631,664
  Number of sequences in database:  40,517
  
Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,543,047
Number of Sequences: 40517
Number of extensions: 1543047
Number of successful extensions: 4846
Number of sequences better than 1.0e-10: 6
Number of HSP's better than  0.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 4821
Number of HSP's gapped (non-prelim): 20
length of query: 844
length of database: 3,089,631,664
effective HSP length: 21
effective length of query: 823
effective length of database: 3,088,780,807
effective search space: 2542066604161
effective search space used: 2542066604161
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 38 (75.8 bits)


------ End of Forwarded Message




More information about the Bioperl-l mailing list