[Bioperl-l] FW: problem parsing WU-blast output

Forrest Zhang forrest_zhang at 163.com
Thu Oct 25 04:06:27 EDT 2007


Hi, Joe
	My this script(wublast.pl) maybe is useful for you. You can get the
subsequence by using query range and hit range.
	The script is below, and the file name is wublast.pl.

use strict;
use Bio::SearchIO;

die "Usage:perl wublast <File>\n"
      unless @ARGV==1;
my $inputfile = $ARGV[0];
my $in = new Bio::SearchIO(-format => 'blast', 
                           -file   => $inputfile);
print "query","\t","hit","\t","total_length","\t",
      "query_lenth","\t","hit_length","\t",
      "percent_identity","\t","score","\t","evalue","\t","rank",
      "\t","query range","\t","hit range","\n";

while( my $result = $in->next_result ) {
    my $image=$result->query_name;

    while( my $hit = $result->next_hit ) {
	while( my $hsp = $hit->next_hsp ) {

	print $image,"\t",$hit->name,"\t",$hsp->length('total'),"\t",
	      $hsp->length('query'),"\t",$hsp->length('hit'),"\t",
	    $hsp->percent_identity,"\t",$hsp->score,"\t",$hsp->evalue,"\t",
 
$hsp->rank,"\t",$hsp->start('query'),",",$hsp->end('query'),"\t",
            $hsp->start('hit'),",",$hsp->end('hit'),"\n";

	}  
    }
}


Forrest Zhang


-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Joseph Fass
Sent: Thursday, October 25, 2007 5:43 AM
To: Dave Messina
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] problem parsing WU-blast output

Hi Dave,

here's my code, followed by a sample wu-blast report (below).
I'm using bioperl version 1.4
Thanks for looking into it, and I'd be very curious to know what you find.

Joe



***************code***************
#!/usr/bin/perl -w

use strict;
use Bio::SearchIO;
use Bio::SeqIO;

# note: processes only the first result (first query sequence) of the blast
report!

my $usage = "usage: collect_hits.pl <blast report> <sequence database
(fasta)> <output_file>\n";
my $reportfile = shift || die $usage;
# open Blast report for reading in hit IDs
my $in  = Bio::SearchIO->new(-file => $reportfile,
                             -format => 'blast');

# open database (fasta format) for searching for hit IDs
my $databasefile = shift || die $usage;

# open output file (fasta format) for writing out IDs and sequences of Blast
hits
my $hitsfile = shift || die $usage;
my $out = Bio::SeqIO->new(-file => ">$hitsfile",
                          -format => 'fasta');

# get result from Blast report (only one!)
my $result = $in->next_result(); print "query: " .
$result->query_name()."\n";
#my $dummy = $result->next_hit; print "1st hit: " . $dummy->name() . "\n"; #
for debugging
#$dummy = $result->next_hit; print "2nd hit: " . $dummy->name() . "\n"; #
debugging
# then loop through hits, finding matching IDs in database and writing out
full fasta-format sequences
while (my $hit = $result->next_hit) {
  # find hit ID in database file to fill in sequence and write corresponding
sequence to output file
  my $seq = Bio::Seq->new( -id => $hit->name() ); # create Seq object with
hit name
  print "seq_id: " . $seq->id."\n";
  # open database file
  my $db = Bio::SeqIO->new(-file => $databasefile,
               -format => 'fasta');
  # now look through database sequences to pull out correct sequence for ID
from Blast hit
  my $still_looking = 1;
  do {
    my $db_seq = $db->next_seq();
    #print $seq->id() . " ... " . $db_seq->id() . "\n";
    if ($seq->id() eq $db_seq->id()) {
      $seq->seq($db_seq->seq);
      $still_looking = 0;
    } # if
  } while ($still_looking);
  # then write sequence (in fasta format) to output_file
  $out->write_seq($seq);
  print "found a sequence\n";
} # while







********************blast report*************************

BLASTN 2.0MP-WashU [04-May-2006] [linux26-x64-I32LPF64 2006-05-10T17:22:28]

Copyright (C) 1996-2006 Washington University, Saint Louis, Missouri USA.
All Rights Reserved.

Reference:  Gish, W. (1996-2006) http://blast.wustl.edu

Notice:  this program and its default parameter settings are optimized to
find
nearly identical sequences rapidly.  To identify weak protein similarities
encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  962_177_14574088_5489_46110_045.ab1
        (676 letters)
>Unfiltered+1
TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC
AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
CCCAACAATCCTACTT
>Unfiltered-1
AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
TCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAGCATGG
CCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATGGCTTTC
CCTGTAATTAACAAATTGATTACCATTAGGAGAAGCAAGTGTGATGATGTCGAGTGAGAG
TAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGGAAATCGGCATCAGCATGT
TTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAACACGGTAGTTTTCAAGA
TTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCGAAGGTGACCATATTTG
TTGCTGAATAGAGTGTGGAACCTGTCGGAGCTGAAGTAGAAGGGGTTGTTTTGTGTTCTT
GAATCAGACTCTTCCTGGCTCTCATGGTGCTGCTGCCGGTGTACAATGCCAAAGGAGACA
GAAAGTGATGCCAGGA

Database:  ../Cowpea1X/Cowpea_all_GSS_clean.fasta
           260,642 sequences; 158,813,828 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done


Smallest
                                                                       Sum
                                                              High
Expectation
Sequences producing High-scoring Segment Pairs:              Score
E(N)      N

962_177_14574088_5489_46110_045.ab1                           3380  2.0e-147
1
962_191_14579666_5489_46288_070.ab1                           2705  6.4e-117
1
962_307_14625348_5489_47135_029.ab1                           2314  2.8e-99
1
962_370_14650238_5489_47797_032.ab1                           2054  1.8e-87
1
962_400_14670294_5489_48184_096.ab1                           2040  7.2e-87
1
962_79_14536329_16654_45346_033.ab1                           1928  7.8e-82
1
962_187_14578095_5489_46263_022.ab1                           1764  2.3e-74
1
962_309_14626130_16654_47155_078.ab1                          1263  1.1e-51
1
962_45_14523164_5489_45006_087.ab1                            1160  3.7e-47
1
962_394_14659720_16654_47971_045.ab1                          1146  1.6e-46
1
962_61_14529390_16654_45210_020.ab1                           1077  2.1e-43
1
962_177_14574088_16654_46114_045.ab1                           955  7.5e-38
1
962_282_14615493_16654_46934_055.ab1                           891  1.3e-34
1
962_248_14601477_16654_46676_055.ab1                           687  1.0e-25
1
962_196_14581545_16654_48111_005.ab1                           633  3.0e-23
1


>962_177_14574088_5489_46110_045.ab1
        Length = 676

  Plus Strand HSPs:

 Score = 3380 (513.2 bits), Expect = 2.0e-147, P = 2.0e-147
 Identities = 676/676 (100%), Positives = 676/676 (100%), Strand = Plus /
Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGTTCC
120

Query:   121 ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 ACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCT
180

Query:   181 CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 CCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACA
240

Query:   241 CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
300
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 CCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGT
300

Query:   301 AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
360
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 AATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCA
360

Query:   361 ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 ATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCT
420

Query:   421 TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
480
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 TCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTA
480

Query:   481 ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 ACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTC
540

Query:   541 ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
600
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   541 ACAGATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTT
600

Query:   601 GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
660
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   601 GCAATTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAG
660

Query:   661 CCCAACAATCCTACTT 676
             ||||||||||||||||
Sbjct:   661 CCCAACAATCCTACTT 676


>962_191_14579666_5489_46288_070.ab1
        Length = 664

  Plus Strand HSPs:

 Score = 2705 (411.9 bits), Expect = 6.4e-117, P = 6.4e-117
 Identities = 541/541 (100%), Positives = 541/541 (100%), Strand = Plus /
Plus

Query:   136 ACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTCAGA
195
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:     1 ACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTCAGA 60

Query:   196 ATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTCCTA
255
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 ATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTCCTA
120

Query:   256 AACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATCACT
315
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   121 AACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATCACT
180

Query:   316 ACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCAATTTGTTAATTACAG
375
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   181 ACTCTCACTCGACATCATCACACTTGCTTCTCCTAATGGTAATCAATTTGTTAATTACAG
240

Query:   376 GGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAG
435
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 GGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAG
300

Query:   436 GCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACG
495
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   301 GCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACG
360

Query:   496 AGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAG
555
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   361 AGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAG
420

Query:   556 CGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAA
615
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   421 CGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAA
480

Query:   616 ATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACT
675
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   481 ATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACT
540

Query:   676 T 676
             |
Sbjct:   541 T 541


>962_307_14625348_5489_47135_029.ab1
        Length = 687

  Minus Strand HSPs:

 Score = 2314 (353.2 bits), Expect = 2.8e-99, P = 2.8e-99
 Identities = 558/629 (88%), Positives = 558/629 (88%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTA-
618
             ||||||||||||||||||||||||||||| ||||||||||||| |||  ||||||||||
Sbjct:    72 AAGTAGGATTGTTGGGCTTCTGTGCTAGATAGGAAAAAGTCCTACAGGCCAAGCATTTAT
131

Query:   617 -ATTT-A-GAGA-GAAA---TTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGA
565
              || | | | || ||||   || ||||||||||||||||||  | |||||| |     ||
Sbjct:   132 CATCTCATGTGAAGAAAAATTTACAAGTTAGAATAAAAAAAAAT-TAGTTC-G-----GA
184

Query:   564 AAAAAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTC
505
             ||  ||    |||||||||||||||||| |||||||| |||| ||||||||||| |||||
Sbjct:   185 AAGCAG----TACTTGAAATCTGTGAGGATTGTTAACGGGTACGGCGAGTTTGACTATTC
240

Query:   504 TGAGATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCT
445
             ||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||
Sbjct:   241 TGAGATTCTCGTTGTCGTCAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCT
300

Query:   444 GAGCATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTA
385
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct:   301 GAGCATGGCCTTGCTCAAGAATGTAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTA
360

Query:   384 TGGCTTTCCCTGTAATTAACAAATTGATTAC---CA-T--T--AGGAGAAGCAAGTGTGA
333
             ||||| |||||||||||||||||||||||||   || |  |  |||||||||||||||||
Sbjct:   361 TGGCTCTCCCTGTAATTAACAAATTGATTACAATCAATGGTGCAGGAGAAGCAAGTGTGA
420

Query:   332 TGATGTCGAGTGAGAGTAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGGAA
273
             |||| | |||||||  ||| ||||||||||||||||||||||||||||||| ||||||||
Sbjct:   421 TGATTTTGAGTGAG--TAGCGATTAGTTGATTACTTACCATTAAGGACAACTAGGAGGAA
478

Query:   272 ATCGGCATCAGCATGTTTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAAC
213
             ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||
Sbjct:   479 ATCGGCATCAGCATGGTGAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACAAC
538

Query:   212 ACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCG
153
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||
Sbjct:   539 ACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTCTGGAGGACACG
598

Query:   152 AAGGTGACCATATTTGTTGCTGAATAGAGTGTGGAACC---TGTCGGAGCTGAAGTAGAA 96
             |||||||||||||| ||| |||||||||||||||||||   |||| |||  |||||||||
Sbjct:   599 AAGGTGACCATATTGGTTTCTGAATAGAGTGTGGAACCACCTGTCAGAGTCGAAGTAGAA
658

Query:    95 GGGGTTGTTTTGTGTTCTTGAATCAGACT 67
             |||||| ||||||  |||||| ||  |||
Sbjct:   659 GGGGTTATTTTGTCCTCTTGATTCCAACT 687


>962_370_14650238_5489_47797_032.ab1
        Length = 581

  Plus Strand HSPs:

 Score = 2054 (314.2 bits), Expect = 1.8e-87, P = 1.8e-87
 Identities = 468/514 (91%), Positives = 468/514 (91%), Strand = Plus / Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             |||| |||||||||||||||||||| ||||||||||||||| |  | ||||| |||||||
Sbjct:    74 TCCTTGCATCACTTTCTGTCTCCTTCGGCATTGTACACCGGGA--A-CACCAAGAGAGCC
130

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGT--T
118
             | |||||||| || ||||||  |||||| |||||||||||||||  ||| |||||||  |
Sbjct:   131 AAGAAGAGTCGGAATCAAGAGGACAAAATAACCCCTTCTACTTCGACTCTGACAGGTGGT
190

Query:   119 -CCACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAAC
177
              ||||||||||||||| ||| |||||||||||||||| |||||||| |||||||||||||
Sbjct:   191 TCCACACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAAC
250

Query:   178 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   251 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
310

Query:   238 ACACCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTA
297
             ||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||
Sbjct:   311 ACACCCTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTA
370

Query:   298 AGTAATCAACTAATCACTACTCTCACTCGACATCATCACACTTGCTTCTCCT--A--AT-
352
             ||||||||||||||| ||||||  |||| | |||||||||||||||||||||  |  ||
Sbjct:   371 AGTAATCAACTAATCGCTACTC--ACTCAAAATCATCACACTTGCTTCTCCTGCACCATT
428

Query:   353 G---GTAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGG
409
             |   ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct:   429 GATTGTAATCAATTTGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGACGG
488

Query:   410 CAGAGACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTT
469
             ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct:   489 CAGAGACTCCTACATTCTTGAGCAGGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTT
548

Query:   470 CTTTTTGGTTAACCCTAATGAAAACGAGAATCTC 503
             ||||||||| |||||| | || ||||||||||||
Sbjct:   549 CTTTTTGGT-AACCCTGACGACAACGAGAATCTC 581


>962_400_14670294_5489_48184_096.ab1
        Length = 641

  Plus Strand HSPs:

 Score = 2040 (312.1 bits), Expect = 7.2e-87, P = 7.2e-87
 Identities = 488/564 (86%), Positives = 488/564 (86%), Strand = Plus / Plus

Query:   123 ACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCC
182
             ||||||||||| ||| |||||||||||||||| |||||||| ||||||||||||||||||
Sbjct:     1 ACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAACGCTCC 60

Query:   183 AAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACC
242
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:    61 AAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACC
120

Query:   243 CTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAA
302
             |||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||
Sbjct:   121 CTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTAAGTAA
180

Query:   303 TCAACTAATCACTACTCTCACTCGA-CATCATCACA--CTTGCTTCT-C-CTAATG---G
354
             |||||||||| |||||| | | | | ||||| |||   ||| || || | | | ||   |
Sbjct:   181 TCAACTAATCGCTACTCACTCACAATCATCA-CACTTTCTTTCTCCTGCACCATTGATTG
239

Query:   355 TAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAG
414
             ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct:   240 TAATCAATTCGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGACGGCAGAG
299

Query:   415 ACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTT
474
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   300 ACTCCTACATTCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTT
359

Query:   475 TGGTTAACCCTAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACA
534
             ||||||||||| | || |||||||||||||||||| |||||||||||||||| |||||||
Sbjct:   360 TGGTTAACCCTGACGACAACGAGAATCTCAGAATAGTCAAACTCGCCATACCCGTTAACA
419

Query:   535 ACCCTCACAGATTTCAAGTAGCGCCTTTTTT-CTGATCCTGAACTATAACTTTTTTTATT
593
             | ||||||||||||||||||  |||||     || ||  |    | |  ||| |   ||
Sbjct:   420 ATCCTCACAGATTTCAAGTACTGCCTTCCGAACTAATTTTTT--T-TCCCTTCTAACATG
476

Query:   594 CTAACTTGCAATTTCTCTCTAAAT-TAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAG
652
             | |  || |     || | | |   ||||||||||  ||| ||||||||||||| |||||
Sbjct:   477 CGATTTTTCTCCA-CT-TGTGATGATAAATGCTTGGCCTGTAGGACTTTTTCCTATCTAG
534

Query:   653 CACAGAAGCCCAACAATCCTACTT 676
             ||||||||||||||||||||||||
Sbjct:   535 CACAGAAGCCCAACAATCCTACTT 558


>962_79_14536329_16654_45346_033.ab1
        Length = 675

  Plus Strand HSPs:

 Score = 1928 (295.3 bits), Expect = 7.8e-82, P = 7.8e-82
 Identities = 472/553 (85%), Positives = 472/553 (85%), Strand = Plus / Plus

Query:    77 AAGAA-CACAAAACAACCCCTTCTACTTCAGCTCCGACA-G-G-TTCCACACTCTATTCA
132
             ||||  || || |||||||||||||||||| |||||||| | | ||||||||||||| ||
Sbjct:     6 AAGAGTCAGAAGACAACCCCTTCTACTTCAACTCCGACAAGTGGTTCCACACTCTATACA 65

Query:   133 GCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAACGCTCCAAACAAATTC
192
             | ||| |||||||||||||||| || ||||| |||||||||||||||||| |||||||||
Sbjct:    66 GAAACCAATATGGTCACCTTCGTGTGCTCCAGAGGTTCGACCAACGCTCCGAACAAATTC
125

Query:   193 AGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTC
252
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct:   126 AGAATCTTGAAAACTACCGTCTTGTAGAGTTCAAGTCCAAACCCAACACCCTCCTTCTTC
185

Query:   253 CTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTAAGTAATCAACTAATC
312
             || | || |||||||||||||| |||||  |||||||||| |||||||||| |||||||
Sbjct:   186 CTCACCACGCTGATGCCGATTTGCTCCTATTTGTCCTTAACGGTAAGTAATAAACTAATA
245

Query:   313 ACTACTC-TCACTCGACATCATCACACTTGCTTCTCCT-AA---TGGTA---ATCAATTT
364
             |   ||  | ||  || | | ||| | ||||||||||  ||   || ||   ||||| ||
Sbjct:   246 ATCGCTAGTAACA-GA-A-CTTCATATTTGCTTCTCCGCAAAAATGATAGTGATCAAGTT
302

Query:   365 GTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCAT
424
             ||||||||||||   | || || |||| |||||||||||||| |||||||| |||| |||
Sbjct:   303 GTTAATTACAGGTGGACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACAT
362

Query:   425 TCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
484
             ||||||||||||| |||| ||||| |||||||||||||||| |||||||||| |||||||
Sbjct:   363 TCTTGAGCAAGGCGATGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCC
422

Query:   485 TAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAG
544
             | | || |||||| |||||||||||||||||||||||||||| ||||||||||||||||
Sbjct:   423 TGACGACAACGAGGATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACAT
482

Query:   545 ATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAA
604
             ||||||||||  |||||||  ||||| |  ||||| | |||||||| || |||||||||
Sbjct:   483 ATTTCAAGTACTGCCTTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCAT
539

Query:   605 TTTCTCTCTAAAT 617
             |||||||||||||
Sbjct:   540 TTTCTCTCTAAAT 552

 Score = 1188 (184.3 bits), Expect = 2.1e-48, P = 2.1e-48
 Identities = 358/471 (76%), Positives = 358/471 (76%), Strand = Plus / Plus

Query:   220 AGTTCAAGTCCAAACCCAACACCCTCCTTCTTC-CTAAACATGCTGATGCCGATTTCCTC
278
             ||| |||  ||||  ||  | || || ||| || | |  | || ||  |      ||||
Sbjct:   159 AGTCCAAACCCAACACC--CTCCTTC-TTCCTCACCACGC-TGATGCCGATTTGCTCCTA
214

Query:   279 CTTGTTGTCCTTAATG-GTAAGTAATCAACTAATCACTACTCTCACTCGACATCATCACA
337
              ||||  |      |  |||| ||| | | ||||| ||| |  ||    || ||||
Sbjct:   215 TTTGTCCTTAACGGTAAGTAA-TAAACTAATAATCGCTAGTAACAGA--ACTTCATATTT
271

Query:   338 -CTTGCTTCTCCTAA-TGGTA---ATCAATTTGTTAATTACAGGGAAAGCCATACTCACC
392
              ||| || | |  || || ||   ||||| ||||||||||||||   | || || ||||
Sbjct:   272 GCTT-CTCCGCAAAAATGATAGTGATCAAGTTGTTAATTACAGGTGGACCCGTAATCACA
330

Query:   393 TTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAGGCCATGCTCAGAAGATC
452
             |||||||||||||| |||||||| |||| |||||||||||||||| |||| ||||| |||
Sbjct:   331 TTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAGCAAGGCGATGCCCAGAAAATC
390

Query:   453 CCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACGAGAATCTCAGAATAATC
512
             ||||||||||||| |||||||||| |||||||| | || |||||| ||||||||||||||
Sbjct:   391 CCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGACAACGAGGATCTCAGAATAATC
450

Query:   513 AAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAGCGCCTTTTTTCTGATCC
572
             |||||||||||||| |||||||||||||||| ||||||||||  |||||||  ||||| |
Sbjct:   451 AAACTCGCCATACCCGTTAACAACCCTCACATATTTCAAGTACTGCCTTTT--CTGATTC
508

Query:   573 TGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAAAT-T----A-AA-TGCT
625
               ||||| | |||||||| || ||||||||| ||||||||||||| |    | || || |
Sbjct:   509 CCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCTCTAAATGTGACGATAAATGTT
567

Query:   626 TGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCTACTT 676
             ||  ||| ||||||||||| | |||||||||||||||||||| ||||||||
Sbjct:   568 TGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCAACAGTCCTACTT 618


>962_187_14578095_5489_46263_022.ab1
        Length = 590

  Plus Strand HSPs:

 Score = 1764 (270.7 bits), Expect = 2.3e-74, P = 2.3e-74
 Identities = 410/453 (90%), Positives = 410/453 (90%), Strand = Plus / Plus

Query:     1 TCCTGGCATCACTTTCTGTCTCCTTTGGCATTGTACACCGGCAGCAGCACCATGAGAGCC 60
             ||||||||||||||||||||||||| |||||||||||||||  | ||||||| |||||||
Sbjct:   144 TCCTGGCATCACTTTCTGTCTCCTTCGGCATTGTACACCGG--G-AGCACCAAGAGAGCC
200

Query:    61 AGGAAGAGTCTGATTCAAGAACACAAAACAACCCCTTCTACTTCAGCTCCGACAGGT--T
118
             | |||||||| ||  |||||  |||||| |||||||||||||||  ||| |||||||  |
Sbjct:   201 AAGAAGAGTCGGAACCAAGAGGACAAAATAACCCCTTCTACTTCGACTCTGACAGGTGGT
260

Query:   119 -CCACACTCTATTCAGCAACAAATATGGTCACCTTCGGGTCCTCCACAGGTTCGACCAAC
177
              ||||||||||||||| ||| |||||||||||||||| |||||||| |||||||||||||
Sbjct:   261 TCCACACTCTATTCAGAAACCAATATGGTCACCTTCGTGTCCTCCAGAGGTTCGACCAAC
320

Query:   178 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
237
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   321 GCTCCAAACAAATTCAGAATCTTGAAAACTACCGTGTTGTAGAGTTCAAGTCCAAACCCA
380

Query:   238 ACACCCTCCTTCTTCCTAAACATGCTGATGCCGATTTCCTCCTTGTTGTCCTTAATGGTA
297
             ||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||
Sbjct:   381 ACACCCTCCTTCTTCCTCACCATGCTGATGCCGATTTCCTCCTAGTTGTCCTTAATGGTA
440

Query:   298 AGTAATCAACTAATCACTACTCTCACTCGACA-TCATCACACTTGCTT-CTCCT--A--A
351
             ||||||||||||||| ||||||  |||| ||| ||||||||||| ||| |||||  |  |
Sbjct:   441 AGTAATCAACTAATCGCTACTC--ACTC-ACAATCATCACACTTTCTTTCTCCTGCACCA
497

Query:   352 T-G---GTAATCAATTTGTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGAC
407
             | |   |||||||||| |||||||||||||| ||||||||||||||||||||||||||||
Sbjct:   498 TTGATTGTAATCAATTCGTTAATTACAGGGAGAGCCATACTCACCTTGGTGAACCCTGAC
557

Query:   408 GGCAGAGACTCCTTCATTCTTGAGCAAGGCCAT 440
             ||||||||||||| |||||||||||||||||||
Sbjct:   558 GGCAGAGACTCCTACATTCTTGAGCAAGGCCAT 590


>962_309_14626130_16654_47155_078.ab1
        Length = 531

  Plus Strand HSPs:

 Score = 1263 (195.6 bits), Expect = 1.1e-51, P = 1.1e-51
 Identities = 281/312 (90%), Positives = 281/312 (90%), Strand = Plus / Plus

Query:   365 GTTAATTACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCAT
424
             |||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||
Sbjct:     1 GTTAATTACAGGAAGAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCATTCAT 60

Query:   425 TCTTGAGCAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
484
             ||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||
Sbjct:    61 TCTTGAGCAAGGCCATGTTCAAAGGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCC
120

Query:   485 TAATGAAAACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAG
544
             ||| || ||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct:   121 TAACGACAACGACAATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACAA
180

Query:   545 ATTTCAAGTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAA
604
             ||||||||||  ||||| | |  ||| |   ||||||||| ||||||||||||||| |||
Sbjct:   181 ATTTCAAGTACTGCCTTCTGT--GATTCCATACTATAACTGTTTTTATTCTAACTTTCAA
238

Query:   605 TTTCTCTCTAAATTAAATGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCA
664
             ||||||||||||| ||||| || | ||| ||||||||||||| |||||||||||||| ||
Sbjct:   239 TTTCTCTCTAAAT-AAATGTTTCTCCTGTAGGACTTTTTCCTATCTAGCACAGAAGCTCA
297

Query:   665 ACAATCCTACTT 676
              |||||||||||
Sbjct:   298 GCAATCCTACTT 309


>962_45_14523164_5489_45006_087.ab1
        Length = 697

  Plus Strand HSPs:

 Score = 1160 (180.1 bits), Expect = 3.7e-47, P = 3.7e-47
 Identities = 302/364 (82%), Positives = 302/364 (82%), Strand = Plus / Plus

Query:   327 ACATCATCACACTTGCTTCTCCT-AA---TGGTA---ATCAATTTGTTAATTACAGGGAA
379
             | | | ||| | ||||||||||  ||   || ||   ||||| ||||||||||||||
Sbjct:    13 AGAACTTCATATTTGCTTCTCCGCAAAAATGATAGTGATCAAGTTGTTAATTACAGGTGG 72

Query:   380 AGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAGCAAGGCCA
439
             | || || |||| |||||||||||||| |||||||| |||| |||||||||||||||| |
Sbjct:    73 ACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAGCAAGGCGA
132

Query:   440 TGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAAAACGAGAA
499
             ||| ||||| |||||||||||||||| |||||||||| |||||||| | || |||||| |
Sbjct:   133 TGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGACAACGAGGA
192

Query:   500 TCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAAGTAGCGCC
559
             ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||  |||
Sbjct:   193 TCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACATATTTCAAGTACTGCC
252

Query:   560 TTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCTCTAAAT-T
618
             ||||  ||||| |  ||||| | |||||||| || ||||||||| ||||||||||||| |
Sbjct:   253 TTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCTCTAAATGT
309

Query:   619 -A--A--A-TGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCAACAATCCT
672
              |  |  | || |||  ||| ||||||||||| | |||||||||||||||||||| ||||
Sbjct:   310 GACGATAAATGTTTGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCAACAGTCCT
369

Query:   673 ACTT 676
             ||||
Sbjct:   370 ACTT 373


>962_394_14659720_16654_47971_045.ab1
        Length = 708

  Minus Strand HSPs:

 Score = 1146 (178.0 bits), Expect = 1.6e-46, P = 1.6e-46
 Identities = 284/333 (85%), Positives = 284/333 (85%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTA-
618
             ||||||||||||||||||||||||||||| ||||||||||||| |||  ||||||||||
Sbjct:   374 AAGTAGGATTGTTGGGCTTCTGTGCTAGATAGGAAAAAGTCCTACAGGCCAAGCATTTAT
433

Query:   617 -ATTTAGAGAGAAATTGCAAGTTAGAA-T-A-AA-AAAAGTTATAGTTCAGGATCAGAAA
563
              || |   | |||     || ||| || | | || ||||   | |  | ||  || ||||
Sbjct:   434 CATCTCATGTGAAGAAA-AATTTACAAGTTAGAATAAAAAAAAAAAAT-AGT-TCGGAAA
490

Query:   562 AAAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTG
503
               ||    ||||||||||||||||||||||||||| |||| ||||||||||| |||||||
Sbjct:   491 GCAG----TACTTGAAATCTGTGAGGGTTGTTAACGGGTACGGCGAGTTTGACTATTCTG
546

Query:   502 AGATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGA
443
             ||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||
Sbjct:   547 AGATTCTCGTTGTCGTCAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGA
606

Query:   442 GCATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATG
383
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct:   607 GCATGGCCTTGCTCAAGAATGTAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATG
666

Query:   382 GCTTTCCCTGTAATTAACAAATTGATTACCATT 350
             ||| |||||||||||||| |||||||||| | |
Sbjct:   667 GCTCTCCCTGTAATTAACGAATTGATTACAAAT 699


>962_61_14529390_16654_45210_020.ab1
        Length = 696

  Plus Strand HSPs:

 Score = 1077 (167.6 bits), Expect = 2.1e-43, P = 2.1e-43
 Identities = 265/312 (84%), Positives = 265/312 (84%), Strand = Plus / Plus

Query:   372 ACAGGGAAAGCCATACTCACCTTGGTGAACCCTGACGGCAGAGACTCCTTCATTCTTGAG
431
             |||||   | || || |||| |||||||||||||| |||||||| |||| ||||||||||
Sbjct:     1 ACAGGTGGACCCGTAATCACATTGGTGAACCCTGATGGCAGAGAATCCTACATTCTTGAG 60

Query:   432 CAAGGCCATGCTCAGAAGATCCCTGCAGGAACCACTTTCTTTTTGGTTAACCCTAATGAA
491
             |||||| |||| ||||| |||||||||||||||| |||||||||| |||||||| | ||
Sbjct:    61 CAAGGCGATGCCCAGAAAATCCCTGCAGGAACCATTTTCTTTTTGATTAACCCTGACGAC
120

Query:   492 AACGAGAATCTCAGAATAATCAAACTCGCCATACCTGTTAACAACCCTCACAGATTTCAA
551
             |||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||
Sbjct:   121 AACGAGGATCTCAGAATAATCAAACTCGCCATACCCGTTAACAACCCTCACATATTTCAA
180

Query:   552 GTAGCGCCTTTTTTCTGATCCTGAACTATAACTTTTTTTATTCTAACTTGCAATTTCTCT
611
             |||  |||||||  ||||| |  ||||| | |||||||| || ||||||||| |||||||
Sbjct:   181 GTACTGCCTTTT--CTGATTCCCAACTA-ACCTTTTTTTCTTTTAACTTGCATTTTCTCT
237

Query:   612 CTAAAT-T-A--A--A-TGCTTGTTCTGCAGGACTTTTTCCTTTCTAGCACAGAAGCCCA
664
             |||||| | |  |  | || |||  ||| ||||||||||| | |||||||||||||||||
Sbjct:   238 CTAAATGTGACGATAAATGTTTGCCCTGTAGGACTTTTTCTTATCTAGCACAGAAGCCCA
297

Query:   665 ACAATCCTACTT 676
             ||| ||||||||
Sbjct:   298 ACAGTCCTACTT 309


>962_177_14574088_16654_46114_045.ab1
        Length = 625

  Minus Strand HSPs:

 Score = 955 (149.3 bits), Expect = 7.5e-38, P = 7.5e-38
 Identities = 191/191 (100%), Positives = 191/191 (100%), Strand = Minus /
Plus

Query:   676 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
617
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   435 AAGTAGGATTGTTGGGCTTCTGTGCTAGAAAGGAAAAAGTCCTGCAGAACAAGCATTTAA
494

Query:   616 TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
557
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   495 TTTAGAGAGAAATTGCAAGTTAGAATAAAAAAAGTTATAGTTCAGGATCAGAAAAAAGGC
554

Query:   556 GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
497
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:   555 GCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGAGATTC
614

Query:   496 TCGTTTTCATT 486
             |||||||||||
Sbjct:   615 TCGTTTTCATT 625


>962_282_14615493_16654_46934_055.ab1
        Length = 274

  Minus Strand HSPs:

 Score = 891 (139.7 bits), Expect = 1.3e-34, P = 1.3e-34
 Identities = 191/207 (92%), Positives = 191/207 (92%), Strand = Minus /
Plus

Query:   561 AAGGCGCTACTTGAAATCTGTGAGGGTTGTTAACAGGTATGGCGAGTTTGATTATTCTGA
502
             |||||  |||||||||||||||||| |||||||| |||||||||||||||| ||||||||
Sbjct:    68 AAGGCAGTACTTGAAATCTGTGAGGATTGTTAACGGGTATGGCGAGTTTGACTATTCTGA
127

Query:   501 GATTCTCGTTTTCATTAGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAG
442
             |||||||||| || |  |||||||||||||||||||||||||||||||||||||||||||
Sbjct:   128 GATTCTCGTTGTCGTCTGGGTTAACCAAAAAGAAAGTGGTTCCTGCAGGGATCTTCTGAG
187

Query:   441 CATGGCCTTGCTCAAGAATGAAGGAGTCTCTGCCGTCAGGGTTCACCAAGGTGAGTATGG
382
             ||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||
Sbjct:   188 CATGGCCTTGCTCAATAATGTAGGAGTCTCTGCCGTCAGGGTTCCCCAAGGTGAGTATGG
247

Query:   381 CTTTCCCTGTAATTAACAAATTGATTA 355
             || |||||| ||||||| | |||||||
Sbjct:   248 CTCTCCCTGCAATTAACGATTTGATTA 274


>962_248_14601477_16654_46676_055.ab1
        Length = 566

  Minus Strand HSPs:

 Score = 687 (109.1 bits), Expect = 1.0e-25, P = 1.0e-25
 Identities = 203/273 (74%), Positives = 203/273 (74%), Strand = Minus /
Plus

Query:   333 ATGATGTCGAGTGAGA-GTAGTGATTAGTTGATTACTTACCATTAAGGACAACAAGGAGG
275
             ||||  |  | | ||| ||||| |  |||  |||||| |||  ||||||| |  ||||||
Sbjct:     1 ATGAAATTTAATCAGAAGTAGT-A--AGTA-ATTACTGACCGCTAAGGACGAGGAGGAGG 56

Query:   274 AAATCGGCATCAGCATGTTTAGGAAGAAGGAGGGTGTTGGGTTTGGACTTGAACTCTACA
215
             ||||| || || ||||| | ||| ||||| ||||||| |||| |||||| |||||| |||
Sbjct:    57 AAATCAGCGTCTGCATGGTGAGGGAGAAGAAGGGTGTGGGGTCTGGACTCGAACTCCACA
116

Query:   214 ACACGGTAGTTTTCAAGATTCTGAATTTGTTTGGAGC---GTTGGTCGAACCTGTGGAGG
158
             |||||||||| |  ||| |||||||  ||| ||||||   ||||||| || || || |||
Sbjct:   117 ACACGGTAGTCTCGAAGGTTCTGAAGCTGTGTGGAGCTTCGTTGGTCAAAGCTCTGAAGG
176

Query:   157 ACCCGAAGGTGACCATATTTGTTGCTGAATAGAGTGTGGAACCTGTCGGAGCTGAAGTAG 98
             |  || | |||||| | || |||  |||| |||||| |||| || |  ||  ||||||
Sbjct:   177 ATACGGATGTGACCGTGTTGGTTCTTGAAAAGAGTGCGGAATCTATTCGACATGAAGTGA
236

Query:    97 AAGGGGTTGTTTTGTGTTCTTGAATCAGACTCT 65
             || |||||| | ||||||  ||| || || |||
Sbjct:   237 AAAGGGTTGGTCTGTGTTTGTGAGTCTGAGTCT 269


>962_196_14581545_16654_48111_005.ab1
        Length = 538

  Minus Strand HSPs:

 Score = 633 (101.0 bits), Expect = 3.0e-23, P = 3.0e-23
 Identities = 169/204 (82%), Positives = 169/204 (82%), Strand = Minus /
Plus

Query:   201 CAAGATTCTGAATTTGTTTGGAGCGTTGGTCGAACCTGTGGAGGACCCGAAGGTGACCAT
142
             ||||||||||||||||||| |  |||||||||||||| ||||||||||| || |||||||
Sbjct:     2 CAAGATTCTGAATTTGTTTCGTACGTTGGTCGAACCTCTGGAGGACCCGGAGATGACCAT 61

Query:   141 ATTTGTTGCTGAATAGAGTGTGGAACC---TGTCGGAGCTGAAGTAGAAGGGGTTGTTTT 85
             ||| |||  ||||||||||||||||||   | ||||||||||||| ||| ||||| ||||
Sbjct:    62 ATTGGTTTTTGAATAGAGTGTGGAACCACCTATCGGAGCTGAAGTGGAAAGGGTTATTTT
121

Query:    84 GTGTTCTTGAATCAGACTCTTCCTGGCTCTCATGGTGCTGCTGCCGGTGTACAATGCCAA 25
             ||  ||| |  |  |||||||  ||||| || ||||||| | |  | ||||||||||| |
Sbjct:   122 GT--TCTCG--T--GACTCTTGTTGGCTTTCTTGGTGCT-C-GT-GATGTACAATGCCTA
172

Query:    24 AGGAGACAGAAAGTGATGCCAGGA 1
             |||| ||||||| |||||||||||
Sbjct:   173 AGGAAACAGAAACTGATGCCAGGA 196


Parameters:
  E=1e-20
  evalues
  echofilter
  -o Cowpea962_177_14574088_5489_46110_045.ab1.wu.n

  ctxfactor=2.00

  Query                        -----  As Used  -----    -----  Computed
----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.182   0.357    same    same    same
               Q=10,R=10       0.104   0.0151  0.0600    n/a     n/a     n/a
   -1      0   +5,-4           0.192   0.182   0.357    same    same    same
               Q=10,R=10       0.104   0.0151  0.0600    n/a     n/a     n/a

  Query
  Strand MatID  Length  Eff.Length     E     S  W   T   X   E2      S2
   +1      0      676       676   9.9e-21  611 11 n/a  73  0.049    80
                                                      134  0.048   119
   -1      0      676       676   9.9e-21  611 11 n/a  73  0.049    80
                                                      134  0.048   119


Statistics:

  Database:  ../../Cowpea1X/Cowpea_all_GSS_clean.fasta
   Title:  ../Cowpea1X/Cowpea_all_GSS_clean.fasta
   Posted:  2:44:50 PM PDT Oct 19, 2007
   Created:  2:44:50 PM PDT Oct 19, 2007
   Format:  XDF-1
   # of letters in database:  158,813,828
   # of sequences in database:  260,642
   # of database sequences satisfying E:  15
  No. of states in DFA:  245 (490 KB)
  Total size of DFA:  548 KB (2076 KB)
  Time to generate neighborhood:  0.00u 0.00s 0.00t   Elapsed:  00:00:00
  No. of threads or processors used:  2
  Search cpu time:  1.19u 0.04s 1.23t   Elapsed:  00:00:00
  Total cpu time:  1.20u 0.04s 1.24t   Elapsed:  00:00:00
  Start:  Fri Oct 19 14:51:16 2007   End:  Fri Oct 19 14:51:16 2007













On 10/24/07, Dave Messina <David.Messina at sbc.su.se> wrote:
>
> Hi Joseph,
>
> Could you post the blast report that's giving you trouble? And also could
> you tell us what version of WU-BLAST you're running and what version of
> BioPerl you're using?
>
> I'd like to try and reproduce your problem.
>
> Thanks,
> Dave
>
>


-- 
Joseph Fass
joseph.fass at gmail.com  ||  joefass at hotmail.com
970.227.5928 (c)  ||  530.754.7978 (w)
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





More information about the Bioperl-l mailing list