[Bioperl-l] OK for aa seq but not a na seq on RemoteBlast.pm version 1.28

Pieter Monsieurs Pieter.Monsieurs at esat.kuleuven.be
Thu Feb 16 04:46:09 EST 2006


Hi,

I have the same problem with the blast.pm-file.
The people of NCBI added some extra info when giving the Blast-output. 
(see e.g. "Features flanking this part..." or "Features in this part 
..."), example added.
The blast.pm module starts looking for the hsp-alignement-information, 
but it dies when it hits this Feature-information.

Pieter


>gi|77552765|gb|DP000011.1| <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=77552765&dopt=GenBank> Oryza sativa (japonica cultivar-group) chromosome 12, complete 

sequence
Length=27492551

 Features flanking this part of subject sequence:
   
3726 bp at 5' side: transposon protein, putative, CACTA, En/Spm sub-class <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=19251479&to=19253693&view=gbwithparts>
   
2655 bp at 3' side: hypothetical protein <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=19260091&to=19260600&view=gbwithparts>

 Score = 36.2 bits (18),  Expect = 0.22
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  4         GTACTACTCTACTCTACT  21
                 ||||||||||||||||||

Sbjct  19257436  GTACTACTCTACTCTACT  19257419


 Features flanking this part of subject sequence:
   
2991 bp at 5' side: hypothetical protein <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=27003164&to=27003907&view=gbwithparts>
   1131 bp at 3' side: hypothetical protein
 <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=27008046&to=27010752&view=gbwithparts>

 Score = 36.2 bits (18),  Expect = 0.22
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus

Query  2         ATGTACTACTCTACTCTA  19
                 ||||||||||||||||||
Sbjct  27006915  ATGTACTACTCTACTCTA  27006898



 Features in this part of subject sequence:
   DHHC zinc finger domain, putative
 <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=17614825&to=17618687&view=gbwithparts>

 Score = 34.2 bits (17),  Expect = 0.87
 Identities = 17/17 (100%), Gaps = 0/17 (0%)
 Strand=Plus/Plus

Query  5         TACTACTCTACTCTACT  21
                 |||||||||||||||||
Sbjct  17616437  TACTACTCTACTCTACT  17616453



 Features flanking this part of subject sequence:
   102 bp at 5' side: bZIP transcription factor, putative
 <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=2774964&to=2775778&view=gbwithparts>
   3740 bp at 3' side: yeast dcp1, putative <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=2779635&to=2782508&view=gbwithparts>

 Score = 32.2 bits (16),  Expect = 
3.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Plus

Query  7        CTACTCTACTCTACTC  22
                ||||||||||||||||
Sbjct  2775880  CTACTCTACTCTACTC  2775895


 Features flanking this part of subject sequence:

   21 bp at 5' side: peptide transporter T17F3.11, putative <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=27321354&to=27323117&view=gbwithparts>
   
10230 bp at 3' side: transposon protein, putative, unclassified <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide&from=27333383&to=27334285&view=gbwithparts>

 Score = 32.2 bits (16),  Expect = 3.4
 Identities = 16/16 (100%), Gaps = 0/16 (0%)
 Strand=Plus/Minus

Query  7         CTACTCTACTCTACTC  22

                 ||||||||||||||||
Sbjct  27323153  CTACTCTACTCTACTC  27323138




Guojun Yang wrote:

>Hi, Chris,
>Finally the remoteblast test script works for the amino.fa query. but when I try a nucleic acid sequence (see below), Error occurs: 
>"
>waiting........
>------------- EXCEPTION  -------------
>MSG: no data for midline  Features flanking this part of subject sequence:
>STACK Bio::SearchIO::blast::next_result /usr/lib/perl5/site_perl/5.8.3/Bio/Searc                             hIO/blast.pm:1172
>STACK toplevel remoteblast_test:40
>"
>The query sequence is:
>CTCCCTCCGTCTCAAAATATTTGACGCCGTTGACTTTTTACTAAAAATGTTTGACCGTTC
>GTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTA
>AATATATTTTTATGTATACATATAGTTTTACATATTTCACAAAAAATTTTGAATAAGACG
>AACGGTCAAATATGTTTTAAAAAGTCAACGGTGTCAAACATTTAGAAACGGAGGGAG
>
>The script (basically same as the remoteblast test, I only changed database to 'nr' and program to 'blastn' and filename to 'ost3'):
>#!/usr/bin/perl
>
>use Bio::SeqIO;
>use Bio::Seq;
>use Bio::Tools::Run::RemoteBlast;
>use Bio::SearchIO;
>use strict;
>my $prog='blastn';
>my $db='nr';
>my $e_val=1e-10;
>my @params=( -prog=>$prog,
>	-data=>$db,
>	-expect=>$e_val,
>	-readmethod=>'SearchIO');
>my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>
>my $v = 1;
>
>my $str = Bio::SeqIO->new(-file=>'ost3' , -format => 'fasta' );
>
>while (my $input = $str->next_seq()){
>  #Blast a sequence against a database:
>  #Alternatively, you could  pass in a file with many
>  #sequences rather than loop through sequence one at a time
>  #Remove the loop starting 'while (my $input = $str->next_seq())'
>  #and swap the two lines below for an example of that.
>  my $r = $factory->submit_blast($input);
>  #my $r = $factory->submit_blast('amino.fa');
>  print STDERR "waiting..." if( $v > 0 );
>  while ( my @rids = $factory->each_rid ) {
>    foreach my $rid ( @rids ) {
>      my $rc = $factory->retrieve_blast($rid);
>      if( !ref($rc) ) {
>        if( $rc < 0 ) {
>          $factory->remove_rid($rid);
>        }
>        print STDERR "." if ( $v > 0 );
>        sleep 5;
>      } else {
>        my $result = $rc->next_result();
>        #save the output
>        my $filename = $result->query_name()."\.out";
>        $factory->save_output($filename);
>        $factory->remove_rid($rid);
>        print "\nQuery Name: ", $result->query_name(), "\n";
>        while ( my $hit = $result->next_hit ) {
>          next unless ( $v > 0);
>          print "\thit name is ", $hit->name, "\n";
>          while( my $hsp = $hit->next_hsp ) {
>            print "\t\tscore is ", $hsp->score, "\n";
>          }
>        }
>      }
>    }
>  }
>}
>
>
>Do you think there might still be something in the NCBI output format?
>
>Thank you,
>Guojun
>
>
>
>
>Guojun Yang
>Department of Plant Biology
>University of Georgia
>Tel: 706-542-1857
>Fax: 706-542-1805
>http://www.arches.uga.edu/~guojun
>
>
>
>----- Original Message -----
>From: Chris Fields [mailto:cjfields at uiuc.edu]
>To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>Subject: FW: [Bioperl-l] more on RemoteBlast.pm version 1.2
>
>
>  
>
>>Sorry, forgot to add that I didn't see the regex issue that you mentioned.
>>It could be a perl-related issue.  Try the fixes I mentioned and see what
>>happens.
>>    
>>
>>>Christopher Fields
>>>      
>>>
>>Postdoctoral Researcher - Switzer Lab
>>Dept. of Biochemistry
>>University of Illinois Urbana-Champaign 
>>    
>>
>>>>>-----Original Message-----
>>>>>          
>>>>>
>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>Sent: Tuesday, February 14, 2006 12:36 PM
>>>To: 'gyang at plantbio.uga.edu'
>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
>>>      
>>>
>>>>>It's a good habit to always add single quotes around words.  The perl
>>>>>          
>>>>>
>>>interpreter may think a single bare word is a subroutine or perlfunc
>>>called with no args so will try to find a subroutine named blastp().  My
>>>debugger actually gives the error that the bare word blastp may conflict
>>>with a future reserved word.  Like you said, 'use strict' will point that
>>>out.
>>>      
>>>
>>>>>As for the regex, it should match all the blast programs at NCBI (blastp,
>>>>>          
>>>>>
>>>blastn, blastx, tblastn, tblastx) and is built-in to make sure nothing
>>>else passes through.
>>>      
>>>
>>>>>So, if you are using the script below, there are several errors.  The bare
>>>>>          
>>>>>
>>>words for $prog and $db need quotes, and the flags for you @params array
>>>don't have a dash before them.  I get this after adding quotes but before
>>>adding the dashes to @params:
>>>      
>>>
>>>>>C:\Perl\Scripts>test_blast.pl
>>>>>------------- EXCEPTION: Bio::Root::Exception -------------
>>>>>          
>>>>>
>>>MSG:
>>>STACK: Error::throw
>>>STACK: Bio::Root::Root::throw C:\Perl\src\bioperl\bioperl-
>>>live/Bio/Root/Root.pm:328
>>>STACK: Bio::Tools::Run::RemoteBlast::submit_parameter
>>>C:\Perl\src\bioperl\bioperl-live/Bio/Tools/Run/RemoteBlast.pm:325
>>>STACK: Bio::Tools::Run::RemoteBlast::new C:\Perl\src\bioperl\bioperl-
>>>live/Bio/Tools/Run/RemoteBlast.pm:256
>>>STACK: C:\Perl\Scripts\test_blast.pl:15
>>>-----------------------------------------------------------
>>>      
>>>
>>>>>The last line indicates a problem with this line:
>>>>>my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>>>>>Changing the @params to this:
>>>>>my @params=( -prog=>$prog,
>>>>>          
>>>>>
>>>	-data=>$db,
>>>	-expect=>$e_val,
>>>	-readmethod=>'SearchIO');
>>>      
>>>
>>>>>fixes it, and I get output as expected.
>>>>>Christopher Fields
>>>>>          
>>>>>
>>>Postdoctoral Researcher - Switzer Lab
>>>Dept. of Biochemistry
>>>University of Illinois Urbana-Champaign
>>>      
>>>
>>>>>>>>-----Original Message-----
>>>>>>>>                
>>>>>>>>
>>>>From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
>>>>Sent: Tuesday, February 14, 2006 11:48 AM
>>>>To: Chris Fields; bioperl-l at lists.open-bio.org
>>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
>>>>
>>>>Hi, Chris,
>>>>When I tried with the perldoc script, It did not work either. First it
>>>>says $prog can not be bare word if I "use strict". I added quotes on the
>>>>words, then it says the value for $prog does not match expression
>>>>t?blast[pnx]. Rejecting. STACK ...RemoteBlast.pm 325 and 256.  The
>>>>        
>>>>
>>>script
>>>      
>>>
>>>>is shown below. Why is the expression "t?blast[pnx]"?
>>>>
>>>>#!/usr/bin/perl
>>>>
>>>>use Bio::SeqIO;
>>>>use Bio::Seq;
>>>>use Bio::Tools::Run::RemoteBlast;
>>>>use Bio::SearchIO;
>>>>
>>>>
>>>>my $prog=blastp;
>>>>my $db=swissprot;
>>>>my $e_val=1e-10;
>>>>my @params=( prog=>$prog,
>>>>	data=>$db,
>>>>	expect=>$e_val,
>>>>	readmethod=>'SearchIO');
>>>>my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>>>>
>>>>my $v = 1;
>>>>
>>>>my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta' );
>>>>
>>>>while (my $input = $str->next_seq()){
>>>>  #Blast a sequence against a database:
>>>>  #Alternatively, you could  pass in a file with many
>>>>  #sequences rather than loop through sequence one at a time
>>>>  #Remove the loop starting 'while (my $input = $str->next_seq())'
>>>>  #and swap the two lines below for an example of that.
>>>>  my $r = $factory->submit_blast($input);
>>>>  #my $r = $factory->submit_blast('amino.fa');
>>>>  print STDERR "waiting..." if( $v > 0 );
>>>>  while ( my @rids = $factory->each_rid ) {
>>>>    foreach my $rid ( @rids ) {
>>>>      my $rc = $factory->retrieve_blast($rid);
>>>>      if( !ref($rc) ) {
>>>>        if( $rc < 0 ) {
>>>>          $factory->remove_rid($rid);
>>>>        }
>>>>        print STDERR "." if ( $v > 0 );
>>>>        sleep 5;
>>>>      } else {
>>>>        my $result = $rc->next_result();
>>>>        #save the output
>>>>        my $filename = $result->query_name()."\.out";
>>>>        $factory->save_output($filename);
>>>>        $factory->remove_rid($rid);
>>>>        print "\nQuery Name: ", $result->query_name(), "\n";
>>>>        while ( my $hit = $result->next_hit ) {
>>>>          next unless ( $v > 0);
>>>>          print "\thit name is ", $hit->name, "\n";
>>>>          while( my $hsp = $hit->next_hsp ) {
>>>>            print "\t\tscore is ", $hsp->score, "\n";
>>>>          }
>>>>        }
>>>>      }
>>>>    }
>>>>  }
>>>>}
>>>>
>>>>Thank you for your help!
>>>>
>>>>
>>>>Guojun
>>>>Department of Plant Biology
>>>>University of Georgia
>>>>
>>>>----- Original Message -----
>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>To: gyang at plantbio.uga.edu
>>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>
>>>>
>>>>        
>>>>
>>>>>Try two things:
>>>>>          
>>>>>
>>>>>>1)  Use a much simpler script, like the one in 'perldoc
>>>>>>            
>>>>>>
>>>>>Bio::Tools::Run::RemoteBlast'.  If this fixes it, there's something
>>>>>          
>>>>>
>>>>wrong
>>>>        
>>>>
>>>>>with the logic in your subroutine:
>>>>>          
>>>>>
>>>>>>my $v = 1;
>>>>>>my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta' );
>>>>>>while (my $input = $str->next_seq()){
>>>>>>            
>>>>>>
>>>>>  #Blast a sequence against a database:
>>>>>  #Alternatively, you could  pass in a file with many
>>>>>  #sequences rather than loop through sequence one at a time
>>>>>  #Remove the loop starting 'while (my $input = $str->next_seq())'
>>>>>  #and swap the two lines below for an example of that.
>>>>>  my $r = $factory->submit_blast($input);
>>>>>  #my $r = $factory->submit_blast('amino.fa');
>>>>>  print STDERR "waiting..." if( $v > 0 );
>>>>>  while ( my @rids = $factory->each_rid ) {
>>>>>    foreach my $rid ( @rids ) {
>>>>>      my $rc = $factory->retrieve_blast($rid);
>>>>>      if( !ref($rc) ) {
>>>>>        if( $rc < 0 ) {
>>>>>          $factory->remove_rid($rid);
>>>>>        }
>>>>>        print STDERR "." if ( $v > 0 );
>>>>>        sleep 5;
>>>>>      } else {
>>>>>        my $result = $rc->next_result();
>>>>>        #save the output
>>>>>        my $filename = $result->query_name()."\.out";
>>>>>        $factory->save_output($filename);
>>>>>        $factory->remove_rid($rid);
>>>>>        print "\nQuery Name: ", $result->query_name(), "\n";
>>>>>        while ( my $hit = $result->next_hit ) {
>>>>>          next unless ( $v > 0);
>>>>>          print "\thit name is ", $hit->name, "\n";
>>>>>          while( my $hsp = $hit->next_hsp ) {
>>>>>            print "\t\tscore is ", $hsp->score, "\n";
>>>>>          }
>>>>>        }
>>>>>      }
>>>>>    }
>>>>>  }
>>>>>}
>>>>>          
>>>>>
>>>>>>2) Try the RemoteBlast from Bugzilla and see if that works.  It
>>>>>>            
>>>>>>
>>>really
>>>      
>>>
>>>>>shouldn't make that much of a difference, but I noticed that the CVS
>>>>>RemoteBlast (1.28) was changed in Dec 2005, after bioperl-1.5.1 was
>>>>>released; the Bugzilla version is based off CVS.
>>>>>          
>>>>>
>>>>>>Christopher Fields
>>>>>>            
>>>>>>
>>>>>Postdoctoral Researcher - Switzer Lab
>>>>>Dept. of Biochemistry
>>>>>University of Illinois Urbana-Champaign
>>>>>          
>>>>>
>>>>>>>-----Original Message-----
>>>>>>>              
>>>>>>>
>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>Sent: Monday, February 13, 2006 3:00 PM
>>>>>>To: bioperl-l at lists.open-bio.org
>>>>>>Subject: Re: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>            
>>>>>>
>>>>>>>>Thanks, Chris,
>>>>>>>>                
>>>>>>>>
>>>>>>I installed version 1.5.1 and replaced the blast.pm file with the
>>>>>>            
>>>>>>
>>>one
>>>      
>>>
>>>>from
>>>>        
>>>>
>>>>>>your bug report. The running version is 1.5 when I use the command
>>>>>>            
>>>>>>
>>>you
>>>      
>>>
>>>>>>sent me. But when I tried the script, it doesn't change much. My
>>>>>>remoteblast code (portion) is here:
>>>>>>            
>>>>>>
>>>>>>>>sub search {
>>>>>>>>                
>>>>>>>>
>>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'}="$ORGN";
>>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'WORD_SIZE'}=7;
>>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'}=5000;
>>>>>>local
>>>>>>
>>>>>>            
>>>>>>
>>>$Bio::Tools::Run::RemoteBlast::HEADER{'COMPOSITION_BASED_STATISTICS'}=
>>>      
>>>
>>>>>>'no';
>>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'}='3 1';
>>>>>>my $query = Bio::Seq -> new ( -seq=>"$_[0]",
>>>>>>			      -id=>"query",
>>>>>>			      -desc=>"new seq");
>>>>>>my $len=$query->length();
>>>>>>@db=('nr','htgs','wgs');
>>>>>>foreach my $db (@db) {
>>>>>>my $factory = Bio::Tools::Run::RemoteBlast->new('-prog' =>'blastn',
>>>>>>						'-data' =>"$db",
>>>>>>
>>>>>>            
>>>>>>
>>'-expect'=>"$E_value");
>>    
>>
>>>>>>>>>>my $blast_report = $factory->submit_blast($query);
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>my @rids = $factory->each_rid();
>>>>>>>>                
>>>>>>>>
>>>>>>foreach my $rid ( @rids ) {
>>>>>>    print STDERR "$rid\n";
>>>>>>}
>>>>>># RID = Remote Blast ID (e.g: 1017772174-16400-6638)
>>>>>>print STDERR "waiting...";
>>>>>>sleep 60;
>>>>>>            
>>>>>>
>>>>>>>>foreach my $rid ( @rids ) {
>>>>>>>>                
>>>>>>>>
>>>>>>    my $rc = $factory->retrieve_blast($rid);
>>>>>>    while (!ref($rc) ) {
>>>>>>	if( $rc < 0 ) {
>>>>>># retrieve_blast returns -1 on error
>>>>>>	    $factory->remove_rid($rid);
>>>>>>	    print "Error!\n";
>>>>>>	    send_error($email,$function,$seqname,$queryname[$ST]);
>>>>>>	    die "Can't retrieve $rid";
>>>>>>	} if ($rc==0) { # retrieve_blast returns 0 on 'job not
>>>>>>            
>>>>>>
>>>finished'
>>>      
>>>
>>>>>>	    sleep 60;
>>>>>>	    $rc = $factory->retrieve_blast($rid);
>>>>>>	}
>>>>>>    }
>>>>>>    if (ref($rc)) {
>>>>>>	print STDERR "Done.\n";
>>>>>>	 while( my $result = $rc->next_result) {
>>>>>>	    while( my $hit = $result->next_hit()) {
>>>>>>	    	$hit_name=$hit->name;
>>>>>>		$hit_name =~ /\S+[|](\S+)[.]\d+[|].*/;
>>>>>>		$name=$1;
>>>>>>		@left_plus_start=();
>>>>>>		@left_plus_end=();
>>>>>>		@left_minus_start=();
>>>>>>		@left_minus_end=();
>>>>>>		@right_plus_start=();
>>>>>>		@right_plus_end=();
>>>>>>		@right_minus_start=();
>>>>>>		@right_minus_end=();
>>>>>>            
>>>>>>
>>>>>>>>		if (!($name =~ /^[a-zA-Z][a-zA-Z]\_\d{6}/i)) {
>>>>>>>>                
>>>>>>>>
>>>>>>		while( my $hsp = $hit->next_hsp()) {
>>>>>>......
>>>>>>            
>>>>>>
>>>>>>>>It was working quite well before around October laster year, but
>>>>>>>>                
>>>>>>>>
>>>>it has
>>>>        
>>>>
>>>>>>stopped since then, When a submission is sent via a webpage, the cgi
>>>>>>starts to work and use a memory of ~20 Mb. Then it hangs there,
>>>>>>            
>>>>>>
>>>>finally
>>>>        
>>>>
>>>>>>the expected email is received but without real results although it
>>>>>>            
>>>>>>
>>>>does
>>>>        
>>>>
>>>>>>contain something from other parts of the script. Apparently the
>>>>>>            
>>>>>>
>>>>search
>>>>        
>>>>
>>>>>>sub did not return anything (I know there is something should be
>>>>>>returned.). Is it also possible the format of the NCBI output for
>>>>>>            
>>>>>>
>>>each
>>>      
>>>
>>>>>>result has changed?
>>>>>>Thank you,
>>>>>>Guojun
>>>>>>            
>>>>>>
>>>>>>>>>>Department of Plant Biology
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>University of Georgia
>>>>>>            
>>>>>>
>>>>>>>>>>>>----- Original Message -----
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>>>>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>            
>>>>>>
>>>>>>>>>>>How do you know two versions are installed (i.e. how are
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>you
>>>      
>>>
>>>>checking
>>>>        
>>>>
>>>>>>the
>>>>>>            
>>>>>>
>>>>>>>version)?  Do you see have two complete bioperl distributions (in
>>>>>>>              
>>>>>>>
>>>>two
>>>>        
>>>>
>>>>>>>separate directories) or are you looking in modules?  Here's the
>>>>>>>              
>>>>>>>
>>>way
>>>      
>>>
>>>>to
>>>>        
>>>>
>>>>>>>check the version (from the FAQ):
>>>>>>>              
>>>>>>>
>>>>>>>>perl -MBio::Root::Version -e 'print
>>>>>>>>                
>>>>>>>>
>>>>$Bio::Root::Version::VERSION,"\n"'
>>>>        
>>>>
>>>>>>>>If you have two full bioperl distributions on your computer,
>>>>>>>>                
>>>>>>>>
>>>>normally
>>>>        
>>>>
>>>>>>only
>>>>>>            
>>>>>>
>>>>>>>one will be in use unless you have explicitly set the environment
>>>>>>>              
>>>>>>>
>>>>>>variable
>>>>>>            
>>>>>>
>>>>>>>PERL5LIB.  The PERL5LIB  directories will be searched first before
>>>>>>>              
>>>>>>>
>>>>your
>>>>        
>>>>
>>>>>>>normal perl directory list (@INC) is searched.  You MAY get some
>>>>>>>              
>>>>>>>
>>>>mixing
>>>>        
>>>>
>>>>>>>then, but only if perl can't find a particular module in the path
>>>>>>>              
>>>>>>>
>>>>>>designated
>>>>>>            
>>>>>>
>>>>>>>in PERL5LIB; then it will progress through the directories listed
>>>>>>>              
>>>>>>>
>>>in
>>>      
>>>
>>>>>>@INC.
>>>>>>            
>>>>>>
>>>>>>>This may happen if a module is unique to a particular release, but
>>>>>>>              
>>>>>>>
>>>>>>shouldn't
>>>>>>            
>>>>>>
>>>>>>>happen for the majority of modules, including RemoteBlast.  You
>>>>>>>              
>>>>>>>
>>>can
>>>      
>>>
>>>>>>check
>>>>>>            
>>>>>>
>>>>>>>what @INC and PERL5LIB are set to by using 'perl -V'.  @INC will
>>>>>>>              
>>>>>>>
>>>>differ
>>>>        
>>>>
>>>>>>>depending on your OS, perl build, etc.
>>>>>>>              
>>>>>>>
>>>>>>>>Regardless, if you follow the directions for installing bioperl
>>>>>>>>                
>>>>>>>>
>>>>for
>>>>        
>>>>
>>>>>>your
>>>>>>            
>>>>>>
>>>>>>>system ('perl Makefile.PL', 'make', 'make test', 'make install',
>>>>>>>              
>>>>>>>
>>>>unless
>>>>        
>>>>
>>>>>>you
>>>>>>            
>>>>>>
>>>>>>>explicitly change the installation directory when using 'perl
>>>>>>>              
>>>>>>>
>>>>>>Makefile.PL'),
>>>>>>            
>>>>>>
>>>>>>>then 'uninstalling' Bioperl shouldn't be a problem as it will
>>>>>>>              
>>>>>>>
>>>>install
>>>>        
>>>>
>>>>>>the
>>>>>>            
>>>>>>
>>>>>>>Bioperl distribution you downloaded over the old version in @INC.
>>>>>>>              
>>>>>>>
>>>>See
>>>>        
>>>>
>>>>>>this
>>>>>>            
>>>>>>
>>>>>>>page:
>>>>>>>              
>>>>>>>
>>>>>>>>http://bioperl.open-bio.org/SRC/bioperl-live/INSTALL
>>>>>>>>for more details.
>>>>>>>>Christopher Fields
>>>>>>>>                
>>>>>>>>
>>>>>>>Postdoctoral Researcher - Switzer Lab
>>>>>>>Dept. of Biochemistry
>>>>>>>University of Illinois Urbana-Champaign
>>>>>>>              
>>>>>>>
>>>>>>>>>>-----Original Message-----
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>>>Sent: Monday, February 13, 2006 12:32 PM
>>>>>>>>To: bioperl-l at lists.open-bio.org
>>>>>>>>Subject: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>Hi, Chris,
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>I do have different versions of bioperl on my Linux machine
>>>>>>>>                
>>>>>>>>
>>>(1.4.
>>>      
>>>
>>>>and
>>>>        
>>>>
>>>>>>>>1.5.0), this may be the problem. Should I just install bioperl-
>>>>>>>>                
>>>>>>>>
>>>>1.5.1
>>>>        
>>>>
>>>>>>or I
>>>>>>            
>>>>>>
>>>>>>>>need to uninstall and remove the previous versions. I could not
>>>>>>>>                
>>>>>>>>
>>>>find
>>>>        
>>>>
>>>>>>any
>>>>>>            
>>>>>>
>>>>>>>>hint on uninstalling bioperl on linux. Could you please give me
>>>>>>>>                
>>>>>>>>
>>>>some
>>>>        
>>>>
>>>>>>>>suggestion?
>>>>>>>>Thanks,
>>>>>>>>Guojun
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>Department of Plant Biology
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>University of Georgia
>>>>>>>>      _____
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>  From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>>>>>>>>Sent: Mon, 13 Feb 2006 11:45:14 -0500
>>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
>>>>>>>>                
>>>>>>>>
>>>>>>version
>>>>>>            
>>>>>>
>>>>>>>>1.28
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>>>If you're using RemoteBlast 1.28, then you've likely
>>>>>>>>>>>>>>                            
>>>>>>>>>>>>>>
>>>>>>updated from CVS
>>>>>>            
>>>>>>
>>>>>>>>which isn't the latest fix.
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>Make sure that you check the following:
>>>>>>>>>>1) Always post to the mailing list:
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>http://www.bioperl.org/wiki/HOWTO:Beginners#Getting_Assistance .
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>2) You must have the complete bioperl-1.5.1 or bioperl-live
>>>>>>>>>>                    
>>>>>>>>>>
>>>>(CVS)
>>>>        
>>>>
>>>>>>>>installed first.  Perform a clean installation; do not upgrade
>>>>>>>>                
>>>>>>>>
>>>>only
>>>>        
>>>>
>>>>>>>>Bio::SearchIO::blast and Bio::Tools::Run::RemoteBlast, as we
>>>>>>>>                
>>>>>>>>
>>>can't
>>>      
>>>
>>>>>>>>guarantee that mixing modules from old and new distributions
>>>>>>>>                
>>>>>>>>
>>>(1.4
>>>      
>>>
>>>>and
>>>>        
>>>>
>>>>>>>>1.5.1, for instance) will work.  A bioperl-1.5.1 or bioperl-live
>>>>>>>>installation will allow text output from BLAST v.2.2.12 to be
>>>>>>>>                
>>>>>>>>
>>>>saved
>>>>        
>>>>
>>>>>>and
>>>>>>            
>>>>>>
>>>>>>>>parsed; it will not parse the newest BLAST text output from NCBI
>>>>>>>>                
>>>>>>>>
>>>>>>(v2.2.13)
>>>>>>            
>>>>>>
>>>>>>>>but it should still save it. I believe as long as next_results()
>>>>>>>>                
>>>>>>>>
>>>>isn't
>>>>        
>>>>
>>>>>>>>called, it will work.
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>3) The bug fixes for the above issue with parsing BLAST
>>>>>>>>>>                    
>>>>>>>>>>
>>>2.2.13
>>>      
>>>
>>>>>>text output
>>>>>>            
>>>>>>
>>>>>>>>are NOT in CVS; they haven't been cleared and checked in by
>>>>>>>>                
>>>>>>>>
>>>Roger
>>>      
>>>
>>>>Hall
>>>>        
>>>>
>>>>>>>>(who's now taking care of RemoteBlast) and the powers that be
>>>>>>>>                
>>>>>>>>
>>>>(Jason
>>>>        
>>>>
>>>>>>or
>>>>>>            
>>>>>>
>>>>>>>>whomever is in charge of Bio::SearchIO).  They can be found in
>>>>>>>>                
>>>>>>>>
>>>>>>Bugzilla:
>>>>>>            
>>>>>>
>>>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1934
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1935
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>The fix in RemoteBlast in Bugzilla (#1935) is to allow the
>>>>>>>>>>                    
>>>>>>>>>>
>>>>option
>>>>        
>>>>
>>>>>>of
>>>>>>            
>>>>>>
>>>>>>>>saving XML output, so isn't necessary if you don't plan on using
>>>>>>>>                
>>>>>>>>
>>>>this
>>>>        
>>>>
>>>>>>>>option.  And, remember, they haven't been committed yet to CVS,
>>>>>>>>                
>>>>>>>>
>>>>which
>>>>        
>>>>
>>>>>>>>means that the final version will change to refle the new
>>>>>>>>                
>>>>>>>>
>>>version.
>>>      
>>>
>>>>>>>>>>>>Christopher Fields
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>Postdoctoral Researcher - Switzer Lab
>>>>>>>>Dept. of Biochemistry
>>>>>>>>University of Illinois Urbana-Champaign
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>    _____
>>>>>>>>>>>>From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>Sent: Monday, February 13, 2006 9:26 AM
>>>>>>>>To: Chris Fields
>>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
>>>>>>>>                
>>>>>>>>
>>>>>>version
>>>>>>            
>>>>>>
>>>>>>>>1.28
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>Hi, Chris
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>Thanks for your suggestion, however, it doesn't seem to work
>>>>>>>>>>                    
>>>>>>>>>>
>>>>for
>>>>        
>>>>
>>>>>>my cgi
>>>>>>            
>>>>>>
>>>>>>>>even after I replace both blast.pm and RemoteBlast.pm. I didn't
>>>>>>>>                
>>>>>>>>
>>>>even
>>>>        
>>>>
>>>>>>get
>>>>>>            
>>>>>>
>>>>>>>>any RID. Is there any suggestion?
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>>>Guojun
>>>>>>>>>>>>>>                            
>>>>>>>>>>>>>>
>>>>>>>>>>>>Guojun Yang
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>Department of Plant Biology
>>>>>>>>University of Georgia
>>>>>>>>Tel: 706-542-1857
>>>>>>>>Fax: 706-542-1805
>>>>>>>>http://www.arches.uga.edu/~guojun
>>>>>>>>    _____
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>To: gyang at plantbio.uga.edu, bioperl-l at bioperl.org
>>>>>>>>Sent: Fri, 03 Feb 2006 16:07:29 -0500
>>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
>>>>>>>>                
>>>>>>>>
>>>>>>version
>>>>>>            
>>>>>>
>>>>>>>>1.28
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>I would say give the new code a try, but realize that it
>>>>>>>>>>                    
>>>>>>>>>>
>>>>hasn't
>>>>        
>>>>
>>>>>>been
>>>>>>            
>>>>>>
>>>>>>>>checked
>>>>>>>>in (like I said below). I will try going over the modified
>>>>>>>>Bio::SearchIO::blast again this weekend to see if there is
>>>>>>>>                
>>>>>>>>
>>>>anything I
>>>>        
>>>>
>>>>>>>>might
>>>>>>>>have missed. The changed order in the header of BLAST text
>>>>>>>>                
>>>>>>>>
>>>output
>>>      
>>>
>>>>has
>>>>        
>>>>
>>>>>>me a
>>>>>>            
>>>>>>
>>>>>>>>bit worried that it might not catch everything, but it at least
>>>>>>>>                
>>>>>>>>
>>>>>>doesn't
>>>>>>            
>>>>>>
>>>>>>>>hang
>>>>>>>>in the while() loop I described in the bug report below (bug
>>>>>>>>                
>>>>>>>>
>>>>#1934)
>>>>        
>>>>
>>>>>>and
>>>>>>            
>>>>>>
>>>>>>>>seems to process everything fine.
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>If you want more stability in the code, you might consider
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>changing over
>>>>>>            
>>>>>>
>>>>>>>>to
>>>>>>>>XML output and parsing with Bio::SearchIO::blastxml. There are
>>>>>>>>                
>>>>>>>>
>>>>some
>>>>        
>>>>
>>>>>>>>changes
>>>>>>>>in Bio::Tools::Run::RemoteBlast (bug #1935) that accommodate
>>>>>>>>                
>>>>>>>>
>>>>saving
>>>>        
>>>>
>>>>>>XML
>>>>>>            
>>>>>>
>>>>>>>>output, but I believe it parses everything regardless. If you
>>>>>>>>                
>>>>>>>>
>>>look
>>>      
>>>
>>>>>>back
>>>>>>            
>>>>>>
>>>>>>>>the
>>>>>>>>last month or so there has been a bit of discussion here about
>>>>>>>>                
>>>>>>>>
>>>it.
>>>      
>>>
>>>>>>Jason
>>>>>>            
>>>>>>
>>>>>>>>describes a bit on how to set up RemoteBlast for XML:
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>http://bioperl.org/news/2005/11/06/getting-blastxml-using-
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>remoteblast/
>>>>>>            
>>>>>>
>>>>>>>>>>Christopher Fields
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>Postdoctoral Researcher - Switzer Lab
>>>>>>>>Dept. of Biochemistry
>>>>>>>>University of Illinois Urbana-Champaign
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>-----Original Message-----
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>>>>Sent: Friday, February 03, 2006 1:45 PM
>>>>>>>>>To: bioperl-l at bioperl.org
>>>>>>>>>Subject: [Bioperl-l] more question regarding RemoteBlast.pm
>>>>>>>>>                  
>>>>>>>>>
>>>>version
>>>>        
>>>>
>>>>>>1.28
>>>>>>            
>>>>>>
>>>>>>>>>Hi, Everybody,
>>>>>>>>>I see this post and am wondering if this is the reason for the
>>>>>>>>>malfunctionning of my webserver. We set up a webserver named
>>>>>>>>>                  
>>>>>>>>>
>>>>MAK,
>>>>        
>>>>
>>>>>>for
>>>>>>            
>>>>>>
>>>>>>>>MITE
>>>>>>>>                
>>>>>>>>
>>>>>>>>>sequence analysis. It was working very well until around
>>>>>>>>>                  
>>>>>>>>>
>>>>November
>>>>        
>>>>
>>>>>>2005,
>>>>>>            
>>>>>>
>>>>>>>>>when it stopped returning any result (the site is fine and
>>>>>>>>>                  
>>>>>>>>>
>>>seems
>>>      
>>>
>>>>to
>>>>        
>>>>
>>>>>>be
>>>>>>            
>>>>>>
>>>>>>>>>doing sth after submission). In the CGI script, I used
>>>>>>>>>                  
>>>>>>>>>
>>>>remoteblast
>>>>        
>>>>
>>>>>>(that
>>>>>>            
>>>>>>
>>>>>>>>>work was done in 2003) to do searches. I currently do not have
>>>>>>>>>                  
>>>>>>>>>
>>>>>>access to
>>>>>>            
>>>>>>
>>>>>>>>>the server because I moved. Quite several people sent emails
>>>>>>>>>                  
>>>>>>>>>
>>>to
>>>      
>>>
>>>>us
>>>>        
>>>>
>>>>>>about
>>>>>>            
>>>>>>
>>>>>>>>>its malfunctioning. Is there any suggestion on fixing the
>>>>>>>>>                  
>>>>>>>>>
>>>>problem?
>>>>        
>>>>
>>>>>>>>Should
>>>>>>>>                
>>>>>>>>
>>>>>>>>>I simplily ask the remoteblast.pm be replaced with the new
>>>>>>>>>                  
>>>>>>>>>
>>>>version?
>>>>        
>>>>
>>>>>>>>>Thanks a lot,
>>>>>>>>>Guojun
>>>>>>>>>
>>>>>>>>>Department of Plant Biology
>>>>>>>>>University of Georgia
>>>>>>>>>Tel: 706-542-1857
>>>>>>>>>Fax: 706-542-1805
>>>>>>>>>http://www.arches.uga.edu/~guojun
>>>>>>>>>_____
>>>>>>>>>
>>>>>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>To: 'Nagesh Chakka' [mailto:nagesh.chakka at anu.edu.au], 'Huang
>>>>>>>>>                  
>>>>>>>>>
>>>>Jian'
>>>>        
>>>>
>>>>>>>>>[mailto:hjian at kuicr.kyoto-u.ac.jp], 'bioperl-l'
>>>>>>>>>                  
>>>>>>>>>
>>>[mailto:bioperl-
>>>      
>>>
>>>>>>>>>l at bioperl.org]
>>>>>>>>>Sent: Fri, 03 Feb 2006 10:45:23 -0500
>>>>>>>>>Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
>>>>>>>>>
>>>>>>>>>Like Nagesh says, try the latest RemoteBlast from bioperl-live
>>>>>>>>>                  
>>>>>>>>>
>>>>CVS.
>>>>        
>>>>
>>>>>>It
>>>>>>            
>>>>>>
>>>>>>>>>will
>>>>>>>>>work for saving text output. However, it will not parse
>>>>>>>>>                  
>>>>>>>>>
>>>anything
>>>      
>>>
>>>>>>using
>>>>>>            
>>>>>>
>>>>>>>>>next_result (it will likely hang) and will not save XML
>>>>>>>>>                  
>>>>>>>>>
>>>format.
>>>      
>>>
>>>>See
>>>>        
>>>>
>>>>>>>>these
>>>>>>>>                
>>>>>>>>
>>>>>>>>>bugs:
>>>>>>>>>
>>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1934
>>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1935
>>>>>>>>>
>>>>>>>>>for explanations and possible fixes (changes to RemoteBlast
>>>>>>>>>                  
>>>>>>>>>
>>>and
>>>      
>>>
>>>>>>>>>Bio::SearchIO::blast). Note that these haven't been checked in
>>>>>>>>>                  
>>>>>>>>>
>>>>yet
>>>>        
>>>>
>>>>>>so
>>>>>>            
>>>>>>
>>>>>>>>are
>>>>>>>>                
>>>>>>>>
>>>>>>>>>still not included in bioperl-live; they may be further
>>>>>>>>>                  
>>>>>>>>>
>>>modified
>>>      
>>>
>>>>>>before
>>>>>>            
>>>>>>
>>>>>>>>>committing to CVS. If you're not worried about XML, you could
>>>>>>>>>                  
>>>>>>>>>
>>>>just
>>>>        
>>>>
>>>>>>try
>>>>>>            
>>>>>>
>>>>>>>>the
>>>>>>>>                
>>>>>>>>
>>>>>>>>>first fix, which is a change to SearchIO::blast.
>>>>>>>>>
>>>>>>>>>Nagesh, I remember you posting to the list a month ago using a
>>>>>>>>>                  
>>>>>>>>>
>>>>>>script
>>>>>>            
>>>>>>
>>>>>>>>>which
>>>>>>>>>had problems; the script you used saves the output but doesn't
>>>>>>>>>                  
>>>>>>>>>
>>>>>>actually
>>>>>>            
>>>>>>
>>>>>>>>>parse it (i.e. you don't use next_result() to go through the
>>>>>>>>>                  
>>>>>>>>>
>>>>data).
>>>>        
>>>>
>>>>>>Is
>>>>>>            
>>>>>>
>>>>>>>>the
>>>>>>>>                
>>>>>>>>
>>>>>>>>>version of BLAST in your text output 2.2.12 or 2.2.13? Have
>>>>>>>>>                  
>>>>>>>>>
>>>you
>>>      
>>>
>>>>>>tried
>>>>>>            
>>>>>>
>>>>>>>>>parsing the output using "-readmethod => SearchIO" or "-
>>>>>>>>>                  
>>>>>>>>>
>>>>readmethod
>>>>        
>>>>
>>>>>>=>
>>>>>>            
>>>>>>
>>>>>>>>>blast"
>>>>>>>>>using your version of RemoteBlast and method next_result()?
>>>>>>>>>                  
>>>>>>>>>
>>>Like
>>>      
>>>
>>>>>>below
>>>>>>            
>>>>>>
>>>>>>>>>(from
>>>>>>>>>perldoc):
>>>>>>>>>
>>>>>>>>>while ( my @rids = $factory->each_rid ) {
>>>>>>>>>foreach my $rid ( @rids ) {
>>>>>>>>>my $rc = $factory->retrieve_blast($rid);
>>>>>>>>>if( !ref($rc) ) {
>>>>>>>>>if( $rc < 0 ) {
>>>>>>>>>$factory->remove_rid($rid);
>>>>>>>>>}
>>>>>>>>>print STDERR "." if ( $v > 0 );
>>>>>>>>>sleep 5;
>>>>>>>>>} else { # parsing
>>>>>>>>>starts here
>>>>>>>>>my $result = $rc->next_result(); # it should hang
>>>>>>>>>here
>>>>>>>>>#save the output
>>>>>>>>>my $filename = $result->query_name()."\.out";
>>>>>>>>>$factory->save_output($filename);
>>>>>>>>>$factory->remove_rid($rid);
>>>>>>>>>print "\nQuery Name: ", $result->query_name(), "\n";
>>>>>>>>>while ( my $hit = $result->next_hit ) {
>>>>>>>>>next unless ( $v > 0);
>>>>>>>>>print "\thit name is ", $hit->name, "\n";
>>>>>>>>>while( my $hsp = $hit->next_hsp ) {
>>>>>>>>>print "\t\tscore is ", $hsp->score, "\n";
>>>>>>>>>}
>>>>>>>>>}
>>>>>>>>>}
>>>>>>>>>}
>>>>>>>>>}
>>>>>>>>>}
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>My script hanged if I used next_result() in any way prior to
>>>>>>>>>                  
>>>>>>>>>
>>>the
>>>      
>>>
>>>>>>fixes.
>>>>>>            
>>>>>>
>>>>>>>>I
>>>>>>>>                
>>>>>>>>
>>>>>>>>>want to see how many others are having the same issues with
>>>>>>>>>                  
>>>>>>>>>
>>>>parsing
>>>>        
>>>>
>>>>>>>>using
>>>>>>>>                
>>>>>>>>
>>>>>>>>>the CVS version of bioperl-live.
>>>>>>>>>
>>>>>>>>>Christopher Fields
>>>>>>>>>Postdoctoral Researcher - Switzer Lab
>>>>>>>>>Dept. of Biochemistry
>>>>>>>>>University of Illinois Urbana-Champaign
>>>>>>>>>
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>-----Original Message-----
>>>>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-
>>>>>>>>>>                    
>>>>>>>>>>
>>>l-
>>>      
>>>
>>>>>>>>>>bounces at lists.open-bio.org] On Behalf Of Nagesh Chakka
>>>>>>>>>>Sent: Thursday, February 02, 2006 7:24 PM
>>>>>>>>>>To: Huang Jian; bioperl-l
>>>>>>>>>>Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
>>>>>>>>>>
>>>>>>>>>>Hi Huang,
>>>>>>>>>>Thanks for the message. The older version of RemoteBlast.pm
>>>>>>>>>>                    
>>>>>>>>>>
>>>>works
>>>>        
>>>>
>>>>>>on
>>>>>>            
>>>>>>
>>>>>>>>the
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>logic of checking the temporary file size to determine
>>>>>>>>>>                    
>>>>>>>>>>
>>>whether
>>>      
>>>
>>>>the
>>>>        
>>>>
>>>>>>>>Blast
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>results are ready. This condition is not getting satisfied
>>>>>>>>>>                    
>>>>>>>>>>
>>>may
>>>      
>>>
>>>>be
>>>>        
>>>>
>>>>>>due
>>>>>>            
>>>>>>
>>>>>>>>to
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>some changes brought about by NCBI. I had this problem
>>>>>>>>>>                    
>>>>>>>>>>
>>>>recently
>>>>        
>>>>
>>>>>>and
>>>>>>            
>>>>>>
>>>>>>>>>>figured out that the solution was to use the latest version
>>>>>>>>>>                    
>>>>>>>>>>
>>>>which
>>>>        
>>>>
>>>>>>has
>>>>>>            
>>>>>>
>>>>>>>>>>this problem fixed (does not use file size logic any more)
>>>>>>>>>>                    
>>>>>>>>>>
>>>>which
>>>>        
>>>>
>>>>>>is
>>>>>>            
>>>>>>
>>>>>>>>not
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>yet included in the BioPerl package.
>>>>>>>>>>Cheers
>>>>>>>>>>Nagesh
>>>>>>>>>>
>>>>>>>>>>Huang Jian wrote:
>>>>>>>>>>
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>>>Dear Nagesh,
>>>>>>>>>>>
>>>>>>>>>>>I have replaced my old RemoteBlast.pm (v 1.17) with v 1.28
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>you
>>>>        
>>>>
>>>>>>send
>>>>>>            
>>>>>>
>>>>>>>>>>>me. Now it works perfectly!!!
>>>>>>>>>>>
>>>>>>>>>>>Thank you!!
>>>>>>>>>>>
>>>>>>>>>>>Huang
>>>>>>>>>>>
>>>>>>>>>>>----- Original Message ----- From: "Nagesh Chakka"
>>>>>>>>>>><nagesh.chakka at anu.edu.au>
>>>>>>>>>>>To: "Huang Jian" <hjian at kuicr.kyoto-u.ac.jp>; "bioperl-l"
>>>>>>>>>>><bioperl-l at bioperl.org>
>>>>>>>>>>>Sent: Friday, February 03, 2006 7:48 AM
>>>>>>>>>>>Subject: Re: [Bioperl-l] Sorry, failure in post on the
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>net,
>>>      
>>>
>>>>so
>>>>        
>>>>
>>>>>>still
>>>>>>            
>>>>>>
>>>>>>>>>>>via email
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>>>>>>>>>Hi Huang,
>>>>>>>>>>>>I see that you are submitting a sequence for a remote
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>blast
>>>      
>>>
>>>>>>search.
>>>>>>            
>>>>>>
>>>>>>>>>Can
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>>>you check if the RemoteBlast.pm being used is v 1.28
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>(2005/12/09).
>>>>>>            
>>>>>>
>>>>>>>>If
>>>>>>>>                
>>>>>>>>
>>>>>>>>>>>>not I have attached it with this email, try to replace it
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>with
>>>>        
>>>>
>>>>>>the
>>>>>>            
>>>>>>
>>>>>>>>>old
>>>>>>>>>                  
>>>>>>>>>
>>>>>>>>>>>>one which has a bug.
>>>>>>>>>>>>Let me know if it works.
>>>>>>>>>>>>Nagesh
>>>>>>>>>>>>                        
>>>>>>>>>>>>
>>>>>>>>>>>                      
>>>>>>>>>>>
>>>>>>>>>>_______________________________________________
>>>>>>>>>>Bioperl-l mailing list
>>>>>>>>>>Bioperl-l at lists.open-bio.org
>>>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>                    
>>>>>>>>>>
>>>>>>>>>_______________________________________________
>>>>>>>>>Bioperl-l mailing list
>>>>>>>>>Bioperl-l at lists.open-bio.org
>>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>_______________________________________________
>>>>>>>>>Bioperl-l mailing list
>>>>>>>>>Bioperl-l at lists.open-bio.org
>>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>                  
>>>>>>>>>
>>>>>>_______________________________________________
>>>>>>            
>>>>>>
>>>>>>>>Bioperl-l mailing list
>>>>>>>>Bioperl-l at lists.open-bio.org
>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>
>>>>>>>>_______________________________________________
>>>>>>>>                
>>>>>>>>
>>>>>>Bioperl-l mailing list
>>>>>>Bioperl-l at lists.open-bio.org
>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>
>>>>>>            
>>>>>>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>  
>

Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm



More information about the Bioperl-l mailing list