[Bioperl-l] PAML + Codeml problem..

Johri, Saurabh s.johri at imperial.ac.uk
Mon May 8 11:38:13 EDT 2006


Hi all,
 
I'm trying to use codeml from PAML to estimate Ka, Ks values from
sequences within a multi fasta file:
i'm using the code which has been posted on the bioperl wiki...
 
However, when I run the code, i get the following errors:
 
I did a google search to see if anyone had come across similar
problems.... in which case the problem seems to have been due to the
sequences not being a multiple of 3,
In my code I check if the sequence is a multiple of 3 and if  not, i
alter the sequences until this is the case, although I still have the
same error messages,
 
Any suggestions as to why this could be happening?
 
Thanks!!!
 
Saurabh Johri
Tuberculosis Research Group
Centre for Molecular Microbiology & Infection
Imperial College London
SW7 2AZ

 
 
 
-------------------- WARNING ---------------------
MSG: There was an error - see error_string for the program output
---------------------------------------------------
 
------------- EXCEPTION Bio::Root::NotImplemented -------------
MSG: Unknown format of PAML output
STACK Bio::Tools::Phylo::PAML::_parse_summary
/sw/lib/perl5/5.8.6/Bio/Tools/Phylo/PAML.pm:359
STACK Bio::Tools::Phylo::PAML::next_result
/sw/lib/perl5/5.8.6/Bio/Tools/Phylo/PAML.pm:224
------------------------------------
 
>Rv3923c
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcaccgc
aaataagcccggtgttgcaatcaa
>Rv3923c_mtb_cdc1551
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcac
>Rv3923c_mtb_f11
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcaccgc
aaataagcccggtgttgcaatcaa
>Rv3923c_mtb_c1
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcaccgc
aaataagcccggtgttgcaatcaa
>Rv3923c_mtb_210
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcaccgc
aaataagcccggtgttgcaatcaa
>Rv3923c_mbovis
caccgatcactacctgccagttcgacagccctccgcaagccgcatcgcagttgctgctccaaccgagccgag
gagacatgccggctgctcggcagcgcgcggatcaccacatgatcggacgggtggagttctttgacgatcgac
ccagccacgtgccgcagccgacgtgccacgcggtggcgttccacggccgaccccaccgacttggc
gataatcagtccgacgcgcggcccaccgccactcccacgccaccaataaacgaccatgtcagaccgcacggt
acgcatcccgtgcttcaccgttgtttcaaaatccgctgaccgcctcatgcggttgcgtgcacgaagcaccgc
aaataagcccggtgttgcaatcaa
 
------------------------------------



More information about the Bioperl-l mailing list