[Bioperl-l] problem parsing WU-blast output

Joseph Fass joseph.fass at gmail.com
Wed Oct 24 17:43:08 EDT 2007


Hi Dave,

here's my code, followed by a sample wu-blast report (below).
I'm using bioperl version 1.4
Thanks for looking into it, and I'd be very curious to know what you find.

Joe



***************code***************
#!/usr/bin/perl -w

use strict;
use Bio::SearchIO;
use Bio::SeqIO;

# note: processes only the first result (first query sequence) of the blast
report!

my $usage = "usage: collect_hits.pl <blast report> <sequence database
(fasta)> <output_file>\n";
my $reportfile = shift || die $usage;
# open Blast report for reading in hit IDs
my $in  = Bio::SearchIO->new(-file => $reportfile,
                             -format => 'blast');

# open database (fasta format) for searching for hit IDs
my $databasefile = shift || die $usage;

# open output file (fasta format) for writing out IDs and sequences of Blast
hits
my $hitsfile = shift || die $usage;
my $out = Bio::SeqIO->new(-file => ">$hitsfile",
                          -format => 'fasta');

# get result from Blast report (only one!)
my $result = $in->next_result(); print "query: " .
$result->query_name()."\n";
#my $dummy = $result->next_hit; print "1st hit: " . $dummy->name() . "\n"; #
for debugging
#$dummy = $result->next_hit; print "2nd hit: " . $dummy->name() . "\n"; #
debugging
# then loop through hits, finding matching IDs in database and writing out
full fasta-format sequences
while (my $hit = $result->next_hit) {
  # find hit ID in database file to fill in sequence and write corresponding
sequence to output file
  my $seq = Bio::Seq->new( -id => $hit->name() ); # create Seq object with
hit name
  print "seq_id: " . $seq->id."\n";
  # open database file
  my $db = Bio::SeqIO->new(-file => $databasefile,
               -format => 'fasta');
  # now look through database sequences to pull out correct sequence for ID
from Blast hit
  my $still_looking = 1;
  do {
    my $db_seq = $db->next_seq();
    #print $seq->id() . " ... " . $db_seq->id() . "\n";
    if ($seq->id() eq $db_seq->id()) {
      $seq->seq($db_seq->seq);
      $still_looking = 0;
    } # if
  } while ($still_looking);
  # then write sequence (in fasta format) to output_file
  $out->write_seq($seq);
  print "found a sequence\n";
} # while







********************blast report*************************

BLASTN 2.0MP-WashU [04-May-2006] [linux26-x64-I32LPF64 2006-05-10T17:22:28]

Copyright (C) 1996-2006 Washington University, Saint Louis, Missouri USA.
All Rights Reserved.

Reference:  Gish, W. (1996-2006) http://blast.wustl.edu

Notice:  this program and its default parameter settings are optimized to
find
nearly identical sequences rapidly.  To identify weak protein similarities
encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  962_177_14574088_5489_46110_045.ab1
        (676 letters)
>Unfiltered+1
TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC
AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
CCCAACAATCCTACTT
>Unfiltered-1
AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
TCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAGCATGG
CCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATGGCTTTC
CCTGTAATTAACAAATTGATTACCATTAGGAGAAGCAAGTGTGATGATGTCGAGTGAGAG
TAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGGAAATCGGCATCAGCATGT
TTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAACACGGTAGTTTTCAAGA
TTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCGAAGGTGACCATATTTG
TTGCTGAATAGAGTGTGGAACCTGTCGGAGCTGAAGTAGAAGGGGTTGTTTTGTGTTCTT
GAATCAGACTCTTCCTGGCTCTCATGGTGCTGCTGCCGGTGTACAATGCCAAAGGAGACA
GAAAGTGATGCCAGGA

Database:  ../Cowpea1X/Cowpea_all_GSS_clean.fasta
           260,642 sequences; 158,813,828 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done


Smallest
                                                                       Sum
                                                              High
Expectation
Sequences producing High-scoring Segment Pairs:              Score
E(N)      N

962_177_14574088_5489_46110_045.ab1                           3380  2.0e-147
1
962_191_14579666_5489_46288_070.ab1                           2705  6.4e-117
1
962_307_14625348_5489_47135_029.ab1                           2314  2.8e-99
1
962_370_14650238_5489_47797_032.ab1                           2054  1.8e-87
1
962_400_14670294_5489_48184_096.ab1                           2040  7.2e-87
1
962_79_14536329_16654_45346_033.ab1                           1928  7.8e-82
1
962_187_14578095_5489_46263_022.ab1                           1764  2.3e-74
1
962_309_14626130_16654_47155_078.ab1                          1263  1.1e-51
1
962_45_14523164_5489_45006_087.ab1                            1160  3.7e-47
1
962_394_14659720_16654_47971_045.ab1                          1146  1.6e-46
1
962_61_14529390_16654_45210_020.ab1                           1077  2.1e-43
1
962_177_14574088_16654_46114_045.ab1                           955  7.5e-38
1
962_282_14615493_16654_46934_055.ab1                           891  1.3e-34
1
962_248_14601477_16654_46676_055.ab1                           687  1.0e-25
1
962_196_14581545_16654_48111_005.ab1                           633  3.0e-23
1


>962_177_14574088_5489_46110_045.ab1
        Length = 676

  Plus Strand HSPs:

 Score = 3380 (513.2 bits), Expect = 2.0e-147, P = 2.0e-147
 Identities = 676/676 (100%), Positives = 676/676 (100%), Strand = Plus /
Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
120

Query:   121 ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
180

Query:   181 CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
240

Query:   241 CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
300

Query:   301 AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
360

Query:   361 ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
420

Query:   421 TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
480

Query:   481 ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
540

Query:   541 ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
600

Query:   601 GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   601 GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
660

Query:   661 CCCAACAATCCTACTT 676
             ||||||||||||||||
Sbjct:   661 CCCAACAATCCTACTT 676


>962_191_14579666_5489_46288_070.ab1
        Length = 664

  Plus Strand HSPs:

 Score = 2705 (411.9 bits), Expect = 6.4e-117, P = 6.4e-117
 Identities = 541/541 (100%), Positives = 541/541 (100%), Strand = Plus /
Plus

Query:   136 ACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTCAGA
195
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 ACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTCAGA 60

Query:   196 ATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTCCTA
255
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTCCTA
120

Query:   256 AACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATCACT
315
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 AACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATCACT
180

Query:   316 ACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCAATTTGTTAATTACAG
375
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCAATTTGTTAATTACAG
240

Query:   376 GGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAG
435
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 GGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAG
300

Query:   436 GCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACG
495
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 GCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACG
360

Query:   496 AGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAG
555
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 AGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAG
420

Query:   556 CGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAA
615
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 CGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAA
480

Query:   616 ATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACT
675
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 ATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACT
540

Query:   676 T 676
             |
Sbjct:   541 T 541


>962_307_14625348_5489_47135_029.ab1
        Length = 687

  Minus Strand HSPs:

 Score = 2314 (353.2 bits), Expect = 2.8e-99, P = 2.8e-99
 Identities = 558/629 (88%), Positives = 558/629 (88%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTA-
618
             ||||||||||||||||||||||||||||| ||||||||||||| |||  ||||||||||
Sbjct:    72 AAGTAGGATTGTTGGGCTTCTGTGCTAGATAGGAAAAAGTCCTACAGGCCAAGCATTTAT
131

Query:   617 -ATTT-A-GAGA-GAAA---TTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGA
565
              || | | | || ||||   || ||||||||||||||||||  | |||||| |     ||
Sbjct:   132 CATCTCATGTGAAGAAAAATTTACAAGTTAGAATAAAAAAAAAT-TAGTTC-G-----GA
184

Query:   564 AAAAAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTC
505
             ||  ||    |||||||||||||||||| |||||||| |||| ||||||||||| |||||
Sbjct:   185 AAGCAG----TACTTGAAATCTGTGAGGATTGTTAACGGGTACGGCGAGTTTGACTATTC
240

Query:   504 TGAGATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCT
445
             ||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TGAGATTCTCGTTGTCGTCAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCT
300

Query:   444 GAGCATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTA
385
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct:   301 GAGCATGGCCTTGCTCAAGAATGTAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTA
360

Query:   384 TGGCTTTCCCTGTAATTAACAAATTGATTAC---CA-T--T--AGGAGAAGCAAGTGTGA
333
             ||||| |||||||||||||||||||||||||   || |  |  |||||||||||||||||
Sbjct:   361 TGGCTCTCCCTGTAATTAACAAATTGATTACAATCAATGGTGCAGGAGAAGCAAGTGTGA
420

Query:   332 TGATGTCGAGTGAGAGTAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGGAA
273
             |||| | |||||||  ||| ||||||||||||||||||||||||||||||| ||||||||
Sbjct:   421 TGATTTTGAGTGAG--TAGCGATTAGTTGATTACTTACCATTAAGGACAACTAGGAGGAA
478

Query:   272 ATCGGCATCAGCATGTTTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAAC
213
             ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct:   479 ATCGGCATCAGCATGGTGAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAAC
538

Query:   212 ACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCG
153
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||
Sbjct:   539 ACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTCTGGAGGACACG
598

Query:   152 AAGGTGACCATATTTGTTGCTGAATAGAGTGTGGAACC---TGTCGGAGCTGAAGTAGAA 96
             |||||||||||||| ||| |||||||||||||||||||   |||| |||  |||||||||
Sbjct:   599 AAGGTGACCATATTGGTTTCTGAATAGAGTGTGGAACCACCTGTCAGAGTCGAAGTAGAA
658

Query:    95 GGGGTTGTTTTGTGTTCTTGAATCAGACT 67
             |||||| ||||||  |||||| ||  |||
Sbjct:   659 GGGGTTATTTTGTCCTCTTGATTCCAACT 687


>962_370_14650238_5489_47797_032.ab1
        Length = 581

  Plus Strand HSPs:

 Score = 2054 (314.2 bits), Expect = 1.8e-87, P = 1.8e-87
 Identities = 468/514 (91%), Positives = 468/514 (91%), Strand = Plus / Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             |||| |||||||||||||||||||| ||||||||||||||| |  | ||||| |||||||
Sbjct:    74 TCCTTGCATCACTTTCTGTCTCCTTCGGCATTGTACACCGGGA--A-CACCAAGAGAGCC
130

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGT--T
118
             | |||||||| || ||||||  |||||| |||||||||||||||  ||| |||||||  |
Sbjct:   131 AAGAAGAGTCGGAATCAAGAGGACAAAATAACCCCTTCTACTTCGACTCTGACAGGTGGT
190

Query:   119 -CCACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAAC
177
              ||||||||||||||| ||| |||||||||||||||| |||||||| |||||||||||||
Sbjct:   191 TCCACACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAAC
250

Query:   178 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   251 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
310

Query:   238 ACACCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTA
297
             ||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||
Sbjct:   311 ACACCCTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTA
370

Query:   298 AGTAATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCT--A--AT-
352
             ||||||||||||||| ||||||  |||| | |||||||||||||||||||||  |  ||
Sbjct:   371 AGTAATCAACTAATCGCTACTC--ACTCAAAATCATCACACTTGCTTCTCCTGCACCATT
428

Query:   353 G---GTAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGG
409
             |   ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct:   429 GATTGTAATCAATTTGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGACGG
488

Query:   410 CAGAGACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTT
469
             ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct:   489 CAGAGACTCCTACATTCTTGAGCAGGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTT
548

Query:   470 CTTTTTGGTTAACCCTAATGAAAACGAGAATCTC 503
             ||||||||| |||||| | || ||||||||||||
Sbjct:   549 CTTTTTGGT-AACCCTGACGACAACGAGAATCTC 581


>962_400_14670294_5489_48184_096.ab1
        Length = 641

  Plus Strand HSPs:

 Score = 2040 (312.1 bits), Expect = 7.2e-87, P = 7.2e-87
 Identities = 488/564 (86%), Positives = 488/564 (86%), Strand = Plus / Plus

Query:   123 ACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCC
182
             ||||||||||| ||| |||||||||||||||| |||||||| ||||||||||||||||||
Sbjct:     1 ACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAACGCTCC 60

Query:   183 AAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACC
242
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACC
120

Query:   243 CTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAA
302
             |||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct:   121 CTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTAAGTAA
180

Query:   303 TCAACTAATCACTACTCTCACTCGA-CATCATCACA--CTTGCTTCT-C-CTAATG---G
354
             |||||||||| |||||| | | | | ||||| |||   ||| || || | | | ||   |
Sbjct:   181 TCAACTAATCGCTACTCACTCACAATCATCA-CACTTTCTTTCTCCTGCACCATTGATTG
239

Query:   355 TAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAG
414
             ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct:   240 TAATCAATTCGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGACGGCAGAG
299

Query:   415 ACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTT
474
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   300 ACTCCTACATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTT
359

Query:   475 TGGTTAACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACA
534
             ||||||||||| | || |||||||||||||||||| |||||||||||||||| |||||||
Sbjct:   360 TGGTTAACCCTGACGACAACGAGAATCTCAGAATAGTCAAACTCGCCATACCCGTTAACA
419

Query:   535 ACCCTCACAGATTTCAAGTAGCGCCTTTTTT-CTGATCCTGAACTATAACTTTTTTTATT
593
             | ||||||||||||||||||  |||||     || ||  |    | |  ||| |   ||
Sbjct:   420 ATCCTCACAGATTTCAAGTACTGCCTTCCGAACTAATTTTTT--T-TCCCTTCTAACATG
476

Query:   594 CTAACTTGCAATTTCTCTCTAAAT-TAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAG
652
             | |  || |     || | | |   ||||||||||  ||| ||||||||||||| |||||
Sbjct:   477 CGATTTTTCTCCA-CT-TGTGATGATAAATGCTTGGCCTGTAGGACTTTTTCCTATCTAG
534

Query:   653 CACAGAAGCCCAACAATCCTACTT 676
             ||||||||||||||||||||||||
Sbjct:   535 CACAGAAGCCCAACAATCCTACTT 558


>962_79_14536329_16654_45346_033.ab1
        Length = 675

  Plus Strand HSPs:

 Score = 1928 (295.3 bits), Expect = 7.8e-82, P = 7.8e-82
 Identities = 472/553 (85%), Positives = 472/553 (85%), Strand = Plus / Plus

Query:    77 AAGAA-CACAAAACAACCCCTTCTACTTCAGCTCCGACA-G-G-TTCCACACTCTATTCA
132
             ||||  || || |||||||||||||||||| |||||||| | | ||||||||||||| ||
Sbjct:     6 AAGAGTCAGAAGACAACCCCTTCTACTTCAACTCCGACAAGTGGTTCCACACTCTATACA 65

Query:   133 GCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTC
192
             | ||| |||||||||||||||| || ||||| |||||||||||||||||| |||||||||
Sbjct:    66 GAAACCAATATGGTCACCTTCGTGTGCTCCAGAGGTTCGACCAACGCTCCGAACAAATTC
125

Query:   193 AGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTC
252
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct:   126 AGAATCTTGAAAACTACCGTCTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTC
185

Query:   253 CTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATC
312
             || | || |||||||||||||| |||||  |||||||||| |||||||||| |||||||
Sbjct:   186 CTCACCACGCTGATGCCGATTTGCTCCTATTTGTCCTTAACGGTAAGTAATAAACTAATA
245

Query:   313 ACTACTC-TCACTCGACATCATCACACTTGCTTCTCCT-AA---TGGTA---ATCAATTT
364
             |   ||  | ||  || | | ||| | ||||||||||  ||   || ||   ||||| ||
Sbjct:   246 ATCGCTAGTAACA-GA-A-CTTCATATTTGCTTCTCCGCAAAAATGATAGTGATCAAGTT
302

Query:   365 GTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCAT
424
             ||||||||||||   | || || |||| |||||||||||||| |||||||| |||| |||
Sbjct:   303 GTTAATTACAGGTGGACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACAT
362

Query:   425 TCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
484
             ||||||||||||| |||| ||||| |||||||||||||||| |||||||||| |||||||
Sbjct:   363 TCTTGAGCAAGGCGATGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCC
422

Query:   485 TAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAG
544
             | | || |||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct:   423 TGACGACAACGAGGATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACAT
482

Query:   545 ATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAA
604
             ||||||||||  |||||||  ||||| |  ||||| | |||||||| || |||||||||
Sbjct:   483 ATTTCAAGTACTGCCTTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCAT
539

Query:   605 TTTCTCTCTAAAT 617
             |||||||||||||
Sbjct:   540 TTTCTCTCTAAAT 552

 Score = 1188 (184.3 bits), Expect = 2.1e-48, P = 2.1e-48
 Identities = 358/471 (76%), Positives = 358/471 (76%), Strand = Plus / Plus

Query:   220 AGTTCAAGTCCAAACCCAACACCCTCCTTCTTC-CTAAACATGCTGATGCCGATTTCCTC
278
             ||| |||  ||||  ||  | || || ||| || | |  | || ||  |      ||||
Sbjct:   159 AGTCCAAACCCAACACC--CTCCTTC-TTCCTCACCACGC-TGATGCCGATTTGCTCCTA
214

Query:   279 CTTGTTGTCCTTAATG-GTAAGTAATCAACTAATCACTACTCTCACTCGACATCATCACA
337
              ||||  |      |  |||| ||| | | ||||| ||| |  ||    || ||||
Sbjct:   215 TTTGTCCTTAACGGTAAGTAA-TAAACTAATAATCGCTAGTAACAGA--ACTTCATATTT
271

Query:   338 -CTTGCTTCTCCTAA-TGGTA---ATCAATTTGTTAATTACAGGGAAAGCCATACTCACC
392
              ||| || | |  || || ||   ||||| ||||||||||||||   | || || ||||
Sbjct:   272 GCTT-CTCCGCAAAAATGATAGTGATCAAGTTGTTAATTACAGGTGGACCCGTAATCACA
330

Query:   393 TTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATC
452
             |||||||||||||| |||||||| |||| |||||||||||||||| |||| ||||| |||
Sbjct:   331 TTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAGCAAGGCGATGCCCAGAAAATC
390

Query:   453 CCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACGAGAATCTCAGAATAATC
512
             ||||||||||||| |||||||||| |||||||| | || |||||| ||||||||||||||
Sbjct:   391 CCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGACAACGAGGATCTCAGAATAATC
450

Query:   513 AAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAGCGCCTTTTTTCTGATCC
572
             |||||||||||||| |||||||||||||||| ||||||||||  |||||||  ||||| |
Sbjct:   451 AAACTCGCCATACCCGTTAACAACCCTCACATATTTCAAGTACTGCCTTTT--CTGATTC
508

Query:   573 TGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAAAT-T----A-AA-TGCT
625
               ||||| | |||||||| || ||||||||| ||||||||||||| |    | || || |
Sbjct:   509 CCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCTCTAAATGTGACGATAAATGTT
567

Query:   626 TGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACTT 676
             ||  ||| ||||||||||| | |||||||||||||||||||| ||||||||
Sbjct:   568 TGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCAACAGTCCTACTT 618


>962_187_14578095_5489_46263_022.ab1
        Length = 590

  Plus Strand HSPs:

 Score = 1764 (270.7 bits), Expect = 2.3e-74, P = 2.3e-74
 Identities = 410/453 (90%), Positives = 410/453 (90%), Strand = Plus / Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             ||||||||||||||||||||||||| |||||||||||||||  | ||||||| |||||||
Sbjct:   144 TCCTGGCATCACTTTCTGTCTCCTTCGGCATTGTACACCGG--G-AGCACCAAGAGAGCC
200

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGT--T
118
             | |||||||| ||  |||||  |||||| |||||||||||||||  ||| |||||||  |
Sbjct:   201 AAGAAGAGTCGGAACCAAGAGGACAAAATAACCCCTTCTACTTCGACTCTGACAGGTGGT
260

Query:   119 -CCACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAAC
177
              ||||||||||||||| ||| |||||||||||||||| |||||||| |||||||||||||
Sbjct:   261 TCCACACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAAC
320

Query:   178 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   321 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
380

Query:   238 ACACCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTA
297
             ||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||
Sbjct:   381 ACACCCTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTA
440

Query:   298 AGTAATCAACTAATCACTACTCTCACTCGACA-TCATCACACTTGCTT-CTCCT--A--A
351
             ||||||||||||||| ||||||  |||| ||| ||||||||||| ||| |||||  |  |
Sbjct:   441 AGTAATCAACTAATCGCTACTC--ACTC-ACAATCATCACACTTTCTTTCTCCTGCACCA
497

Query:   352 T-G---GTAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGAC
407
             | |   |||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct:   498 TTGATTGTAATCAATTCGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGAC
557

Query:   408 GGCAGAGACTCCTTCATTCTTGAGCAAGGCCAT 440
             ||||||||||||| |||||||||||||||||||
Sbjct:   558 GGCAGAGACTCCTACATTCTTGAGCAAGGCCAT 590


>962_309_14626130_16654_47155_078.ab1
        Length = 531

  Plus Strand HSPs:

 Score = 1263 (195.6 bits), Expect = 1.1e-51, P = 1.1e-51
 Identities = 281/312 (90%), Positives = 281/312 (90%), Strand = Plus / Plus

Query:   365 GTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCAT
424
             |||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct:     1 GTTAATTACAGGAAGAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCATTCAT 60

Query:   425 TCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
484
             ||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCTTGAGCAAGGCCATGTTCAAAGGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
120

Query:   485 TAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAG
544
             ||| || ||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct:   121 TAACGACAACGACAATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACAA
180

Query:   545 ATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAA
604
             ||||||||||  ||||| | |  ||| |   ||||||||| ||||||||||||||| |||
Sbjct:   181 ATTTCAAGTACTGCCTTCTGT--GATTCCATACTATAACTGTTTTTATTCTAACTTTCAA
238

Query:   605 TTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCA
664
             ||||||||||||| ||||| || | ||| ||||||||||||| |||||||||||||| ||
Sbjct:   239 TTTCTCTCTAAAT-AAATGTTTCTCCTGTAGGACTTTTTCCTATCTAGCACAGAAGCTCA
297

Query:   665 ACAATCCTACTT 676
              |||||||||||
Sbjct:   298 GCAATCCTACTT 309


>962_45_14523164_5489_45006_087.ab1
        Length = 697

  Plus Strand HSPs:

 Score = 1160 (180.1 bits), Expect = 3.7e-47, P = 3.7e-47
 Identities = 302/364 (82%), Positives = 302/364 (82%), Strand = Plus / Plus

Query:   327 ACATCATCACACTTGCTTCTCCT-AA---TGGTA---ATCAATTTGTTAATTACAGGGAA
379
             | | | ||| | ||||||||||  ||   || ||   ||||| ||||||||||||||
Sbjct:    13 AGAACTTCATATTTGCTTCTCCGCAAAAATGATAGTGATCAAGTTGTTAATTACAGGTGG 72

Query:   380 AGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAGGCCA
439
             | || || |||| |||||||||||||| |||||||| |||| |||||||||||||||| |
Sbjct:    73 ACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAGCAAGGCGA
132

Query:   440 TGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACGAGAA
499
             ||| ||||| |||||||||||||||| |||||||||| |||||||| | || |||||| |
Sbjct:   133 TGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGACAACGAGGA
192

Query:   500 TCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAGCGCC
559
             ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||  |||
Sbjct:   193 TCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACATATTTCAAGTACTGCC
252

Query:   560 TTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAAAT-T
618
             ||||  ||||| |  ||||| | |||||||| || ||||||||| ||||||||||||| |
Sbjct:   253 TTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCTCTAAATGT
309

Query:   619 -A--A--A-TGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCT
672
              |  |  | || |||  ||| ||||||||||| | |||||||||||||||||||| ||||
Sbjct:   310 GACGATAAATGTTTGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCAACAGTCCT
369

Query:   673 ACTT 676
             ||||
Sbjct:   370 ACTT 373


>962_394_14659720_16654_47971_045.ab1
        Length = 708

  Minus Strand HSPs:

 Score = 1146 (178.0 bits), Expect = 1.6e-46, P = 1.6e-46
 Identities = 284/333 (85%), Positives = 284/333 (85%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTA-
618
             ||||||||||||||||||||||||||||| ||||||||||||| |||  ||||||||||
Sbjct:   374 AAGTAGGATTGTTGGGCTTCTGTGCTAGATAGGAAAAAGTCCTACAGGCCAAGCATTTAT
433

Query:   617 -ATTTAGAGAGAAATTGCAAGTTAGAA-T-A-AA-AAAAGTTATAGTTCAGGATCAGAAA
563
              || |   | |||     || ||| || | | || ||||   | |  | ||  || ||||
Sbjct:   434 CATCTCATGTGAAGAAA-AATTTACAAGTTAGAATAAAAAAAAAAAAT-AGT-TCGGAAA
490

Query:   562 AAAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTG
503
               ||    ||||||||||||||||||||||||||| |||| ||||||||||| |||||||
Sbjct:   491 GCAG----TACTTGAAATCTGTGAGGGTTGTTAACGGGTACGGCGAGTTTGACTATTCTG
546

Query:   502 AGATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGA
443
             ||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||
Sbjct:   547 AGATTCTCGTTGTCGTCAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGA
606

Query:   442 GCATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATG
383
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct:   607 GCATGGCCTTGCTCAAGAATGTAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATG
666

Query:   382 GCTTTCCCTGTAATTAACAAATTGATTACCATT 350
             ||| |||||||||||||| |||||||||| | |
Sbjct:   667 GCTCTCCCTGTAATTAACGAATTGATTACAAAT 699


>962_61_14529390_16654_45210_020.ab1
        Length = 696

  Plus Strand HSPs:

 Score = 1077 (167.6 bits), Expect = 2.1e-43, P = 2.1e-43
 Identities = 265/312 (84%), Positives = 265/312 (84%), Strand = Plus / Plus

Query:   372 ACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAG
431
             |||||   | || || |||| |||||||||||||| |||||||| |||| ||||||||||
Sbjct:     1 ACAGGTGGACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAG 60

Query:   432 CAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAA
491
             |||||| |||| ||||| |||||||||||||||| |||||||||| |||||||| | ||
Sbjct:    61 CAAGGCGATGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGAC
120

Query:   492 AACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAA
551
             |||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||
Sbjct:   121 AACGAGGATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACATATTTCAA
180

Query:   552 GTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCT
611
             |||  |||||||  ||||| |  ||||| | |||||||| || ||||||||| |||||||
Sbjct:   181 GTACTGCCTTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCT
237

Query:   612 CTAAAT-T-A--A--A-TGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCA
664
             |||||| | |  |  | || |||  ||| ||||||||||| | |||||||||||||||||
Sbjct:   238 CTAAATGTGACGATAAATGTTTGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCA
297

Query:   665 ACAATCCTACTT 676
             ||| ||||||||
Sbjct:   298 ACAGTCCTACTT 309


>962_177_14574088_16654_46114_045.ab1
        Length = 625

  Minus Strand HSPs:

 Score = 955 (149.3 bits), Expect = 7.5e-38, P = 7.5e-38
 Identities = 191/191 (100%), Positives = 191/191 (100%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
617
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   435 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
494

Query:   616 TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
557
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   495 TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
554

Query:   556 GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
497
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   555 GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
614

Query:   496 TCGTTTTCATT 486
             |||||||||||
Sbjct:   615 TCGTTTTCATT 625


>962_282_14615493_16654_46934_055.ab1
        Length = 274

  Minus Strand HSPs:

 Score = 891 (139.7 bits), Expect = 1.3e-34, P = 1.3e-34
 Identities = 191/207 (92%), Positives = 191/207 (92%), Strand = Minus /
Plus

Query:   561 AAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGA
502
             |||||  |||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct:    68 AAGGCAGTACTTGAAATCTGTGAGGATTGTTAACGGGTATGGCGAGTTTGACTATTCTGA
127

Query:   501 GATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAG
442
             |||||||||| || |  |||||||||||||||||||||||||||||||||||||||||||
Sbjct:   128 GATTCTCGTTGTCGTCTGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAG
187

Query:   441 CATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATGG
382
             ||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||
Sbjct:   188 CATGGCCTTGCTCAATAATGTAGGAGTCTCTGCCGTCAGGGTTCCCCAAGGTGAGTATGG
247

Query:   381 CTTTCCCTGTAATTAACAAATTGATTA 355
             || |||||| ||||||| | |||||||
Sbjct:   248 CTCTCCCTGCAATTAACGATTTGATTA 274


>962_248_14601477_16654_46676_055.ab1
        Length = 566

  Minus Strand HSPs:

 Score = 687 (109.1 bits), Expect = 1.0e-25, P = 1.0e-25
 Identities = 203/273 (74%), Positives = 203/273 (74%), Strand = Minus /
Plus

Query:   333 ATGATGTCGAGTGAGA-GTAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGG
275
             ||||  |  | | ||| ||||| |  |||  |||||| |||  ||||||| |  ||||||
Sbjct:     1 ATGAAATTTAATCAGAAGTAGT-A--AGTA-ATTACTGACCGCTAAGGACGAGGAGGAGG 56

Query:   274 AAATCGGCATCAGCATGTTTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACA
215
             ||||| || || ||||| | ||| ||||| ||||||| |||| |||||| |||||| |||
Sbjct:    57 AAATCAGCGTCTGCATGGTGAGGGAGAAGAAGGGTGTGGGGTCTGGACTCGAACTCCACA
116

Query:   214 ACACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGC---GTTGGTCGAACCTGTGGAGG
158
             |||||||||| |  ||| |||||||  ||| ||||||   ||||||| || || || |||
Sbjct:   117 ACACGGTAGTCTCGAAGGTTCTGAAGCTGTGTGGAGCTTCGTTGGTCAAAGCTCTGAAGG
176

Query:   157 ACCCGAAGGTGACCATATTTGTTGCTGAATAGAGTGTGGAACCTGTCGGAGCTGAAGTAG 98
             |  || | |||||| | || |||  |||| |||||| |||| || |  ||  ||||||
Sbjct:   177 ATACGGATGTGACCGTGTTGGTTCTTGAAAAGAGTGCGGAATCTATTCGACATGAAGTGA
236

Query:    97 AAGGGGTTGTTTTGTGTTCTTGAATCAGACTCT 65
             || |||||| | ||||||  ||| || || |||
Sbjct:   237 AAAGGGTTGGTCTGTGTTTGTGAGTCTGAGTCT 269


>962_196_14581545_16654_48111_005.ab1
        Length = 538

  Minus Strand HSPs:

 Score = 633 (101.0 bits), Expect = 3.0e-23, P = 3.0e-23
 Identities = 169/204 (82%), Positives = 169/204 (82%), Strand = Minus /
Plus

Query:   201 CAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCGAAGGTGACCAT
142
             ||||||||||||||||||| |  |||||||||||||| ||||||||||| || |||||||
Sbjct:     2 CAAGATTCTGAATTTGTTTCGTACGTTGGTCGAACCTCTGGAGGACCCGGAGATGACCAT 61

Query:   141 ATTTGTTGCTGAATAGAGTGTGGAACC---TGTCGGAGCTGAAGTAGAAGGGGTTGTTTT 85
             ||| |||  ||||||||||||||||||   | ||||||||||||| ||| ||||| ||||
Sbjct:    62 ATTGGTTTTTGAATAGAGTGTGGAACCACCTATCGGAGCTGAAGTGGAAAGGGTTATTTT
121

Query:    84 GTGTTCTTGAATCAGACTCTTCCTGGCTCTCATGGTGCTGCTGCCGGTGTACAATGCCAA 25
             ||  ||| |  |  |||||||  ||||| || ||||||| | |  | ||||||||||| |
Sbjct:   122 GT--TCTCG--T--GACTCTTGTTGGCTTTCTTGGTGCT-C-GT-GATGTACAATGCCTA
172

Query:    24 AGGAGACAGAAAGTGATGCCAGGA 1
             |||| ||||||| |||||||||||
Sbjct:   173 AGGAAACAGAAACTGATGCCAGGA 196


Parameters:
  E=1e-20
  evalues
  echofilter
  -o Cowpea962_177_14574088_5489_46110_045.ab1.wu.n

  ctxfactor=2.00

  Query                        -----  As Used  -----    -----  Computed
----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.182   0.357    same    same    same
               Q=10,R=10       0.104   0.0151  0.0600    n/a     n/a     n/a
   -1      0   +5,-4           0.192   0.182   0.357    same    same    same
               Q=10,R=10       0.104   0.0151  0.0600    n/a     n/a     n/a

  Query
  Strand MatID  Length  Eff.Length     E     S  W   T   X   E2      S2
   +1      0      676       676   9.9e-21  611 11 n/a  73  0.049    80
                                                      134  0.048   119
   -1      0      676       676   9.9e-21  611 11 n/a  73  0.049    80
                                                      134  0.048   119


Statistics:

  Database:  ../../Cowpea1X/Cowpea_all_GSS_clean.fasta
   Title:  ../Cowpea1X/Cowpea_all_GSS_clean.fasta
   Posted:  2:44:50 PM PDT Oct 19, 2007
   Created:  2:44:50 PM PDT Oct 19, 2007
   Format:  XDF-1
   # of letters in database:  158,813,828
   # of sequences in database:  260,642
   # of database sequences satisfying E:  15
  No. of states in DFA:  245 (490 KB)
  Total size of DFA:  548 KB (2076 KB)
  Time to generate neighborhood:  0.00u 0.00s 0.00t   Elapsed:  00:00:00
  No. of threads or processors used:  2
  Search cpu time:  1.19u 0.04s 1.23t   Elapsed:  00:00:00
  Total cpu time:  1.20u 0.04s 1.24t   Elapsed:  00:00:00
  Start:  Fri Oct 19 14:51:16 2007   End:  Fri Oct 19 14:51:16 2007













On 10/24/07, Dave Messina <David.Messina at sbc.su.se> wrote:
>
> Hi Joseph,
>
> Could you post the blast report that's giving you trouble? And also could
> you tell us what version of WU-BLAST you're running and what version of
> BioPerl you're using?
>
> I'd like to try and reproduce your problem.
>
> Thanks,
> Dave
>
>


-- 
Joseph Fass
joseph.fass at gmail.com  ||  joefass at hotmail.com
970.227.5928 (c)  ||  530.754.7978 (w)


More information about the Bioperl-l mailing list