[Bioperl-l] SeqIO & multi-line fastq

Tristan Lefebure tristan.lefebure at gmail.com
Fri Nov 7 15:59:07 EST 2008


Hi there,

I'm parsing with SeqIO a FastQ file made by MAQ. SeqIO complains because
this is a multiline fastq file. By looking at the Bio::SeqIO::fastq,
it's pretty obvious that it can't handle multilines. Who is wrong? MAQ,
SeqIO, or am I missing something?

Some more details below:

###
[tristan at trudy maq_easyrun] seq2seq.pl cns.fq fastq cns.fna fasta

------------- EXCEPTION -------------
MSG: AACTATTTATCAAATTTAAAATTCAACGAAAAACAAAGCAAAGCAGATCTTTTAGTTTTT
doesn't match fastq descriptor line type
STACK
Bio::SeqIO::fastq::next_seq /usr/local/share/perl/5.10.0/Bio/SeqIO/fastq.pm:113
STACK toplevel /home/tristan/bin/seq2seq.pl:25
-------------------------------------
###

The fastq file looks like that:
-----------
@nctc11168
atgAATCCAAGCCAAATACTTGAAAATTTAAAAAAAGAATTAAGTGAAAACGAATACGAA
AACTATTTATCAAATTTAAAATTCAACGAAAAACAAAGCAAAGCAGATCTTTTAGTTTTT
AATGCTCCAAATGAACTCATGGCTAAATTCATACAAACAAAATACGGCAAAAAAATCGCG
CATTTTTATGAAGTGCAAAGCGGAAATAAAGCCATCATAAATATACAAGCACAAAGTGCT
AAACAAAGCAACAAAAGCACAAAAATCGACATAGCTCATATAAAAGCACAAAGCACGATT
TTAAATC[...]
[some 20000 lines later]
AACCTTTTTTTATAAAATTTAAGATAAAATTTATACATTATGCAAAATTTAAAGAGAgat
n
+
EQWWZ`cffilmu~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~[...]
---------

Thanks!

-Tristan






More information about the Bioperl-l mailing list