[Bioperl-l] Remote blast

Roopa Raghuveer rtbio.2009 at gmail.com
Thu Nov 19 09:55:27 EST 2009


Hello everybody,

I have a problem. I would like to use remote blast to find sequences
matching for an input sequence.

Ex:-I would like to search sequences which match Trypanosoma Brucei
sequence.

I want the output to be only Trypanosoma Brucei sequences matching with my
query.When i tried to use remoteblast to nr database,I got sequences from
different organisms like E.coli,Pseudomonas etc.,

Could you please tell me how can this be solved...?

My code is as follows.

use Bio::Tools::Run::RemoteBlast;
  use strict;
  my $prog = 'blastn';
  my $db   = 'nr';
  my $e_val= '1e-10';
 my $organism= 'Trypanosoma Brucei';

  my @params = ( '-prog' => $prog,
         '-data' => $db,
         '-expect' => $e_val,
         '-readmethod' => 'SearchIO',
         '-Organism'   => $organism );

  my $factory = Bio::Tools::Run::RemoteBlast->
new(@params);

  #change a paramter
  #$Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} = 'Trypanosoma
brucei[ORGN]'

  #remove a parameter
  #delete $Bio::Tools::Run::RemoteBlast::HEADER{'FILTER'};

  my $v = 1;
  #$v is just to turn on and off the messages

  my $str = Bio::SeqIO->new(-file=>'amino.fa' , '-format' => 'fasta' ,
'-organism' => 'Trypanosoma Brucei' );

  while (my $input = $str->next_seq()){
    #Blast a sequence against a database:
   my $r = $factory->submit_blast($input);
    #my $r = $factory->submit_blast('amino.fa');

    print STDERR "waiting..." if( $v > 0 );
    while ( my @rids = $factory->each_rid ) {
      foreach my $rid ( @rids ) {
        my $rc = $factory->retrieve_blast($rid);
        if( !ref($rc) ) {
          if( $rc < 0 ) {
            $factory->remove_rid($rid);
          }
          print STDERR "." if ( $v > 0 );
         sleep 5;
        }
     else {
          my $result = $rc->next_result();
          #save the output
          my $filename = $result->query_name()."\.out";
          $factory->save_output($filename);
          $factory->remove_rid($rid);
          print "\nQuery Name: ", $result->query_name(), "\n";
          while ( my $hit = $result->next_hit ) {
            next unless ( $v > 0);
            print "\thit name is ", $hit->name, "\n";
            while( my $hsp = $hit->next_hsp ) {
              print "\t\tscore is ", $hsp->score, "\n";
            }
          }
        }
      }
    }
  }

My input sequence is

>ref|NC_009512.1|:385-1902
GTGTCAGTGGAACTTTGGCAGCAGTGCGTGGAGCTTCTGCGCGATGAACTGCCTGCCCAGCAATTCAACA
CCTGGATCCGTCCGCTACAGGTCGAAGCCGAAGGCGACGAGTTGCGCGTCTATGCGCCTAACCGTTTCGT
TCTCGATTGGGTCAATGAAAAGTACCTGGGTCGTTTGCTCGAGCTGTTGGGTGAGAACGGTAGCGGCATT
GCACCAGCCCTTTCCTTATTAATAGGTAGCCGCCGCAGCTCGGCCCCAAGGGCTGCACCCAACGCGCCGG
TCAGCGCTGCCGTTGCGGCTTCGCTGGCGCAGACTCAGGCGCACAAGACGGCCCCGGCAGCAGCGGTTGA
ACCCGTTGCCGTGGCCGCGGCCGAGCCTGTATTGGTCGAGACGTCTTCGCGTGACAGCTTTGATGCCATG
GCCGAGCCTGCTGCTGCGCCGCCCAGTGGTGGCCGGGCTGAACAGCGCACCGTGCAGGTTGAAGGTGCGC
TCAAGCACACCAGTTACCTGAACCGGACCTTTACCTTTGACACCTTCGTCGAAGGTAAGTCGAACCAGCT
CGCCCGCGCGGCTGCCTGGCAGGTTGCGGACAACCCTAAGCATGGCTACAACCCACTGTTCCTTTATGGC
GGTGTGGGTTTGGGTAAAACCCACCTTATGCATGCTGTGGGTAACCATCTGCTGAAGAAGAATCCGAACG
CCAAGGTGGTGTACCTGCATTCGGAGCGCTTCGTCGCGGACATGGTCAAAGCGTTGCAACTCAACGCCAT
CAACGAATTCAAGCGCTTCTACCGCTCGGTGGACGCGTTGCTGATCGACGATATCCAGTTCTTCGCTCGC
AAAGAGCGCTCGCAAGAAGAGTTTTTCCACACCTTCAACGCCTTGCTTGAGGGTGGCCAGCAGGTAATCC
TTACCTCTGACCGCTATCCCAAGGAAATCGAAGGCCTGGAAGAGCGTCTGAAGTCGCGCTTTGGTTGGGG
CCTGACGGTGGCTGTCGAGCCGCCAGAGCTGGAGACCCGCGTAGCGATCCTGATGAAGAAGGCCGACCAG
GCCAAAGTCGAGCTCCCGCATGACGCAGCCTTTTTCATCGCTCAGCGCATCCGGTCCAACGTCCGTGAGC
TGGAAGGTGCACTGAAGCGAGTTATTGCTCACTCGCACTTCATGGGGCGTGACATCACCATCGAGCTGAT
TCGTGAATCGCTCAAGGATCTGTTGGCGCTGCAAGACAAACTGGTCAGTGTGGATAACATTCAGCGTACC
GTCGCTGAGTACTACAAGATCAAGATCTCCGATCTGTTGTCCAAGCGTCGTTCGCGTTCTGTCGCGCGCC
CGCGTCAGGTAGCCATGGCCCTGTCCAAGGAGTTGACCAACCACAGTCTGCCGGAAATCGGCGACATGTT
CGGTGGTCGCGACCATACGACCGTGCTGCACGCCTGCCGCAAAATCAATGAACTGAAGGAATCCGACGCG
GACATCCGCGAGGACTACAAGAACCTGCTGCGGACGCTGACGACCTGA

Please mail me regarding any queries.

Regards,
Roopa.


More information about the Bioperl-l mailing list