[Bioperl-l] non-palindromic issue in Bio::Restriction::Analysis

Apurva Narechania apurva at cshl.edu
Wed Jun 6 19:51:45 EDT 2007


Hi,

I was hoping you could confirm and give me some feedback on an issue  
I think I've found with the Bio::Restriction::Analysis module. I am  
using the enzyme AciI, a non-palindromic restriction enzyme with a 5'  
C | CGC 3' recognition site. The module should search both the  
forward and the reverse complement strings in the case of a non- 
palindromic enzyme. I have found that the this works only  
intermittently. For example, the following sequence:

GAAAAAAACAAAGGAAGAAGCTAGCTAGCAGGGCACGCGGTTTGAGGATGGCTGGTGGCCGACCGCAGGGCG 
CGCGGTTG
GAGGATTGCTGGTGGCCGACCAGATGAAACTCACGCGCGGCTGGGGACAGCTGGAATATTTGGGCGGCGGCG 
GCTGGTAT
TACGGGAAAGGAGAGATAGGGTTTTGGACGGCAGCAGCTGGTATTTGGGCCACCAATTTTGCGCGCCAGTAC 
AGGACACC
GATGCCGCAAATTGCACAATGCCTTTTATGGCGACTGACAGTGCGATGCTATAGGTATGAATTGTCGACTGA 
CAAAGTGA
CACTATTCACATATAAATATAACGAATAACACTCAGTTGGAATATAGACATATGCCGACTCACCATCTGTGG 
CAATGTAT
ACCGACTAACAATTCGATGCTAATTCTCTATTTATAGCGACAGTCGTCAGACACTAATTTGGTGTTGTGGTA 
TAATGCTA
GTGCCTCACCGCTGTAGGTGTTGGTCTACTGGTGC

Should digest into 10 fragments using this enzyme, but the module  
produces only 7. Could you please confirm this behavior, and if  
observed, suggest some possible fixes? This may be a bug in the  
_non_pal_enz method, or may be me overlooking something pretty obvious.

Thanks,
Apurva Narechania.



More information about the Bioperl-l mailing list