[Bioperl-l] dbSNP

Marian Thieme marian.thieme at lycos.de
Tue Feb 6 08:52:10 EST 2007


Hello all,

I looked for a method/class/function/script in the docuementation which
provides the opportunity to generate a snp assay suited to submit to
dbSNP (http://www.ncbi.nlm.nih.gov/projects/SNP/
http://www.ncbi.nlm.nih.gov/projects/SNP/how_to_submit.html)
I didnt find those code, but I recognized that there is at least a xml
parser to read dbSNP reports.

Does anybody know if there is also an output class to generate dbSNP
reports ? I could imagine, that at least the snp assay section is worth
to be implemented.

This example is given by ncbi:


TYPE:SNPASSAY
HANDLE:WI
BATCH: 1.98
MOLTYPE:Genomic
METHOD:RESEQ
SYN NAMES:WI-SNP,DnaId,MapDna
COMMENT:
Here is where some public comment that applies to the entire
batch of SNPS could be put.
PRIVATE:
Here is where a note to NCBI regarding processing that would
not be seen by the outside, could be put.
Note that these are is not exactly real SNPs, as
the data were modified.
||
SNP:WI|WIAF-1234567
SYNONYM:EST4291092,EST8291092,EST7291092
ACCESSION:H30533
LENGTH:101
5'_ASSAY:GGCAGGGAAGGAAAATCCTAGGGNCAGCATTGGGGAGGGGGGGACTCTG
OBSERVED:C/T
3'_ASSAY:TAAATTTATTGGGCAACAGGCTGCAGGTGAGGGGGCTGACAGGAGGAGGGA
||
SNP:WI|WIAF-1722
SYNONYM:STS-T17494,STS-T17494,STS-T17494
ACCESSION:T17494
LENGTH:269
5'_FLANK:CTTTCCCTCATCCCCTCTTCCACCACACCATCCCGGAACAAGTGCTCCAGGATT
5'_ASSAY:CCCTGCCCACTGGCCATTTTGGAGTGTGTCC
OBSERVED:A/T
3'_ASSAY:GTGGGTAGCAATGTGGAAACCACCAGGGCCTTTGTGGAGAAAA
3'_FLANK:TGGAGGGGGTTGAGGGAGTCCCAGGAGGGGCTTATTTGAGGGCCTTTGCCACTT
    GCTCATAGGCGAGCTCGATCTCCTCATCATCTGGACAGGTGGAAGCGAATTCTT
    CCCGGGCGTAGGCATTGCTCAAGTACCGAT
||




Regards,
Marian

P.S. this is not in contradiction to my first request about the brackets 
notation. We need both formats.




More information about the Bioperl-l mailing list