[Bioperl-l] Can't parse blast report written by Bio::SearchIO::Writer::TextResultWriter

Prachi Shah prachi at stanford.edu
Thu May 8 18:35:30 EDT 2008


> I suspect somehow you are not reconstituting the Hit or Result objects properly,
> but I didn't try and debug this myself.

Its possible, but I haven't been to point out what is going wrong. But
then, the writer object is able to write the report without incident.
I am at a loss.

> You can specify a sort order function to the Result object now to specify the Hit order,
> maybe we should add sort function to Hit object for retrieving the underlying HSPs in a
> programmable order.  Seems like that would be a cleaner fix.

That would be ideal! But, until that is available, I will have to
make-do with such a solution.

Thanks,
Prachi


> On May 8, 2008, at 1:54 PM, Prachi Shah wrote:
>
>> Hi all,
>>
>> I am trying to order of HSPs within each BLAST Hit in the order of
>> ascending P-values. So, I parse my WU-BLAST report using Bio::SearchIO
>> and create new Result, Hit and HSP objects in the order and then write
>> out another BLAST report with the
>> Bio::SearchIO::Writer::TextResultWriter module. All this works fine.
>> But, when I try to parse this new blast report with
>> Bio::SearchIO::blast, I get the following error:
>>
>> ------------- EXCEPTION  -------------
>> MSG: no data for midline Query: 0       1
>> STACK Bio::SearchIO::blast::next_result
>> /tools/perl/5.6.1/lib/site_perl/5.6.1/Bio/SearchIO/blast.pm:1151
>> STACK toplevel bin/testBlastParse.pl:12
>> --------------------------------------
>>
>> I have copied below sample sections of both blast reports and the
>> code. Any hints/ pointers/ suggestions are greatly appreciated.
>>
>> Thanks,
>> Prachi
>>
>>
>>
>> The old vs new blast reports look slightly different, esp. note the
>> HSP start and stop coordinates for the QUERY sequence.
>>
>> **Snippet of OLD blast report (generated by WU-BLAST):
>> ----------------------------------------------------------------------------------------------------
>> Query=  orf19.4890
>>        (4931 letters)
>>
>> Database:  Ca21_Chromosomes
>>           9 sequences; 14,324,492 total letters.
>> Searching....10....20....30....40....50....60....70....80....90....100% done
>>
>> WARNING:  hspmax=1000 was exceeded by 8 of the database sequences, causing the
>>          associated cutoff score, S2, to be transiently set as high as 113.
>>
>>                                                                     Smallest
>>                                                                       Sum
>>                                                              High  Probability
>> Sequences producing High-scoring Segment Pairs:              Score  P(N)      N
>>
>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)         24655  0.        1
>> Ca21chr5 Assembly 21, Ca21chr5 (1190941 nucleotides)          1682  3.4e-68   3
>> Ca21chr6 Assembly 21, Ca21chr6 (1033553 nucleotides)           908  3.0e-34   3
>> Ca21chr2 Assembly 21, Ca21chr2 (2232049 nucleotides)           859  4.7e-30   1
>> Ca21chr7 Assembly 21, Ca21chr7 (949626 nucleotides)            492  7.3e-24   3
>> Ca21chr4 Assembly 21, Ca21chr4 (1603475 nucleotides)           528  9.8e-21   2
>> Ca21chrR Assembly 21, Ca21chrR (2286425 nucleotides)           520  1.4e-19   5
>> Ca21chr3 Assembly 21, Ca21chr3 (1799426 nucleotides)           502  1.7e-14   2
>> Ca19-mtDNA Assembly 19, Ca19-mtDNA (40420 nucleotides)         313  2.9e-06   2
>>
>>
>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)
>>
>>        Length = 3,188,577
>>
>>  Plus Strand HSPs:
>>
>>  Score = 506 (82.0 bits), Expect = 4.9e-14, P = 4.9e-14
>>  Identities = 850/1549 (54%), Positives = 850/1549 (54%), Strand = Plus / Plus
>>
>> Query:   3450 ATGCATATGGTAATGTTAA-AATCACTGATTTTGGA-TTTTGTGCTAAATTAAC-T-GAT 3505
>>              | | ||| | | || |||| |||  ||||| ||| | ||||| || |  || |  | | |
>> Sbjct: 155924 AGGGATACGATTAT-TTAAGAATT-CTGATATTGAAATTTTG-GC-ATTTTCATATAGTT
>> 155979
>>
>> Query:   3506 CAAAGA--AATAAACGTGCC-ACAATGGTGGGGACACCATATTGG-ATGGCACCTGAAGT 3561
>>              |||| |  ||||||  |    | |||| ||     | ||| | |  |||   |  | | |
>> Sbjct: 155980 CAAACATTAATAAATATATTGAAAATGTTGATTTAATCAT-TAGTCATG---CTGGTACT
>> 156035
>>
>> Query:   3562 GGTTAAACAAAAGGAATATGATGAAAAAGTTGATGTTTGGTCATTGGGGATTATGACTAT 3621
>>              || | ||  |  |  || || | | |   ||||   |    ||||     ||||   ||
>> Sbjct: 156036 GGATCAATCATTG--AT-TGTTTACAT--TTGAA--TAAACCATTAATTGTTATTGTTAA
>> 156088
>>
>> Query:   3622 TGAAATGATTGAAGGAGAACCACCTTATTTGAA-T-GAAGAACCATTAAAAGCATTATAT 3679
>> ----------------------------------------------------------------------------------------------------
>>
>> **Snippet of NEW blast report (generated using
>> Bio::SearchIO::Writer::TextResultWriter)
>> ----------------------------------------------------------------------------------------------------
>> uery= orf19.4890
>>       (4,931 letters)
>>
>> Database: Ca21_Chromosomes
>>           9 sequences; 14,324,492 total letters
>>
>>                                                                 Score       E
>> Sequences producing significant alignments:                      (bits)    value
>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)                24655  0.
>> Ca21chr5 Assembly 21, Ca21chr5 (1190941 nucleotides)
>> 1682  3.4e-68
>> Ca21chr6 Assembly 21, Ca21chr6 (1033553 nucleotides)
>> 908   3.0e-34
>> Ca21chr2 Assembly 21, Ca21chr2 (2232049 nucleotides)
>> 859   4.7e-30
>> Ca21chr7 Assembly 21, Ca21chr7 (949626 nucleotides)
>> 492   7.3e-24
>> Ca21chr4 Assembly 21, Ca21chr4 (1603475 nucleotides)
>> 528   9.8e-21
>> Ca21chrR Assembly 21, Ca21chrR (2286425 nucleotides)
>> 520   1.4e-19
>> Ca21chr3 Assembly 21, Ca21chr3 (1799426 nucleotides)
>> 502   1.7e-14
>> Ca19-mtDNA Assembly 19, Ca19-mtDNA (40420 nucleotides)
>> 313   2.9e-06
>>
>>
>>> Ca21chr1 Assembly 21, Ca21chr1 (3188577 nucleotides)
>>
>>         Length = 3188577
>>
>>  Score = 3705.3 bits (24655), Expect = 0., P = 0.
>>  Identities = 4931/4931 (100%)
>>  Frame =  -1 / +1
>>
>> Query: 1       ATAAAGGATGCCAAATAGTAGTAGTAAAATAGTAAATAGAATTGCAAAACAAAAATGATT -58
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248574 ATAAAGGATGCCAAATAGTAGTAGTAAAATAGTAAATAGAATTGCAAAACAAAAATGATT
>> 2248633
>>
>> Query: -59     AAATAGCCCTTTATCAATAAATTTTTAAAGTTAGTTTCTTCTGGAACCCTACCCTCTTGG -118
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248634 AAATAGCCCTTTATCAATAAATTTTTAAAGTTAGTTTCTTCTGGAACCCTACCCTCTTGG
>> 2248693
>>
>> Query: -119    TGTTAATCTTTTAAGTTAATATTTATAGTTAATAAAGTAGAAGTGTCTATTTATTGATTG -178
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248694 TGTTAATCTTTTAAGTTAATATTTATAGTTAATAAAGTAGAAGTGTCTATTTATTGATTG
>> 2248753
>>
>> Query: -179    TTGTTGTTGTTGATTAAGAATATAAAGAAAAACAGAAAAGAAAAAAAGAAGGTTTAAAAA -238
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248754 TTGTTGTTGTTGATTAAGAATATAAAGAAAAACAGAAAAGAAAAAAAGAAGGTTTAAAAA
>> 2248813
>>
>> Query: -239    AGTTAATTGTGAAGTAAAAGGGTTGAAAAATTTTTTTTTTTTCTGTTTCTCTCTTTGAGA -298
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248814 AGTTAATTGTGAAGTAAAAGGGTTGAAAAATTTTTTTTTTTTCTGTTTCTCTCTTTGAGA
>> 2248873
>>
>> Query: -299    TTCTTTGACATATTTATTATTATAACACTATGCTATACTAAAAACAGTACTACCAATTGA -358
>>               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct: 2248874 TTCTTTGACATATTTATTATTATAACACTATGCTATACTAAAAACAGTACTACCAATTGA
>> 2248933
>>
>> Query: -359    ATTAAATTAAATTAAATTAAATTAAATTATTAGACCAATTTCAATAAAGATAAGCAATTT -418
>>
>> ----------------------------------------------------------------------------------------------------
>>
>> **Here is the snippet of code that reads the old report, generates new
>> objects and writes new report:
>> ----------------------------------------------------------------------------------------------------
>>    my $blast_report = Bio::SearchIO->new(-format => 'blast',
>>                      -file   => $blastOutputTmp);
>>
>>    my $writer =
>> Bio::SearchIO::Writer::TextResultWriter->new(-no_wublastlinks => 0);
>>    my $out_blast_report = Bio::SearchIO->new(-writer => $writer,
>>                          -file   => ">$blastOutputFile");
>>
>>    my $sorted_blast_report;
>>
>>    while( my $result = $blast_report->next_result ) {
>>
>>        my (%parameters, %statistics);
>>
>>    foreach my $param ($result->available_parameters) {
>>
>>        $parameters{$param} = $result->get_parameter($param);
>>    }
>>
>>    foreach my $stat ($result->available_statistics) {
>>
>>        $statistics{$stat} = $result->get_statistic($stat);
>>    }
>>
>>        my $generic_result =
>> Bio::Search::Result::BlastResult->new(-query_name          =>
>> $result->query_name,
>>                                   -query_length        =>
>> $result->query_length,
>>                                   -database_name       =>
>> $result->database_name,
>>                                   -database_entries    =>
>> $result->database_entries,
>>                                   -parameters          => \%parameters,
>>                                   -statistics          => \%statistics,
>>                                   -algorithm           => $result->algorithm,
>>                                   -query_description   =>
>> $result->query_description,
>>                                   -algorithm_reference =>
>> $result->algorithm_reference,
>>                                   -algorithm_version   =>
>> $result->algorithm_version,
>>                                   -database_letters    =>
>> $result->database_letters);
>>
>>        while( my $hit = $result->next_hit ) {
>>
>>        my $generic_hit = Bio::Search::Hit::BlastHit->new(-name
>>  => $hit->name,
>>                                  -algorithm    => $hit->algorithm,
>>                                  -description  => $hit->description,
>>                                  -length       => $hit->length,
>>                                  -score        => $hit->score,
>>                                  -bits         => $hit->bits,
>>                                  -significance => $hit->significance);
>>
>>        my (@hsp_sorted, @hsps);
>>            while( my $hsp = $hit->next_hsp ) {
>>
>>            push(@hsps, $hsp);
>>        }
>>
>>        @hsp_sorted = sort {$a->pvalue <=> $b->pvalue} @hsps;
>>
>>        for(my $i=0; $i<=$#hsp_sorted; $i++) {
>>
>>            $generic_hit->add_hsp($hsp_sorted[$i]);
>>
>>        }
>>
>>        $generic_result->add_hit($generic_hit);
>>
>>    }
>>
>>    $out_blast_report->write_result($generic_result);
>>
>>    }
>> ----------------------------------------------------------------------------------------------------
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


More information about the Bioperl-l mailing list