[Bioperl-l] Bio::Tools::RestrictionEnzyme

Staffa, Nick (NIH/NIEHS) staffa at niehs.nih.gov
Fri Nov 3 11:29:19 EST 2006


The module Bio::Tools::RestrictionEnzyme
Uses the perl split function to generate the fragments of a digestion,
Using the recognition pattern as the delimiter.  It then glues onto the
resulting strings that part of the pattern representing the sequence before
and after the cut.  This is fine for non-ambiguous patterns, but starts
looking funny for patterns having ambiguities.
Worse that in doing a double digest, one enzyme after another, the ambiguity
code character can mask a true cut site.
I was using BsaHI [GRCGYC] followed by HpaII [CCGG]
Below is the example of the CCGG pattern being masked by a Y
And the different results of the digestion.


CGYCGGCATGTCGATGGTGACCATGTGACAGCACGAGTCACTGCTGCTTTCAAGTTCCGAACAGGAATTAGAAA
As opposed to the real thing:
CGCCGGCATGTCGATGGTGACCATGTGACAGCACGAGTCACTGCTGCTTTCAAGTTCCGAACAGGAATTAGAAA

Which when cut by HpaII [CCGG] really yields
first A_B_frag  :
CGC

Instead of :
 first A_B_frag =
 CGYCGGCATGTCGATGGTGACCATGTGACAGCACGAGTCACTGCTGCTTTCAAGTTCCGAACAGGAATTAGAAAG
ACTTGCTAGTGCTGTTGGGTCTCC
TTGACTCTGAGACAATGATAACAATGTTGAAGGTGGTCTAGGCATTTGGGTGCTGTGGAGTTATAAAGAGGAAAAG
AAAAGATAAAACAAAAAAAAATAG
GAAACAAATGATTAAGCCACTACTAAGGGGTCTAGTCTAATGCCAACTGGGTAAATTCATGGGAACAATGTGTGCC
AGTCTTTAGAAACACTGTTTCATA
TTGCATATATTATGGCATGGTATTACATTGATTAATTTTACTTTAGAGATGAAGAAGCTGAGATTTGGGGTGAATA
GCAATTATCCCAAAGTCTCTCAGA
TAGCTGGAGGCAGCAGGGTCTGGGGTATTCACAGTCCCTACTCCATATTGTGTGGTCAGAACCAAATGAGACAGAT
AAAGGGCAGACAAAAGAGAAAGTG
GGGAGTATGATTTGAAAATGATGGTGTGACCCAGATTTCTGATGGAAATATCTAATGGCTGCAGACTGGATAGCTG
TGACCATTTTAGTTACTGAATTCA
GGAGATCTTATCTCAATGGAGGCATGTTGTCAACCAAAAGCCAGGATAAGCAAGGGTCAGTGTCTAGACATTGGAG
TAAGGTTTGCCTGGATATTTCCAC
AGGGAACCAAGTGTCATGGAGTCTTATTCATTGGGAGGTTATCTTTGTTACACACATGGACATATCATCAAGCCAG
CAATTCAGCAAAACTGTCAACACA
CAAATAGAGATGTATTGACAACGGGGAACCACAAGTCATGCTTATTCCAAGCTAAAGCCCTCATGTGGAACTTGTT
TTGTATGGCATTTGTCTCATCTAC
ACATTGATGGGAAGGGTAAAAGGAAGTCTTTGGTGGGATTACAGAAGTCAGTAAAAAAGCAAAAGGAAAGATTTAG
AAAACAAAGAAAAAGAAAAGGGAG
GAAAGGAAAAGAAAAAAGATTTCAGAGATCTCAACATCAATTCAGACCAAGGGTGCCTCTTATACTATGTCCAAGC
CAGTAAGTGGGGTTGTTCTTGTTA
ACTACAGCCATGTATAGAGGTGAACTTCAGGCTCCTGACTGATCCTCTGAGGTAGAAAGTAAACAGTACTCTTATG
ACACACGCAGTTGTTCAGTGCTGA
CATGAAAATGTCATTGCTTACAGCGCTAGGAGAC


This subroutine yields, I believe, the true sequence,
Although I don't know how efficient it is.
I'm thinking it must be more efficient than having to turn each fragment
from the first digestion into a BioPerl Sequence Object before applying the
cut_seq method.

sub cut_seq {
my $number= 0;
my @frags = ();
my $bigline = shift @_;
my $recognition_site = shift @_;
my $cutsite = shift @_;
 my $pat = &expanded_string($recognition_site);
while ($bigline){
#my $offset = index $bigline, $pat;
if ($bigline =~/($pat)/){
my $first = substr $&,0,$cutsite;
my $last = substr $&,$cutsite;
my $frag = $`.$first;
push @frags, $frag;
$number++;
#print "fragment # $number:\n$frag\n";
my $rest_of_bigline = $last.$';
$bigline = $rest_of_bigline;}
else {push @frags, $bigline;    #Last one
$number++;
#print "fragment # $number:\n$bigline\n";
$bigline = "";}
}
return @frags;
}




Nick Staffa 
Telephone: 919-316-4569  (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: Jack L. Field( field1 at niehs.nih.gov )
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina




More information about the Bioperl-l mailing list