[Bioperl-l] SearchIO: Features in/flanking this part of asubject sequence

Mark A. Jensen maj at fortinbras.us
Wed Apr 29 19:48:10 EDT 2009


also check out http://www.bioperl.org/wiki/Parsing_BLAST_HSPs
MAJ
----- Original Message ----- 
From: "Chris Fields" <cjfields at illinois.edu>
To: "Razi Khaja" <razi.khaja at gmail.com>
Cc: <bioperl-l at lists.open-bio.org>
Sent: Wednesday, April 29, 2009 3:41 PM
Subject: Re: [Bioperl-l] SearchIO: Features in/flanking this part of asubject 
sequence


> I'm assuming this is from an older bioperl; this data should be  accessible 
> via $hsp->hit_features in the latest code fromo svn (and I  believe in bioperl 
> 1.6.0 in CPAN).
>
> chris
>
> On Apr 29, 2009, at 2:08 PM, Razi Khaja wrote:
>
>> Hello,
>>
>> I am generating BLAST alignments using the BLAST URL API from NCBI.
>>
>> I want to parse details from BLAST reports whenever there are
>> "Features in/flanking this part of subject sequence".  A portion of
>> the BLAST report showing "Features flanking ..." is pasted below.
>>
>> I am using Bio::SearchIO to parse details.  The relevant part of the
>> script is below.
>>
>> The problem I am having is that for some reason the first occurrence
>> of a "Feature flanking this part of a subject sequence" is skipped.
>> I am only able to parse/print all occurrences of a "Feature
>> in/flanking this part of a subject sequence" from the second
>> occurrence to the last occurrence.
>>
>> I believe the code responsible for parsing this information is in
>> Bio/SearchIO/blast.pm, starting on line 760.
>> I have tried fixing the code in Bio/SearchIO/blast.pm myself but was
>> not able to correct the problem.
>> Would it be possible for someone to fix the code in the
>> Bio/SearchIO/blast.pm module, or help me fix the code so that the
>> first occurrence is not skipped?
>>
>> Thanks,
>> Razi
>
>
>
>> ===== The part of the script that is relevant to parsing "Features
>> in/flanking..." ====
>> my $bio_searchio_in = Bio::SearchIO->new(
>>     -file   => 'blast_result.txt',
>>     -format => 'blast'
>> );
>>
>> my $i = 1;
>> while( my $result = $bio_searchio_in->next_result() ){
>>     while( my $hit = $result->next_hit() ){
>>         while( my $hsp = $hit->next_hsp() ){
>>             my $hsp_features = $hsp->hit_features();
>>             if( $hsp_features ) {
>>                 print "HSP FEATURE $i\t$hsp_features\n";
>>                 $i++;
>>             }
>>         }
>>     }
>> }
>>
>> ===== A portion of a BLAST report with "Features flanking ..." =====
>> ...
>> ...
>>  Score = 54.7 bits (29),  Expect = 0.003
>>  Identities = 29/29 (100%), Gaps = 0/29 (0%)
>>  Strand=Plus/Minus
>>
>> Query  6556     CCTGGGTGACAGAGTGAGACTCCATCTCA  6584
>>                 |||||||||||||||||||||||||||||
>> Sbjct  6953042  CCTGGGTGACAGAGTGAGACTCCATCTCA  6953014
>>
>>
>>> gi|51459264|ref|NT_077382.3|Hs1_77431 Homo sapiens chromosome 1  genomic 
>>> contig
>> Length=237250
>>
>>  Features flanking this part of subject sequence:
>>    16338 bp at 5' side: PRAME family member 8
>>    11926 bp at 3' side: PRAME family member 9
>>
>>  Score = 7286 bits (3945),  Expect = 0.0
>>  Identities = 5437/6145 (88%), Gaps = 152/6145 (2%)
>>  Strand=Plus/Plus
>>
>> Query  23225   GGTTGGTTAATATTGATAATTAAATGACTTGGTACTGAGAAGAAGCTATAGGTGCAAATG
>> 23284
>>               |||||||||||||||||||||||||||||||| |||||| |||||||||||  ||||||||
>> Sbjct  86128   GGTTGGTTAATATTGATAATTAAATGACTTGGCACTGAGCAGAAGCTATAGATGCAAATG
>> 86187
>>
>> Query  23285   GGTGGCCTATGACTATTATTGATTTCATTACTGGTAATTTATCTCTATGCCTAGAAAACA
>> 23344
>>               ||||||||||||||||| |||||||||||||| |||| ||||||| |||| |||  |||||
>> Sbjct  86188   GGTGGCCTATGACTATTGTTGATTTCATTACTTGTAACTTATCTCCATGCATAGGAAACA
>> 86247
>> ...
>> ...
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 



More information about the Bioperl-l mailing list