[Bioperl-l] problem with Bio::Das::FeatureTypeI::name
Vincenza Maselli
vincenza.maselli at gmail.com
Tue Oct 21 06:34:21 EDT 2008
Dear All
I tried to write a simple script to write a gff file, but my script dead
when try to execute the method _write_feature_3 in the gff.pm module but I
got this message:
Abstract method "Bio::Das::FeatureTypeI::name" is not implemented by package
Bio::DB::GFF::Typename.
This is not your fault - author of Bio::DB::GFF::Typename should be
blamed!
Do you have any suggestion to overcome this problem? Did someone implemented
it?
Thanks for the help
Vincenza
================== START CODE
==============================================================================
! /usr/bin/perl
use strict;
use DBI;
use DBD::mysql;
use Data::Dumper;
use Bio::FeatureIO;
use Bio::DB::GFF;
use Bio::DB::GFF::Featname;
use Bio::SeqFeature::Generic;
my $hostname = 'localhost';
my $user = 'user';
my $password = 'passwd';
my $dsn = "dbi:mysql:database=dbname;host=$hostname";
my $dbh = DBI->connect($dsn, $user, $password,{PrintError=>0,RaiseError=>0})
|| die "Can't connect to database:$DBI::errstr\n";
my $out = Bio::FeatureIO->new(-file => ">>test.gff" ,
-format => 'GFF' ,
-version => 3);
# queries
my $sql = qq{SELECT d.fid, d.fref, d.fstart, d.fstop, d.fbin, d.fscore,
d.fstrand, d.fphase, d.ftarget_start, d.ftarget_stop,
t.fmethod, t.fsource,
g.gid,g.gclass,g.gname
FROM fdata d, ftype t, fgroup g
WHERE d.ftypeid = t.ftypeid
AND d.gid = g.gid
LIMIT 1};
my $sth = $dbh->prepare($sql);
$sth->execute;
# create GFF adaptor
my $gff_adaptor = Bio::DB::GFF->new(-dsn => $dsn,
-user => $user,
-pass => $password);
#initialize variables for feature object
my $factory = $gff_adaptor; #a Bio::DB::GFF adaptor object (or
descendent)
while (my $ref = $sth->fetchrow_hashref){
my $srcseq = "ATGCGGATAGACGATAGCGATAACCTATAGTAGATCCGCTCGATCGTAGC";
#the source sequence
my $start = $ref->{'fstart'}; #start of this feature
my $stop = $ref->{'fstop'}; #stop of this feature
my $method = $ref->{'fmethod'}; #this feature's GFF method
my $source = $ref->{'fsource'}; #this feature's GFF source
my $score = $ref->{'fscore'}; #this feature's score
my $fstrand = $ref->{'fstrand'}; #this feature's strand (relative to
the source sequence, which has its own strandedness!)
my $phase = $ref->{'fphase'}; #this feature's phase
my $group = Bio::DB::GFF::Featname->new(-class => $ref->{'gclass'},-name
=> $ref->{'gname'}); #this feature's group
my $db_id = $ref->{'fid'}; #this feature's internal database ID
my $group_id = $ref->{'gid'};
my $tstart = $ref->{'ftarget_start'};
my $tstop = $ref->{'ftarget_stop'};
#create feature object
my $feat = Bio::DB::GFF::Feature->new(
$factory,
$srcseq,
$start,
$stop,
$method,
$source,
$score,
$fstrand,
$phase,
$group,
$db_id,
$group_id,
$tstart,
$tstop);
#write out features
my $seq_feat = Bio::SeqFeature::Generic->new( -gff3_string =>
$feat->gff3_string );
my $annseq = Bio::SeqFeature::Annotated->new(-start => $start,
-end => $stop,
-phase => $phase);
$annseq->add_SeqFeature($feat);
$out->write_feature($annseq);
}
=========================== START RETURN
============================================================
>$ perl
create_gff.pl
------------- EXCEPTION: Bio::Root::NotImplemented -------------
MSG: Abstract method "Bio::Das::FeatureTypeI::name" is not implemented by
package Bio::DB::GFF::Typename.
This is not your fault - author of Bio::DB::GFF::Typename should be
blamed!
STACK: Error::throw
STACK: Bio::Root::Root::throw
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Root/Root.pm:357
STACK: Bio::Root::RootI::throw_not_implemented
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Root/RootI.pm:680
STACK: Bio::Das::FeatureTypeI::name
/usr/local/lib/perl5/site_perl/5.10.0/Bio/Das/FeatureTypeI.pm:142
STACK: Bio::FeatureIO::gff::_write_feature_3
/usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:884
STACK: Bio::FeatureIO::gff::_write_feature_3
/usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:934
STACK: Bio::FeatureIO::gff::write_feature
/usr/local/lib/perl5/site_perl/5.10.0/Bio/FeatureIO/gff.pm:263
STACK: create_gff.pl:86
----------------------------------------------------------------
=====================================================================================================
--
Vincenza Maselli
Dept. of Soil, Plant, Environmental and Animal Production Sciences
University of Naples "Federico II"
Via Universita' 100
Parco Gussone - building number 75 "GenoPom"
80055 Portici, Naples, Italy
phone: +39-081-2539246
web: http://cab.unina.it
More information about the Bioperl-l
mailing list