[Bioperl-l] question about clustalw module.

Frédéric Romagné frederic.romagne at gmail.com
Wed Apr 9 16:45:50 EDT 2008


Hello,

i have a problem when using Bio::Tools::Run::Alignment::Clustalw :

I give it an array_ref scalar (the array contains some fasta sequences)
and all the good parameters and i write the result via  Bio::SeqIO.

The fact is that my result file only contains the Accession number in
the header... An example :

the initial stream is : 

>NM_052854 Homo sapiens cAMP responsive element binding protein 3-like 1
(CREB3L1), mRNA.
AGAAGACGTGCGGAGGGAGACGCAGAGACAGAGGAGAGGCCGGCAGCCACCCAGTCTCGG
GGGAGCACTTAGCTCCCCCGCCCCGGCTCCCACCCTGTCCGGGGGGCTCCTGAAGCCCTC
AGCCCCAACCCCGGGCTCCCCATGGAAGCCAGCTGTGCCCCAGGAGGAGCAGGAGGAGGT
GGAGTCGGCTGAATGCCCACGGTGCGCCCGGGGCCCCTGAGCCCATCCCGCTCCTAGCCG
CTGCCCTAAGGCCCCCGCGCGCCCCGCGCCCCCCACCCGGGGCCGCGCCGCCTCCGTCCG
CCCCTCCCCCGGGGCTTCGCCCCGGACCTGCCCCCCGCCCGTTTGCCAGCGCTCAGGCAG
GAGCTCTGGACTGGGCGCGCCGCCGCCCTGGAGTGAGGGAAGCCCAGTGGAAGGGGGTCC
CGGGAGCCGGCTGCGATGGACGCCGTCTTGGAACCCTTCCCGGCCGACAGGCTGTTCCCC
GGATCCAGCTTCCTGGACTTGGGGGATCTGAACGAGTCGGACTTCCTCAACAATGCGCAC

...

the result file is :

>NM_052854
---------------------------------------AGAAGACGTGCGGAGGGAGAC
GCAGAGACAGAGGAGAGGCCGGCAGCCACCCAGTCTCGGGGGAGCACTTAGCTCCCCCGC
CCCGGCTCCCACCCTGTCCGGGGGGCTCCTGAAGCCCTCAGCCCCAACCCCGGGCTCCCC
ATGGAAGCCAGCTGTGCCCCAGGAGGAGCAGGAGGAGGTGGAGTCGGCTGAATGCCCACG
GTGCGCCCGGGGCCCCTGAGCCCATCCCGCTCCTAGCCGCTGCCCTAAGGCCCCCGCGCG
CCCCGCGCCCCCCACCCGGGGCCGCGCCGCCTCCGTCCGCCCCTCCCCCGGGGCTTCGCC
CCGGACCTGCCCCCCGCCCGTTTGCCAGCGCTCAGGCAGGAGCTCTGGACTGGGCGCGCC
GCCGCCCTGGAGTGAGGGAAGCCCAGTGGAAGGGGGTCCCGGGAGCCGGCTGCGATGGAC

...

So i lost the other informations provided by the header...

Is there any option to keep these informations?

Here is a part of my code with my options :


 my $seq_ref=\@seq;
 my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM', 'quiet' => 1,
		'output' => 'FASTA');
 my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params);
 my $aln = $factory->align($seq_ref);


Thank you.



More information about the Bioperl-l mailing list