[Bioperl-l] Help: How to output the

Jason Stajich jason at bioperl.org
Fri Jan 23 12:20:49 EST 2009


Wen-Zhi -
I strongly encourage you to use it for these types of general questions.

There are several options available to the seq_inds methods which  
allows you to choose query or subject and the type of sequence  
matching: identical, conserved, nomatch, gap
For DNA identical and conserved will be the same result.

You can get the coordinates in either query or hit coordinates with  
the 1st argument - there has been some improvements to this code since  
1.5 series so I would encourage you to get the 1.6 release that is  
alpha stage of release.

Here is the documentation for the method:

  Title   : seq_inds
  Purpose   : Get a list of residue positions (indices) for all  
identical
            : or conserved residues in the query or sbjct sequence.
  Example   : @s_ind = $hsp->seq_inds('query', 'identical');
            : @h_ind = $hsp->seq_inds('hit', 'conserved');
            : @h_ind = $hsp->seq_inds('hit', 'conserved', 1);
  Returns   : List of integers
            : May include ranges if collapse is true.
  Argument  : seq_type  = 'query' or 'hit' or 'sbjct'  (default = query)
               ('sbjct' is synonymous with 'hit')
              class     = 'identical' or 'conserved' or 'nomatch' or  
'gap'
                           (default = identical)
                           (can be shortened to 'id' or 'cons')

              collapse  = boolean, if true, consecutive positions are  
merged
                          using a range notation, e.g., "1 2 3 4 5 7 9  
10 11"
                          collapses to "1-5 7 9-11". This is useful for
                          consolidating long lists. Default = no  
collapse.

-jason

On Jan 23, 2009, at 8:05 AM, Wen-Zhi WANG wrote:

> Dear Jason,
>
> I'm a new guy of bioperl. These days I try to output the unmatched  
> bases (DNA vs. DNA) report with special format, which like
>      A73G  T195C  A234G  A263G C249-  -309C. ([ATCGN-]\d+[ATCGRYN-])
>     The first letter indicates nt base of subject, following integer  
> is the unmatch base index accoring subject, the last letter is the  
> nt base of query sequence. "-" stands for gap (-309C is an ins  
> according subject, C249- is a del on the other hand).
> Bio::Search::Hit::HitI::seq_inds() method seems the right tool of  
> this mission. However, it only gives the nomatch location(s). Is  
> there some method could return sbjct ind base/aa, query ind base/aa  
> and the nomatch location according either sbjct or query?
>
> Thank you very much!
> Happy Chinese New Year!
>
> my perl script is:
> ====================
> #!/usr/bin/perl
> use Bio::SearchIO;
>
> my $file = './test.fasta';
> my $in = new Bio::SearchIO(-format => 'fasta', -file => $file);
> my $r = $in->next_result;
> my $h = $r->next_hit;
> my @inds = ();
> while( my $hsp = $h->next_hsp ) {
>     push @inds, $hsp->seq_inds('hit' => 'nomatch', 1);
> }
> print ">", $r->query_name, "\t", $r->query_description, "\n";
> print "@inds\n";
>
> exit(0);
> __END__
>
> The Fasta output report:
> ==================
> # fasta35 DQ272107.fas AC_000021.fas
> FASTA searches a protein or DNA sequence data bank
>  version 35.04 Aug. 28, 2008
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
> Query: DQ272107.fas
>   1>>>gi|78775891|gb|DQ272107.1| Homo sapiens isolate QH9505  
> mitochondrion, compl - 16570 nt
> Library: AC_000021.fas   16569 residues in     1 sequences
>   16569 residues in     1 sequences
> Statistics: (shuffled [500]) MLE statistics: Lambda= 0.0840;   
> K=5.185e-06
> Algorithm: FASTA (3.5 Sept 2006) [optimized]
> Parameters: +5/-4 matrix (5:-4) ktup: 6
>  join: 95, opt: 80, open/ext: -12/-4, width:  16
>  Scan time:  3.420
> The best scores are:                                      opt bits  
> E(1)
> gi|115315570|ref|AC_000021.2| Homo sapiens mit (16569) [f] 82516  
> 10011.5       0
> gi|115315570|ref|AC_000021.2| Homo sapiens mit (16569) [r]   88  
> 28.2    0.59
>>> gi|115315570|ref|AC_000021.2| Homo sapiens mitochondri  (16569 nt)
>  initn: 68614 init1: 67103 opt: 82516  Z-score: 54000.5  bits:  
> 10011.5 E():    0
> banded Smith-Waterman score: 82516; 99.8% identity (99.8% similar)  
> in 16571 nt overlap (1-16570:1-16569)
>                10        20        30        40        50        60
> gi|787 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
>                10        20        30        40        50        60
>                70        80        90       100       110       120
> gi|787 CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
>        :::::::::::: :::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
>                70        80        90       100       110       120
>               130       140       150       160       170       180
> gi|787 GCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATT
>               130       140       150       160       170       180
>               190       200       210       220       230       240
> gi|787 ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
>        :::::::::::::: :::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
>               190       200       210       220       230       240
>               250       260       270       280       290       300
> gi|787 ACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCA
>        :::::::::::::::::::::: :::::::::::::::::::::::::::::::::::::
> gi|115 ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCA
>               250       260       270       280       290       300
>               310       320       330       340       350       360
> gi|787 AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAA
>        :::::::::   ::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACCCCCCC--TCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAA
>                 310       320       330       340       350
>               370       380       390       400       410       420
> gi|787 AAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGC
>       360       370       380       390       400       410
>               430       440       450       460       470       480
> gi|787 ACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTA
>       420       430       440       450       460       470
>               490       500       510       520       530       540
> gi|787 ATCTCATCAACACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCA
>        :::::::::: :::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCA
>       480       490       500       510       520       530
>               550       560       570       580       590       600
> gi|787 TACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCA
>       540       550       560       570       580       590
>               610       620       630       640       650       660
> gi|787 AAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGG
>       600       610       620       630       640       650
>               670       680       690       700       710       720
> gi|787 TCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGA
>       660       670       680       690       700       710
>               730       740       750       760       770       780
> gi|787 GTTCACCCTCTAAATCACCACGATCAAAAGGGACAAGCATCAAGCACGCAGCAATGCAGC
>        ::::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::
> gi|115 GTTCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGCAATGCAGC
>       720       730       740       750       760       770
>               790       800       810       820       830       840
> gi|787 TCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAAT
>       780       790       800       810       820       830
>               850       860       870       880       890       900
> gi|787 AAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACC
>       840       850       860       870       880       890
>               910       920       930       940       950       960
> gi|787 GCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCC
>       900       910       920       930       940       950
>               970       980       990      1000      1010      1020
> gi|787 CCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAG
>       960       970       980       990      1000      1010
>              1030      1040      1050      1060      1070      1080
> gi|787 ACTACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAACTGGGATTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACTACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAACTGGGATTA
>      1020      1030      1040      1050      1060      1070
>              1090      1100      1110      1120      1130      1140
> gi|787 GATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAG
>      1080      1090      1100      1110      1120      1130
>              1150      1160      1170      1180      1190      1200
> gi|787 AACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGA
>      1140      1150      1160      1170      1180      1190
>              1210      1220      1230      1240      1250      1260
> gi|787 GGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATA
>      1200      1210      1220      1230      1240      1250
>              1270      1280      1290      1300      1310      1320
> gi|787 TACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAA
>      1260      1270      1280      1290      1300      1310
>              1330      1340      1350      1360      1370      1380
> gi|787 AGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCC
>      1320      1330      1340      1350      1360      1370
>              1390      1400      1410      1420      1430      1440
> gi|787 AGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTG
>        :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTA
>      1380      1390      1400      1410      1420      1430
>              1450      1460      1470      1480      1490      1500
> gi|787 AGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCC
>      1440      1450      1460      1470      1480      1490
>              1510      1520      1530      1540      1550      1560
> gi|787 TCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAA
>      1500      1510      1520      1530      1540      1550
>              1570      1580      1590      1600      1610      1620
> gi|787 GTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACA
>      1560      1570      1580      1590      1600      1610
>              1630      1640      1650      1660      1670      1680
> gi|787 CAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACC
>      1620      1630      1640      1650      1660      1670
>              1690      1700      1710      1720      1730      1740
> gi|787 TAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAGCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAAT
>      1680      1690      1700      1710      1720      1730
>              1750      1760      1770      1780      1790      1800
> gi|787 AAAGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAAGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGA
>      1740      1750      1760      1770      1780      1790
>              1810      1820      1830      1840      1850      1860
> gi|787 TGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATG
>      1800      1810      1820      1830      1840      1850
>              1870      1880      1890      1900      1910      1920
> gi|787 AATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAG
>      1860      1870      1880      1890      1900      1910
>              1930      1940      1950      1960      1970      1980
> gi|787 CTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTA
>      1920      1930      1940      1950      1960      1970
>              1990      2000      2010      2020      2030      2040
> gi|787 TAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTT
>      1980      1990      2000      2010      2020      2030
>              2050      2060      2070      2080      2090      2100
> gi|787 AGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAG
>      2040      2050      2060      2070      2080      2090
>              2110      2120      2130      2140      2150      2160
> gi|787 TCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATT
>      2100      2110      2120      2130      2140      2150
>              2170      2180      2190      2200      2210      2220
> gi|787 TAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACC
>      2160      2170      2180      2190      2200      2210
>              2230      2240      2250      2260      2270      2280
> gi|787 CACTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGACCAATCTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CACTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGACCAATCTA
>      2220      2230      2240      2250      2260      2270
>              2290      2300      2310      2320      2330      2340
> gi|787 TCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAA
>      2280      2290      2300      2310      2320      2330
>              2350      2360      2370      2380      2390      2400
> gi|787 GCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCA
>      2340      2350      2360      2370      2380      2390
>              2410      2420      2430      2440      2450      2460
> gi|787 ACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAA
>      2400      2410      2420      2430      2440      2450
>              2470      2480      2490      2500      2510      2520
> gi|787 AAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTA
>      2460      2470      2480      2490      2500      2510
>              2530      2540      2550      2560      2570      2580
> gi|787 GCATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACC
>      2520      2530      2540      2550      2560      2570
>              2590      2600      2610      2620      2630      2640
> gi|787 CTAACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCT
>      2580      2590      2600      2610      2620      2630
>              2650      2660      2670      2680      2690      2700
> gi|787 CCACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGG
>      2640      2650      2660      2670      2680      2690
>              2710      2720      2730      2740      2750      2760
> gi|787 CGGGCATGACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAATGCAAACAG
>        ::::::: ::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGGGCATAACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAATGCAAACAG
>      2700      2710      2720      2730      2740      2750
>              2770      2780      2790      2800      2810      2820
> gi|787 TACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGC
>      2760      2770      2780      2790      2800      2810
>              2830      2840      2850      2860      2870      2880
> gi|787 GACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCG
>      2820      2830      2840      2850      2860      2870
>              2890      2900      2910      2920      2930      2940
> gi|787 AACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAA
>      2880      2890      2900      2910      2920      2930
>              2950      2960      2970      2980      2990      3000
> gi|787 CAGCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAGCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGAT
>      2940      2950      2960      2970      2980      2990
>              3010      3020      3030      3040      3050      3060
> gi|787 CAGGACATCCCAATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCT
>        ::::::::::: ::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCT
>      3000      3010      3020      3030      3040      3050
>              3070      3080      3090      3100       3110
> gi|787 ACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTAC-TTCAAATTCCT
>        :::::::::::::::::::::::::::::::::::::::::::::::: :::::::::::
> gi|115 ACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACNTTCAAATTCCT
>      3060      3070      3080      3090      3100      3110
>     3120      3130      3140      3150      3160      3170
> gi|787 CCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAAT
>      3120      3130      3140      3150      3160      3170
>     3180      3190      3200      3210      3220      3230
> gi|787 GATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATG
>      3180      3190      3200      3210      3220      3230
>     3240      3250      3260      3270      3280      3290
> gi|787 GCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTC
>      3240      3250      3260      3270      3280      3290
>     3300      3310      3320      3330      3340      3350
> gi|787 TTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGG
>      3300      3310      3320      3330      3340      3350
>     3360      3370      3380      3390      3400      3410
> gi|787 CATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCA
>      3360      3370      3380      3390      3400      3410
>     3420      3430      3440      3450      3460      3470
> gi|787 ACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCA
>      3420      3430      3440      3450      3460      3470
>     3480      3490      3500      3510      3520      3530
> gi|787 AAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAG
>      3480      3490      3500      3510      3520      3530
>     3540      3550      3560      3570      3580      3590
> gi|787 CTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACC
>      3540      3550      3560      3570      3580      3590
>     3600      3610      3620      3630      3640      3650
> gi|787 TCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCT
>      3600      3610      3620      3630      3640      3650
>     3660      3670      3680      3690      3700      3710
> gi|787 GATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCC
>      3660      3670      3680      3690      3700      3710
>     3720      3730      3740      3750      3760      3770
> gi|787 AAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTG
>      3720      3730      3740      3750      3760      3770
>     3780      3790      3800      3810      3820      3830
> gi|787 GCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCAT
>      3780      3790      3800      3810      3820      3830
>     3840      3850      3860      3870      3880      3890
> gi|787 CATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCT
>      3840      3850      3860      3870      3880      3890
>     3900      3910      3920      3930      3940      3950
> gi|787 TCGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCGACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAG
>      3900      3910      3920      3930      3940      3950
>     3960      3970      3980      3990      4000      4010
> gi|787 GCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCA
>      3960      3970      3980      3990      4000      4010
>     4020      4030      4040      4050      4060      4070
> gi|787 CCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACAT
>      4020      4030      4040      4050      4060      4070
>     4080      4090      4100      4110      4120      4130
> gi|787 ATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACC
>      4080      4090      4100      4110      4120      4130
>     4140      4150      4160      4170      4180      4190
> gi|787 CCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCC
>      4140      4150      4160      4170      4180      4190
>     4200      4210      4220      4230      4240      4250
> gi|787 TAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAGCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAA
>      4200      4210      4220      4230      4240      4250
>     4260      4270      4280      4290      4300      4310
> gi|787 CCTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAAC
>      4260      4270      4280      4290      4300      4310
>     4320      4330      4340      4350      4360      4370
> gi|787 CCCCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTG
>      4320      4330      4340      4350      4360      4370
>     4380      4390      4400      4410      4420      4430
> gi|787 CCACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCC
>      4380      4390      4400      4410      4420      4430
>     4440      4450      4460      4470      4480      4490
> gi|787 CGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTA
>      4440      4450      4460      4470      4480      4490
>     4500      4510      4520      4530      4540      4550
> gi|787 CTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTG
>      4500      4510      4520      4530      4540      4550
>     4560      4570      4580      4590      4600      4610
> gi|787 AGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCC
>      4560      4570      4580      4590      4600      4610
>     4620      4630      4640      4650      4660      4670
> gi|787 TCGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCGTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCT
>      4620      4630      4640      4650      4660      4670
>     4680      4690      4700      4710      4720      4730
> gi|787 TCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTAC
>      4680      4690      4700      4710      4720      4730
>     4740      4750      4760      4770      4780      4790
> gi|787 CAATCAATACTCATCATTAATAATCATAATGGCTATAGCAATAAAACTAGGAATAGCCCC
>        :::::::::::::::::::::::::::::: :::::::::::::::::::::::::::::
> gi|115 CAATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCC
>      4740      4750      4760      4770      4780      4790
>     4800      4810      4820      4830      4840      4850
> gi|787 CTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTTTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCT
>      4800      4810      4820      4830      4840      4850
>     4860      4870      4880      4890      4900      4910
> gi|787 TCTCACATGACAAAAACTAGCCCCTATCTCAATCATATACCAAATCTCTCCCTCACTAAA
>        :::::::::::::::::::::::: :::::::::::::::::::::::::::::::::::
> gi|115 TCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAA
>      4860      4870      4880      4890      4900      4910
>     4920      4930      4940      4950      4960      4970
> gi|787 CGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATT
>      4920      4930      4940      4950      4960      4970
>     4980      4990      5000      5010      5020      5030
> gi|787 AAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAAT
>      4980      4990      5000      5010      5020      5030
>     5040      5050      5060      5070      5080      5090
> gi|787 AATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTAT
>      5040      5050      5060      5070      5080      5090
>     5100      5110      5120      5130      5140      5150
> gi|787 CCTAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACT
>      5100      5110      5120      5130      5140      5150
>     5160      5170      5180      5190      5200      5210
> gi|787 ATCTCGCACCTGAAACAAGATAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTC
>        ::::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTC
>      5160      5170      5180      5190      5200      5210
>     5220      5230      5240      5250      5260      5270
> gi|787 CCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATT
>      5220      5230      5240      5250      5260      5270
>     5280      5290      5300      5310      5320      5330
> gi|787 CACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CACAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCT
>      5280      5290      5300      5310      5320      5330
>     5340      5350      5360      5370      5380      5390
> gi|787 CTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAA
>      5340      5350      5360      5370      5380      5390
>     5400      5410      5420      5430      5440      5450
> gi|787 CGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCAT
>      5400      5410      5420      5430      5440      5450
>     5460      5470      5480      5490      5500      5510
> gi|787 CGCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATT
>      5460      5470      5480      5490      5500      5510
>     5520      5530      5540      5550      5560      5570
> gi|787 TAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCT
>      5520      5530      5540      5550      5560      5570
>     5580      5590      5600      5610      5620      5630
> gi|787 GTAACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTAACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTT
>      5580      5590      5600      5610      5620      5630
>     5640      5650      5660      5670      5680      5690
> gi|787 AATTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAG
>      5640      5650      5660      5670      5680      5690
>     5700      5710      5720      5730      5740      5750
> gi|787 CTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGG
>      5700      5710      5720      5730      5740      5750
>     5760      5770      5780      5790      5800      5810
> gi|787 AGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACC
>      5760      5770      5780      5790      5800      5810
>     5820      5830      5840      5850      5860      5870
> gi|787 TCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCGGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACT
>      5820      5830      5840      5850      5860      5870
>     5880      5890      5900      5910      5920      5930
> gi|787 CAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCA
>      5880      5890      5900      5910      5920      5930
>     5940      5950      5960      5970      5980      5990
> gi|787 CAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGC
>      5940      5950      5960      5970      5980      5990
>     6000      6010      6020      6030      6040      6050
> gi|787 TCTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAGCCTTCTAGGTAACGACCA
>        ::::::::::::::::::::::::::::::::::::::::: ::::::::::::::::::
> gi|115 TCTAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCA
>      6000      6010      6020      6030      6040      6050
>     6060      6070      6080      6090      6100      6110
> gi|787 CATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACC
>      6060      6070      6080      6090      6100      6110
>     6120      6130      6140      6150      6160      6170
> gi|787 CATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATAT
>      6120      6130      6140      6150      6160      6170
>     6180      6190      6200      6210      6220      6230
> gi|787 GGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCT
>      6180      6190      6200      6210      6220      6230
>     6240      6250      6260      6270      6280      6290
> gi|787 GCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTT
>      6240      6250      6260      6270      6280      6290
>     6300      6310      6320      6330      6340      6350
> gi|787 AGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCT
>      6300      6310      6320      6330      6340      6350
>     6360      6370      6380      6390      6400      6410
> gi|787 AGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAA
>      6360      6370      6380      6390      6400      6410
>     6420      6430      6440      6450      6460      6470
> gi|787 ACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGC
>      6420      6430      6440      6450      6460      6470
>     6480      6490      6500      6510      6520      6530
> gi|787 AGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGA
>      6480      6490      6500      6510      6520      6530
>     6540      6550      6560      6570      6580      6590
> gi|787 CCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCA
>      6540      6550      6560      6570      6580      6590
>     6600      6610      6620      6630      6640      6650
> gi|787 ACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGG
>      6600      6610      6620      6630      6640      6650
>     6660      6670      6680      6690      6700      6710
> gi|787 AATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGG
>      6660      6670      6680      6690      6700      6710
>     6720      6730      6740      6750      6760      6770
> gi|787 TATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATAT
>      6720      6730      6740      6750      6760      6770
>     6780      6790      6800      6810      6820      6830
> gi|787 ATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCAT
>      6780      6790      6800      6810      6820      6830
>     6840      6850      6860      6870      6880      6890
> gi|787 CGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATAT
>      6840      6850      6860      6870      6880      6890
>     6900      6910      6920      6930      6940      6950
> gi|787 GAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGG
>      6900      6910      6920      6930      6940      6950
>     6960      6970      6980      6990      7000      7010
> gi|787 CCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTA
>      6960      6970      6980      6990      7000      7010
>     7020      7030      7040      7050      7060      7070
> gi|787 CGTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGG
>        ::::::::: ::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGTTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGG
>      7020      7030      7040      7050      7060      7070
>     7080      7090      7100      7110      7120      7130
> gi|787 CTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAAT
>      7080      7090      7100      7110      7120      7130
>     7140      7150      7160      7170      7180      7190
> gi|787 CCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGG
>      7140      7150      7160      7170      7180      7190
>     7200      7210      7220      7230      7240      7250
> gi|787 CCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACAT
>      7200      7210      7220      7230      7240      7250
>     7260      7270      7280      7290      7300      7310
> gi|787 CCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGAT
>      7260      7270      7280      7290      7300      7310
>     7320      7330      7340      7350      7360      7370
> gi|787 TTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCT
>      7320      7330      7340      7350      7360      7370
>     7380      7390      7400      7410      7420      7430
> gi|787 GGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAA
>      7380      7390      7400      7410      7420      7430
>     7440      7450      7460      7470      7480      7490
> gi|787 ATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGG
>      7440      7450      7460      7470      7480      7490
>     7500      7510      7520      7530      7540      7550
> gi|787 CCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAA
>      7500      7510      7520      7530      7540      7550
>     7560      7570      7580      7590      7600      7610
> gi|787 ATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGAC
>      7560      7570      7580      7590      7600      7610
>     7620      7630      7640      7650      7660      7670
> gi|787 GCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATT
>      7620      7630      7640      7650      7660      7670
>     7680      7690      7700      7710      7720      7730
> gi|787 TTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACT
>      7680      7690      7700      7710      7720      7730
>     7740      7750      7760      7770      7780      7790
> gi|787 AATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATC
>      7740      7750      7760      7770      7780      7790
>     7800      7810      7820      7830      7840      7850
> gi|787 ATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAAC
>      7800      7810      7820      7830      7840      7850
>     7860      7870      7880      7890      7900      7910
> gi|787 GATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACC
>      7860      7870      7880      7890      7900      7910
>     7920      7930      7940      7950      7960      7970
> gi|787 GACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGC
>      7920      7930      7940      7950      7960      7970
>     7980      7990      8000      8010      8020      8030
> gi|787 GACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGT
>      7980      7990      8000      8010      8020      8030
>     8040      8050      8060      8070      8080      8090
> gi|787 ATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAA
>      8040      8050      8060      8070      8080      8090
>     8100      8110      8120      8130      8140      8150
> gi|787 ACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTA
>      8100      8110      8120      8130      8140      8150
>     8160      8170      8180      8190      8200      8210
> gi|787 TACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTA
>      8160      8170      8180      8190      8200      8210
>     8220      8230      8240      8250      8260      8270
> gi|787 GAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTC
>      8220      8230      8240      8250      8260      8270
>     8280      8290      8300      8310      8320      8330
> gi|787 TACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTA
>      8280      8290      8300      8310      8320      8330
>     8340      8350      8360      8370      8380      8390
> gi|787 AGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACC
>      8340      8350      8360      8370      8380      8390
>     8400      8410      8420      8430      8440      8450
> gi|787 ATAATTACCCCCATATTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACA
>        ::::::::::::::: ::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACA
>      8400      8410      8420      8430      8440      8450
>     8460      8470      8480      8490      8500      8510
> gi|787 AACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGA
>      8460      8470      8480      8490      8500      8510
>     8520      8530      8540      8550      8560      8570
> gi|787 GAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTAC
>      8520      8530      8540      8550      8560      8570
>     8580      8590      8600      8610      8620      8630
> gi|787 CCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCA
>      8580      8590      8600      8610      8620      8630
>     8640      8650      8660      8670      8680      8690
> gi|787 TCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGA
>      8640      8650      8660      8670      8680      8690
>     8700      8710      8720      8730      8740      8750
> gi|787 TAGCCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTT
>        :: :::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTT
>      8700      8710      8720      8730      8740      8750
>     8760      8770      8780      8790      8800      8810
> gi|787 TTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAAC
>      8760      8770      8780      8790      8800      8810
>     8820      8830      8840      8850      8860      8870
> gi|787 TATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTTC
>        ::::::::::::::::::::::::::::::::::::::::: ::::::::::::::::::
> gi|115 TATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTC
>      8820      8830      8840      8850      8860      8870
>     8880      8890      8900      8910      8920      8930
> gi|787 GCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTA
>      8880      8890      8900      8910      8920      8930
>     8940      8950      8960      8970      8980      8990
> gi|787 TCCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCG
>      8940      8950      8960      8970      8980      8990
>     9000      9010      9020      9030      9040      9050
> gi|787 TACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCA
>      9000      9010      9020      9030      9040      9050
>     9060      9070      9080      9090      9100      9110
> gi|787 CCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTC
>      9060      9070      9080      9090      9100      9110
>     9120      9130      9140      9150      9160      9170
> gi|787 TACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAG
>      9120      9130      9140      9150      9160      9170
>     9180      9190      9200      9210      9220      9230
> gi|787 TAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGT
>      9180      9190      9200      9210      9220      9230
>     9240      9250      9260      9270      9280      9290
> gi|787 AAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCT
>      9240      9250      9260      9270      9280      9290
>     9300      9310      9320      9330      9340      9350
> gi|787 AGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACAC
>      9300      9310      9320      9330      9340      9350
>     9360      9370      9380      9390      9400      9410
> gi|787 ACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCA
>      9360      9370      9380      9390      9400      9410
>     9420      9430      9440      9450      9460      9470
> gi|787 CACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGT
>      9420      9430      9440      9450      9460      9470
>     9480      9490      9500      9510      9520      9530
> gi|787 TTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCA
>      9480      9490      9500      9510      9520      9530
>     9540      9550      9560      9570      9580      9590
> gi|787 ACTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACT
>        : ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACT
>      9540      9550      9560      9570      9580      9590
>     9600      9610      9620      9630      9640      9650
> gi|787 CCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCT
>      9600      9610      9620      9630      9640      9650
>     9660      9670      9680      9690      9700      9710
> gi|787 AATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCT
>      9660      9670      9680      9690      9700      9710
>     9720      9730      9740      9750      9760      9770
> gi|787 CTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGG
>      9720      9730      9740      9750      9760      9770
>     9780      9790      9800      9810      9820      9830
> gi|787 CATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGG
>      9780      9790      9800      9810      9820      9830
>     9840      9850      9860      9870      9880      9890
> gi|787 CTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACA
>      9840      9850      9860      9870      9880      9890
>     9900      9910      9920      9930      9940      9950
> gi|787 TCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATT
>      9900      9910      9920      9930      9940      9950
>     9960      9970      9980      9990     10000     10010
> gi|787 TCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAA
>      9960      9970      9980      9990     10000     10010
>    10020     10030     10040     10050     10060     10070
> gi|787 CTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTT
>     10020     10030     10040     10050     10060     10070
>    10080     10090     10100     10110     10120     10130
> gi|787 AATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACT
>     10080     10090     10100     10110     10120     10130
>    10140     10150     10160     10170     10180     10190
> gi|787 CAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGC
>     10140     10150     10160     10170     10180     10190
>    10200     10210     10220     10230     10240     10250
> gi|787 CCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCT
>     10200     10210     10220     10230     10240     10250
>    10260     10270     10280     10290     10300     10310
> gi|787 AGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAAT
>     10260     10270     10280     10290     10300     10310
>    10320     10330     10340     10350     10360     10370
> gi|787 AGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACT
>     10320     10330     10340     10350     10360     10370
>    10380     10390     10400     10410     10420     10430
> gi|787 ACAAAAAGGATTAGACTGAGCTGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGA
>        ::::::::::::::::::: : ::::::::::::::::::::::::::::::::::::::
> gi|115 ACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGA
>     10380     10390     10400     10410     10420     10430
>    10440     10450     10460     10470     10480     10490
> gi|787 CTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACT
>     10440     10450     10460     10470     10480     10490
>    10500     10510     10520     10530     10540     10550
> gi|787 AGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCT
>     10500     10510     10520     10530     10540     10550
>    10560     10570     10580     10590     10600     10610
> gi|787 ACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAA
>     10560     10570     10580     10590     10600     10610
>    10620     10630     10640     10650     10660     10670
> gi|787 CACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGA
>     10620     10630     10640     10650     10660     10670
>    10680     10690     10700     10710     10720     10730
> gi|787 AGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGT
>     10680     10690     10700     10710     10720     10730
>    10740     10750     10760     10770     10780     10790
> gi|787 ACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCA
>     10740     10750     10760     10770     10780     10790
>    10800     10810     10820     10830     10840     10850
> gi|787 CTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATT
>     10800     10810     10820     10830     10840     10850
>    10860     10870     10880     10890     10900     10910
> gi|787 ATTAGCATCATCCCCCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCC
>        :::::::::::::: :::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCC
>     10860     10870     10880     10890     10900     10910
>    10920     10930     10940     10950     10960     10970
> gi|787 CCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTA
>     10920     10930     10940     10950     10960     10970
>    10980     10990     11000     11010     11020     11030
> gi|787 CCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAA
>     10980     10990     11000     11010     11020     11030
>    11040     11050     11060     11070     11080     11090
> gi|787 CTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACA
>     11040     11050     11060     11070     11080     11090
>    11100     11110     11120     11130     11140     11150
> gi|787 GAACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATC
>     11100     11110     11120     11130     11140     11150
>    11160     11170     11180     11190     11200     11210
> gi|787 ACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACC
>     11160     11170     11180     11190     11200     11210
>    11220     11230     11240     11250     11260     11270
> gi|787 CTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCA
>     11220     11230     11240     11250     11260     11270
>    11280     11290     11300     11310     11320     11330
> gi|787 CTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAAC
>     11280     11290     11300     11310     11320     11330
>    11340     11350     11360     11370     11380     11390
> gi|787 TTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCAC
>     11340     11350     11360     11370     11380     11390
>    11400     11410     11420     11430     11440     11450
> gi|787 TTATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCA
>     11400     11410     11420     11430     11440     11450
>    11460     11470     11480     11490     11500     11510
> gi|787 GTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTG
>     11460     11470     11480     11490     11500     11510
>    11520     11530     11540     11550     11560     11570
> gi|787 ACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGC
>     11520     11530     11540     11550     11560     11570
>    11580     11590     11600     11610     11620     11630
> gi|787 TCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCAC
>     11580     11590     11600     11610     11620     11630
>    11640     11650     11660     11670     11680     11690
> gi|787 ATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTC
>     11640     11650     11660     11670     11680     11690
>    11700     11710     11720     11730     11740     11750
> gi|787 ATTCTCATAATCGCCCACGGACTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAAC
>        :::::::::::::::::::: :::::::::::::::::::::::::::::::::::::::
> gi|115 ATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAAC
>     11700     11710     11720     11730     11740     11750
>    11760     11770     11780     11790     11800     11810
> gi|787 TACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCA
>     11760     11770     11780     11790     11800     11810
>    11820     11830     11840     11850     11860     11870
> gi|787 CTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATT
>     11820     11830     11840     11850     11860     11870
>    11880     11890     11900     11910     11920     11930
> gi|787 AACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTC
>     11880     11890     11900     11910     11920     11930
>    11940     11950     11960     11970     11980     11990
> gi|787 CTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACA
>     11940     11950     11960     11970     11980     11990
>    12000     12010     12020     12030     12040     12050
> gi|787 ACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAA
>     12000     12010     12020     12030     12040     12050
>    12060     12070     12080     12090     12100     12110
> gi|787 AACACCCTCATGTTCATACACCTATCCCCCATTATCCTCCTATCCCTCAACCCCGACATC
>        ::::::::::::::::::::::::::::::::: ::::::::::::::::::::::::::
> gi|115 AACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATC
>     12060     12070     12080     12090     12100     12110
>    12120     12130     12140     12150     12160     12170
> gi|787 ATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGAC
>     12120     12130     12140     12150     12160     12170
>    12180     12190     12200     12210     12220     12230
> gi|787 AACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCC
>     12180     12190     12200     12210     12220     12230
>    12240     12250     12260     12270     12280     12290
> gi|787 CCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTT
>     12240     12250     12260     12270     12280     12290
>    12300     12310     12320     12330     12340     12350
> gi|787 AGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAA
>     12300     12310     12320     12330     12340     12350
>    12360     12370     12380     12390     12400     12410
> gi|787 CCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACA
>     12360     12370     12380     12390     12400     12410
>    12420     12430     12440     12450     12460     12470
> gi|787 AAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTC
>     12420     12430     12440     12450     12460     12470
>    12480     12490     12500     12510     12520     12530
> gi|787 TCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACT
>     12480     12490     12500     12510     12520     12530
>    12540     12550     12560     12570     12580     12590
> gi|787 GAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAA
>     12540     12550     12560     12570     12580     12590
>    12600     12610     12620     12630     12640     12650
> gi|787 TATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATA
>     12600     12610     12620     12630     12640     12650
>    12660     12670     12680     12690     12700     12710
> gi|787 TAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATTTTCCTAATTACCA
>        :::::::::::::::::::::::::::::::::::::::::::::: :::::::::::::
> gi|115 TAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCA
>     12660     12670     12680     12690     12700     12710
>    12720     12730     12740     12750     12760     12770
> gi|787 TACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAG
>     12720     12730     12740     12750     12760     12770
>    12780     12790     12800     12810     12820     12830
> gi|787 GAATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAG
>     12780     12790     12800     12810     12820     12830
>    12840     12850     12860     12870     12880     12890
> gi|787 CCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCAT
>     12840     12850     12860     12870     12880     12890
>    12900     12910     12920     12930     12940     12950
> gi|787 GATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATC
>     12900     12910     12920     12930     12940     12950
>    12960     12970     12980     12990     13000     13010
> gi|787 CAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAG
>     12960     12970     12980     12990     13000     13010
>    13020     13030     13040     13050     13060     13070
> gi|787 GTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCC
>     13020     13030     13040     13050     13060     13070
>    13080     13090     13100     13110     13120     13130
> gi|787 ACTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAG
>     13080     13090     13100     13110     13120     13130
>    13140     13150     13160     13170     13180     13190
> gi|787 AAAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AAAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCG
>     13140     13150     13160     13170     13180     13190
>    13200     13210     13220     13230     13240     13250
> gi|787 CAGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAA
>     13200     13210     13220     13230     13240     13250
>    13260     13270     13280     13290     13300     13310
> gi|787 GTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGC
>     13260     13270     13280     13290     13300     13310
>    13320     13330     13340     13350     13360     13370
> gi|787 ACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCC
>     13320     13330     13340     13350     13360     13370
>    13380     13390     13400     13410     13420     13430
> gi|787 ACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTC
>     13380     13390     13400     13410     13420     13430
>    13440     13450     13460     13470     13480     13490
> gi|787 TCACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAG
>     13440     13450     13460     13470     13480     13490
>    13500     13510     13520     13530     13540     13550
> gi|787 GTTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAG
>     13500     13510     13520     13530     13540     13550
>    13560     13570     13580     13590     13600     13610
> gi|787 CCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTC
>     13560     13570     13580     13590     13600     13610
>    13620     13630     13640     13650     13660     13670
> gi|787 TTCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACC
>     13620     13630     13640     13650     13660     13670
>    13680     13690     13700     13710     13720     13730
> gi|787 CCACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCA
>     13680     13690     13700     13710     13720     13730
>    13740     13750     13760     13770     13780     13790
> gi|787 TTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAAC
>     13740     13750     13760     13770     13780     13790
>    13800     13810     13820     13830     13840     13850
> gi|787 TCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAA
>     13800     13810     13820     13830     13840     13850
>    13860     13870     13880     13890     13900     13910
> gi|787 CCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGAT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGAT
>     13860     13870     13880     13890     13900     13910
>    13920     13930     13940     13950     13960     13970
> gi|787 TCTACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCTACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACC
>     13920     13930     13940     13950     13960     13970
>    13980     13990     14000     14010     14020     14030
> gi|787 TGCCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TGCCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCAC
>     13980     13990     14000     14010     14020     14030
>    14040     14050     14060     14070     14080     14090
> gi|787 AGCACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AGCACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACT
>     14040     14050     14060     14070     14080     14090
>    14100     14110     14120     14130     14140     14150
> gi|787 TCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCC
>     14100     14110     14120     14130     14140     14150
>    14160     14170     14180     14190     14200     14210
> gi|787 CGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACTACTACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACTACTACT
>     14160     14170     14180     14190     14200     14210
>    14220     14230     14240     14250     14260     14270
> gi|787 AATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCT
>     14220     14230     14240     14250     14260     14270
>    14280     14290     14300     14310     14320     14330
> gi|787 GACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACC
>     14280     14290     14300     14310     14320     14330
>    14340     14350     14360     14370     14380     14390
> gi|787 ACCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAA
>     14340     14350     14360     14370     14380     14390
>    14400     14410     14420     14430     14440     14450
> gi|787 ACACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATC
>     14400     14410     14420     14430     14440     14450
>    14460     14470     14480     14490     14500     14510
> gi|787 GCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAA
>     14460     14470     14480     14490     14500     14510
>    14520     14530     14540     14550     14560     14570
> gi|787 CCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATC
>     14520     14530     14540     14550     14560     14570
>    14580     14590     14600     14610     14620     14630
> gi|787 AATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 AATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACT
>     14580     14590     14600     14610     14620     14630
>    14640     14650     14660     14670     14680     14690
> gi|787 AAACCCACACTCAACAGAAACAAAGCATATATCATTATTCTCGCACGGACTACAACCACG
>        ::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::::
> gi|115 AAACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACG
>     14640     14650     14660     14670     14680     14690
>    14700     14710     14720     14730     14740     14750
> gi|787 ACCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATA
>     14700     14710     14720     14730     14740     14750
>    14760     14770     14780     14790     14800     14810
> gi|787 CGCAAAATTAACCCCCTAATAAAACTAATTAACCACTCATTCATCGACCTCCCCACCCCA
>        ::::::: :::::::::::::::: :::::::::::::::::::::::::::::::::::
> gi|115 CGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCA
>     14760     14770     14780     14790     14800     14810
>    14820     14830     14840     14850     14860     14870
> gi|787 TCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAA
>     14820     14830     14840     14850     14860     14870
>    14880     14890     14900     14910     14920     14930
> gi|787 ATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCA
>     14880     14890     14900     14910     14920     14930
>    14940     14950     14960     14970     14980     14990
> gi|787 TCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCC
>     14940     14950     14960     14970     14980     14990
>    15000     15010     15020     15030     15040     15050
> gi|787 AATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGACGAGGCCTATATTAC
>        :::::::::::::::::::::::::::::::::::::::::::: :::::::::::::::
> gi|115 AATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTAC
>     15000     15010     15020     15030     15040     15050
>    15060     15070     15080     15090     15100     15110
> gi|787 GGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATA
>     15060     15070     15080     15090     15100     15110
>    15120     15130     15140     15150     15160     15170
> gi|787 GCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCAACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACA
>     15120     15130     15140     15150     15160     15170
>    15180     15190     15200     15210     15220     15230
> gi|787 GTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GTAATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATC
>     15180     15190     15200     15210     15220     15230
>    15240     15250     15260     15270     15280     15290
> gi|787 TGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATC
>     15240     15250     15260     15270     15280     15290
>    15300     15310     15320     15330     15340     15350
> gi|787 TTACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCACGAAACGGGA
>        :: :::::::::::::::::::::::: ::::::::::::::::::::::::::::::::
> gi|115 TTGCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGA
>     15300     15310     15320     15330     15340     15350
>    15360     15370     15380     15390     15400     15410
> gi|787 TCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTAC
>     15360     15370     15380     15390     15400     15410
>    15420     15430     15440     15450     15460     15470
> gi|787 ACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ACAATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTA
>     15420     15430     15440     15450     15460     15470
>    15480     15490     15500     15510     15520     15530
> gi|787 TTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACC
>     15480     15490     15500     15510     15520     15530
>    15540     15550     15560     15570     15580     15590
> gi|787 CCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTC
>     15540     15550     15560     15570     15580     15590
>    15600     15610     15620     15630     15640     15650
> gi|787 CCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATC
>     15600     15610     15620     15630     15640     15650
>    15660     15670     15680     15690     15700     15710
> gi|787 CCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTT
>     15660     15670     15680     15690     15700     15710
>    15720     15730     15740     15750     15760     15770
> gi|787 TATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGC
>     15720     15730     15740     15750     15760     15770
>    15780     15790     15800     15810     15820     15830
> gi|787 TACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 TACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATC
>     15780     15790     15800     15810     15820     15830
>    15840     15850     15860     15870     15880     15890
> gi|787 CTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTAATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGT
>     15840     15850     15860     15870     15880     15890
>    15900     15910     15920     15930     15940     15950
> gi|787 ATAAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATAAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCA
>     15900     15910     15920     15930     15940     15950
>    15960     15970     15980     15990     16000     16010
> gi|787 GAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATT
>     15960     15970     15980     15990     16000     16010
>    16020     16030     16040     16050     16060     16070
> gi|787 CTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAA
>     16020     16030     16040     16050     16060     16070
>    16080     16090     16100     16110     16120     16130
> gi|787 CAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAA
>     16080     16090     16100     16110     16120     16130
>    16140     16150     16160     16170     16180     16190
> gi|787 ATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCTCATGCT
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::: ::::::
> gi|115 ATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCT
>     16140     16150     16160     16170     16180     16190
>    16200     16210     16220     16230     16240     16250
> gi|787 TACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAGCCA
>        :::::::::::::::::::::::: :::::::::::::::::::::::::::::::::::
> gi|115 TACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCA
>     16200     16210     16220     16230     16240     16250
>    16260     16270     16280     16290     16300     16310
> gi|787 CCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAA
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAA
>     16260     16270     16280     16290     16300     16310
>    16320     16330     16340     16350     16360     16370
> gi|787 GCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 GCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCC
>     16320     16330     16340     16350     16360     16370
>    16380     16390     16400     16410     16420     16430
> gi|787 CCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTG
>     16380     16390     16400     16410     16420     16430
>    16440     16450     16460     16470     16480     16490
> gi|787 CTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGAC
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 CTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGAC
>     16440     16450     16460     16470     16480     16490
>    16500     16510     16520     16530     16540     16550
> gi|787 ATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAG
>        ::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
> gi|115 ATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAG
>     16500     16510     16520     16530     16540     16550
>    16560     16570
> gi|787 ACATCACGATG
>        :::::::::::
> gi|115 ACATCACGATG
>     16560
>>> gi|115315570|ref|AC_000021.2| Homo sapiens mitochondri  (16569 nt)
> rev-comp initn:  84 init1:  84 opt:  88  Z-score: 46.5  bits: 28.2  
> E(): 0.59
> banded Smith-Waterman score: 88; 68.3% identity (68.3% similar) in  
> 41 nt overlap (1373-1333:1331-1371)
>        1400      1390      1380      1370      1360      1350
> gi|78- CATAAGGGCTATCGTAGTTTTCTGGGGTAGAAAATGTAGCCCATTTCTTGCCACCTCATG
>                                      ::  ::::::::::    :: ::    :::
> gi|115 GCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATG
>              1310      1320      1330      1340      1350      1360
>        1340      1330      1320      1310      1300      1290
> gi|78- GGCTACACCTTGACCTAACGTCTTTACGTGGGTACTTGCGCTTACTTTGTAGCCTTCATC
>        :::::::  ::
> gi|115 GGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGT
>              1370      1380      1390      1400      1410      1420
>
> 16570 residues in 1 query   sequences
> 16569 residues in 1 library sequences
>  Scomplib [35.04]
>  start: Sat Jan 24 07:06:10 2009 done: Sat Jan 24 07:06:14 2009
>  Total Scan time:  3.420 Total Display time:  0.040
> Function used was FASTA [version 35.04 Aug. 28, 2008]
>
>
> ___________________________________________________________________
>
> Wen-Zhi WANG
>
> State Key Laboratory of Genetic Resources and Evolution
> Kunming Institute of Zoology, Chinese Academy of Sciences
> Kunming, Yunnan 650223 P. R. China
> Tel:      (86) 871-5198993
> Fax:     (86) 871-5195430
> Mobile: 13759114244
> E-mail: wenzhiwang1983 at yahoo.com.cn
>
>
>      ___________________________________________________________
>  好玩贺卡等你发,邮箱贺卡全新上线!
> http://card.mail.cn.yahoo.com/ 
> <AC_000021.fas><DQ272107.fas><test.fasta>




More information about the Bioperl-l mailing list