[Bioperl-l] NO BLAST
Luba Pardo
lubapardo at gmail.com
Fri Dec 15 11:39:11 EST 2006
*Hello,*
*I am having trouble to use the module Bio::Tools::Run::StandAloneBlast;*
**
*I got the following error message: cannot find path to blastall.*
*The code I used is (modified from HOWTObeginners):
*
#! /local/bin/perl -w
#use strict;
use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; use
Bio::Tools::Run::StandAloneBlast;
my $db_object = Bio::DB::GenBank-> new;
#my $seq_ob = $db_object->get_Seq_by_id('NM_004043');
#$seq= Bio::SeqIO->new(-file => "> out.fasta", -format => 'fasta');
#$seq ->write_seq($seq_ob);
#print $seq;
@params = (program =>'blastn',
database =>'db.fa');
$blast_obj =Bio::Tools::Run::StandAloneBlast->new(@params);
$seq_obj = Bio::Seq->new(-id =>"testquery",
-seq =>"TTTAAATATATTTTGAAGTATAGATTATATGTT");
$report_obj = $blast_obj->blastall($seq_obj);
$result_obj =$report_obj->next_result;
print $result_obj->num_hits;
*Whether I create a sequence the novo or retrieve one from internet I got
the same message.*
More information about the Bioperl-l
mailing list