[Bioperl-l] question about clustalw module.

Jason Stajich jason at bioperl.org
Wed Apr 9 16:55:13 EDT 2008


the clustal alignment format does not allow for the description - if  
you want to preserve it you'll have to add it back, make a hash  
indexed by sequence ID and store the description, then when you get  
your alignment back you can update the description field before  
writing it out with AlignIO.

-jason
On Apr 9, 2008, at 1:45 PM, Frédéric Romagné wrote:

> Hello,
>
> i have a problem when using Bio::Tools::Run::Alignment::Clustalw :
>
> I give it an array_ref scalar (the array contains some fasta  
> sequences)
> and all the good parameters and i write the result via  Bio::SeqIO.
>
> The fact is that my result file only contains the Accession number in
> the header... An example :
>
> the initial stream is :
>
>> NM_052854 Homo sapiens cAMP responsive element binding protein 3- 
>> like 1
> (CREB3L1), mRNA.
> AGAAGACGTGCGGAGGGAGACGCAGAGACAGAGGAGAGGCCGGCAGCCACCCAGTCTCGG
> GGGAGCACTTAGCTCCCCCGCCCCGGCTCCCACCCTGTCCGGGGGGCTCCTGAAGCCCTC
> AGCCCCAACCCCGGGCTCCCCATGGAAGCCAGCTGTGCCCCAGGAGGAGCAGGAGGAGGT
> GGAGTCGGCTGAATGCCCACGGTGCGCCCGGGGCCCCTGAGCCCATCCCGCTCCTAGCCG
> CTGCCCTAAGGCCCCCGCGCGCCCCGCGCCCCCCACCCGGGGCCGCGCCGCCTCCGTCCG
> CCCCTCCCCCGGGGCTTCGCCCCGGACCTGCCCCCCGCCCGTTTGCCAGCGCTCAGGCAG
> GAGCTCTGGACTGGGCGCGCCGCCGCCCTGGAGTGAGGGAAGCCCAGTGGAAGGGGGTCC
> CGGGAGCCGGCTGCGATGGACGCCGTCTTGGAACCCTTCCCGGCCGACAGGCTGTTCCCC
> GGATCCAGCTTCCTGGACTTGGGGGATCTGAACGAGTCGGACTTCCTCAACAATGCGCAC
>
> ...
>
> the result file is :
>
>> NM_052854
> ---------------------------------------AGAAGACGTGCGGAGGGAGAC
> GCAGAGACAGAGGAGAGGCCGGCAGCCACCCAGTCTCGGGGGAGCACTTAGCTCCCCCGC
> CCCGGCTCCCACCCTGTCCGGGGGGCTCCTGAAGCCCTCAGCCCCAACCCCGGGCTCCCC
> ATGGAAGCCAGCTGTGCCCCAGGAGGAGCAGGAGGAGGTGGAGTCGGCTGAATGCCCACG
> GTGCGCCCGGGGCCCCTGAGCCCATCCCGCTCCTAGCCGCTGCCCTAAGGCCCCCGCGCG
> CCCCGCGCCCCCCACCCGGGGCCGCGCCGCCTCCGTCCGCCCCTCCCCCGGGGCTTCGCC
> CCGGACCTGCCCCCCGCCCGTTTGCCAGCGCTCAGGCAGGAGCTCTGGACTGGGCGCGCC
> GCCGCCCTGGAGTGAGGGAAGCCCAGTGGAAGGGGGTCCCGGGAGCCGGCTGCGATGGAC
>
> ...
>
> So i lost the other informations provided by the header...
>
> Is there any option to keep these informations?
>
> Here is a part of my code with my options :
>
>
>  my $seq_ref=\@seq;
>  my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM', 'quiet' => 1,
> 		'output' => 'FASTA');
>  my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params);
>  my $aln = $factory->align($seq_ref);
>
>
> Thank you.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




More information about the Bioperl-l mailing list