[Bioperl-l] bug in Bio::SearchIO?

Chris Fields cjfields at uiuc.edu
Wed Sep 12 10:57:22 EDT 2007


Try updating to bioperl from CVS.  I believe this issue was fixed but  
I don't believe it made the 1.5.2 release.

chris

On Sep 12, 2007, at 3:44 AM, Stephan Roessner wrote:

> Hi,
>
> I am parsing a BlastN output with Bio::SearchIO and getting an  
> error for some
> of the hits when retrieving the start and/or the end position with
> $hit->end('sbjct') , $hit->start('sbjct'). I want to filter for  
> hits which
> are are of equal length (~ > 0.9) to the query sequences.
>
> SearchIO is retrieving the right results, but throws an exemption,  
> in this
> case: MSG:Undefined sub-sequence (1633,760). Valid range = 693 -  
> 760 .....
>
> It seems to me valid range is parsed incorrectly, isn't it? Is this  
> a bug?
>
> Does anybody have a similar problem?
>
> see code, error, and blastn output below.
>
> thanks,
> Stephan
>
>
> Stephan Roessner
> MIPS/IBI Inst. for Bioinformatics
> GSF Research Center for Environment and Health
> Ingolstädter Landstr. 1
> 85764 Neuherberg; Germany
> phone: +49 (0)89 3187 3583
> fax:       +49 (0)89 3187 3585
> email: stephan.roessner at gsf.de
>
>
> Here is the piece of code I am using:
>
> my $blast_report = new Bio::SearchIO ('-format'=>'blast',
>                                          '-file' => $source);
>   	
> while( my $result=$blast_report->next_result) {
> 		while( my $hit= $result->next_hit()) {
> 			print "Name: ".$hit->name."\n";
> 			print "S: ".$hit->start('sbjct')."\n";
> 			print "E: ".$hit->end('sbjct')."\n";
> 			print "L: ".$hit->length()."\n";
> 		}
>  	}
>
>
> Here's the message:
>
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Undefined sub-sequence (1633,760). Valid range = 693 - 760
> STACK: Error::throw
> STACK:
> Bio::Root::Root::throw /usr/lib/perl5/vendor_perl/5.8.8/Bio/Root/ 
> Root.pm:359
> STACK:
> Bio::Search::HSP::HSPI::matches /usr/lib/perl5/vendor_perl/5.8.8/ 
> Bio/Search/HSP/HSPI.pm:691
> STACK:
> Bio::Search::SearchUtils::_adjust_contigs /usr/lib/perl5/ 
> vendor_perl/5.8.8/Bio/Search/SearchUtils.pm:489
> STACK:
> Bio::Search::SearchUtils::tile_hsps /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/SearchUtils.pm:206
> STACK:
> Bio::Search::Hit::GenericHit::start /usr/lib/perl5/vendor_perl/ 
> 5.8.8/Bio/Search/Hit/GenericHit.pm:935
> STACK:
> main::parse /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:82
> STACK: /home/users/roessner/workspace/GeneSimilarity/ 
> similarity_analysis.pl:51
> -----------------------------------------------------------
>
> S: 635
> E: 790
> L: 2052
>
> This is the BLASTN output I am parsing::
>
>> LOC_Os11g37470.1 chr11_pseudomolecule_TIGR r_jap version0
>             21623485-21621434 BestGuessTranscript
>           Length = 2052
>
>  Score = 95.6 bits (48), Expect = 1e-17
>  Identities = 106/124 (85%), Gaps = 1/124 (0%)
>  Strand = Plus / Plus
>
>
> Query: 3191 tattaagcataattaatgtatcattagcacatgtagg- 
> ttactgtagcatttaaggctaa 3249
>             |||||||| |||||||| | ||||| ||||||||||| |||||||| || |||  
> ||||||
> Sbjct: 635   
> tattaagcctaattaatctgtcattggcacatgtagggttactgtaacacttatggctaa 694
>
>
> Query: 3250  
> tcatagagtaactagacttaaaagactcgtctcgcgattttcaaccaaactgtgtaatta 3309
>             |||| || ||| |||||| |||||| || ||||||||||||||  ||||| |||  
> |||||
> Sbjct: 695   
> tcatggactaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaatta 754
>
>
> Query: 3310 gttt 3313
>             ||||
> Sbjct: 755  gttt 758
>
>
>
>  Score = 48.1 bits (24), Expect = 0.002
>  Identities = 57/68 (83%)
>  Strand = Plus / Minus
>
>
> Query: 2253  
> aaaaactaattacacaatttacctgtacatcgcgagatgaatcttttaagtttagttact 2312
>             ||||||||||| |||  ||| | || | ||||||||||||||||||| ||| ||  
> ||| |
> Sbjct: 760   
> aaaaactaattgcacggtttgcatgaaaatcgcgagatgaatcttttgagtctatttagt 701
>
>
> Query: 2313 ccatgatt 2320
>             ||||||||
> Sbjct: 700  ccatgatt 693
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 76/94 (80%)
>  Strand = Plus / Minus
>
>
> Query: 1539  
> atgcatgtagtattaaatatagacgaaaataaaaactaattgcacagtttggtcgaaatt 1598
>             ||||||| || |||||||||| |  |||  ||||||||||||||| |||||    
> |||| |
> Sbjct: 790   
> atgcatggagcattaaatataaataaaatgaaaaactaattgcacggtttgcatgaaaat 731
>
>
> Query: 1599 gtcgagacgaattttttgagtctagttaggccat 1632
>               ||||| |||| ||||||||||| |||| ||||
> Sbjct: 730  cgcgagatgaatcttttgagtctatttagtccat 697
>
>
>
>  Score = 44.1 bits (22), Expect = 0.038
>  Identities = 73/90 (81%)
>  Strand = Plus / Plus
>
>
> Query: 2026  
> actaactagaattaaaagattcgtctcgtcatttacagacaaactgtgtaattagttttt 2085
>             ||||| |||| | ||||||||| |||||  |||| ||  ||||| |||  
> |||||||||||
> Sbjct: 701   
> actaaatagactcaaaagattcatctcgcgattttcatgcaaaccgtgcaattagttttt 760
>
>
> Query: 2086 gttttcgtctatatttaatgcttcatgcat 2115
>               |||  | ||||||||||||| |||||||
> Sbjct: 761  cattttatttatatttaatgctccatgcat 790
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign






More information about the Bioperl-l mailing list