From David.Messina at sbc.su.se  Thu Apr  1 08:41:23 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 1 Apr 2010 14:41:23 +0200
Subject: [Bioperl-l] root node branch length in newick trees written
	incorrectly
Message-ID: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se>

Hi everyone,

It seems that TreeIO::newick might not be properly writing root nodes which have a branch length ? it omits the colon.

e.g.

If you read in

	(a:1,b:2):0.0;

It will be written out as

	(a:1,b:2)0.0;


And in the latter case, 0.0 now looks like a node id, causing strict interpreters of newick (like PAML) to complain.

Crazy for the root to have a branch length, you say? Apparently it's a matter of taste ? RAxML and TreeAlign do it, and according to the newick spec it's legit.*

I just filed a bug report (http://bugzilla.open-bio.org/show_bug.cgi?id=3039) with a patch and a test.

But I'm not sure I understand the code that well,though; could another dev or two take a look before I commit?


Thanks,
Dave




* See the example at the bottom of http://evolution.genetics.washington.edu/phylip/newick_doc.html



From bkulohoma at iscb.org  Thu Apr  1 08:50:16 2010
From: bkulohoma at iscb.org (Benard Kulohoma)
Date: Thu, 1 Apr 2010 14:50:16 +0200
Subject: [Bioperl-l] Google summer of code
Message-ID: <95DC9D02-8DF7-4AFB-A29C-5F0401D58197@iscb.org>

Dear Sir, Madam,

Hello. I would like to express my interest in joining this group in the google summer of code.

I am especially interested in:  BioPerl 2.0 (and beyond)

Many thanks,
Benard

From maj at fortinbras.us  Thu Apr  1 09:11:38 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 1 Apr 2010 09:11:38 -0400
Subject: [Bioperl-l] Google Summer of Code
In-Reply-To: <60c593881003300933p46c7c295k69a21ee986ef5777@mail.gmail.com>
References: <60c593881003300933p46c7c295k69a21ee986ef5777@mail.gmail.com>
Message-ID: <2C7AB464D5E3422AA0F69A598091C274@NewLife>

Rob,
Feel free to post your questions to the list, or you can contact us mentors 
directly (me, Chris Fields, Rob Buels), the emails are all available on previous 
posts.
cheers and thanks for your interest-
MAJ
----- Original Message ----- 
From: "Robert Schaefer" <schae234 at gmail.com>
To: <bioperl-l at lists.open-bio.org>
Sent: Tuesday, March 30, 2010 12:33 PM
Subject: [Bioperl-l] Google Summer of Code


> Hello,
>   I am looking for more information of your mentorship program for
> google's SOC. Who would I contact for more information and to ask
> questions?
>
> Thank you,
> Rob Schaefer
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From maj at fortinbras.us  Thu Apr  1 09:10:02 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 1 Apr 2010 09:10:02 -0400
Subject: [Bioperl-l] GSoC 2010
In-Reply-To: <717794.59615.qm@web37507.mail.mud.yahoo.com>
References: <717794.59615.qm@web37507.mail.mud.yahoo.com>
Message-ID: <FA037D8A69AB4964845FFD296F04E52A@NewLife>

Hi Anil,
Yes, everything is still fair game. I encourage you to contact Chris or me 
directly, or go ahead an post your details to the list.
cheers,
MAJ
----- Original Message ----- 
From: "Anil Lal" <anil_m_lal at yahoo.com>
To: <bioperl-l at lists.open-bio.org>
Sent: Tuesday, March 30, 2010 2:24 PM
Subject: [Bioperl-l] GSoC 2010


> Hello,
>
> I am a mid career software programmer and now transitioning in bioinformatics. 
> I always had great interest in bioinformatics and only now am able to make a 
> move to take classes.  I am currently enrolled in University of santa cruz 
> extension classes.  I am very interested in GSoC 2010 and have identified 
> potentially these two projects.Lightweight Sequence objects and Lazy Parsing 
> mentored by Chris Fields and Perl Run Wrappers for External Programs in a 
> Flash mentored by Mark Jenson.
>
> Please let me know if these projects are still available.  If yes, I will send 
> in my application with more details
>
> Thanks a lot for your help.  I would be exciting to work in Bio Perl and 
> contribute.
>
> Anil
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From maj at fortinbras.us  Thu Apr  1 09:51:18 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 1 Apr 2010 09:51:18 -0400
Subject: [Bioperl-l] root node branch length in newick trees
	writtenincorrectly
In-Reply-To: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se>
References: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se>
Message-ID: <D668ED32DC3744B4965E57D87D6EF2EE@NewLife>

Hi Dave,
The spot in the code you're dealing with looks a little kludgy-- the branch 
length must fall through to $id when the node in the data file has branch length 
but no explicit id (like a root node), is that right? Maybe it's more robust to 
to do a check whether a 'putative id' is actually a float, and shunt it into a 
branch length variable in that case. (course, maybe ids like "103748923.192934", 
which would make that bork)... hmm
MAJ
----- Original Message ----- 
From: "Dave Messina" <David.Messina at sbc.su.se>
To: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Thursday, April 01, 2010 8:41 AM
Subject: [Bioperl-l] root node branch length in newick trees writtenincorrectly


Hi everyone,

It seems that TreeIO::newick might not be properly writing root nodes which have 
a branch length ? it omits the colon.

e.g.

If you read in

(a:1,b:2):0.0;

It will be written out as

(a:1,b:2)0.0;


And in the latter case, 0.0 now looks like a node id, causing strict 
interpreters of newick (like PAML) to complain.

Crazy for the root to have a branch length, you say? Apparently it's a matter of 
taste ? RAxML and TreeAlign do it, and according to the newick spec it's legit.*

I just filed a bug report (http://bugzilla.open-bio.org/show_bug.cgi?id=3039) 
with a patch and a test.

But I'm not sure I understand the code that well,though; could another dev or 
two take a look before I commit?


Thanks,
Dave




* See the example at the bottom of 
http://evolution.genetics.washington.edu/phylip/newick_doc.html


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Thu Apr  1 10:26:34 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 01 Apr 2010 09:26:34 -0500
Subject: [Bioperl-l] Google Summer of Code
In-Reply-To: <2C7AB464D5E3422AA0F69A598091C274@NewLife>
References: <60c593881003300933p46c7c295k69a21ee986ef5777@mail.gmail.com>
	<2C7AB464D5E3422AA0F69A598091C274@NewLife>
Message-ID: <1270131994.4658.2.camel@pyrimidine.igb.uiuc.edu>

Rob,

Rob Buels and I are currently the mentors for that section.  It's a
fairly broad project, so we would be more than happy to discuss on- or
off-list what you would like to do in order to narrow it down to a more
focused project.

chris

On Thu, 2010-04-01 at 09:11 -0400, Mark A. Jensen wrote:
> Rob,
> Feel free to post your questions to the list, or you can contact us mentors 
> directly (me, Chris Fields, Rob Buels), the emails are all available on previous 
> posts.
> cheers and thanks for your interest-
> MAJ
> ----- Original Message ----- 
> From: "Robert Schaefer" <schae234 at gmail.com>
> To: <bioperl-l at lists.open-bio.org>
> Sent: Tuesday, March 30, 2010 12:33 PM
> Subject: [Bioperl-l] Google Summer of Code
> 
> 
> > Hello,
> >   I am looking for more information of your mentorship program for
> > google's SOC. Who would I contact for more information and to ask
> > questions?
> >
> > Thank you,
> > Rob Schaefer
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Thu Apr  1 10:32:55 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 1 Apr 2010 16:32:55 +0200
Subject: [Bioperl-l] root node branch length in newick trees
	writtenincorrectly
In-Reply-To: <D668ED32DC3744B4965E57D87D6EF2EE@NewLife>
References: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se>
	<D668ED32DC3744B4965E57D87D6EF2EE@NewLife>
Message-ID: <224D3F22-2747-4B5B-BD10-019B9F9DC1D2@sbc.su.se>


On Apr 1, 2010, at 15:51, Mark A. Jensen wrote:

> Hi Dave,
> The spot in the code you're dealing with looks a little kludgy-- the branch length must fall through to $id when the node in the data file has branch length but no explicit id (like a root node), is that right?

Well, I'm not exactly sure. :) But in case that's true, that's why I left the original code's if block as an elsif.

elsif ( defined $id || defined $bs ) {
                    $data[-1] .= defined $bs ? $bs : $id;
}

There should probably be an

else { 
	warn "We should never reach this branch, should we?"
}

following that elsif just in case. Except the lack of an else{} before, I'm not positive that the code isn't relying on the fallthrough.


> Maybe it's more robust to to do a check whether a 'putative id' is actually a float, and shunt it into a branch length variable in that case. (course, maybe ids like "103748923.192934", which would make that bork)... hmm

Yeah. Is there already a method to ask if a node is the root node?

There's $tree->get_root_node() which is kinda close. But I think what we really want is $node->is_root(). I didn't see that in Bio::Tree::NodeI.

Does anyone know if that (or similar) exists?


D



From cjfields at illinois.edu  Thu Apr  1 10:47:08 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 01 Apr 2010 09:47:08 -0500
Subject: [Bioperl-l] GSoC 2010
In-Reply-To: <FA037D8A69AB4964845FFD296F04E52A@NewLife>
References: <717794.59615.qm@web37507.mail.mud.yahoo.com>
	<FA037D8A69AB4964845FFD296F04E52A@NewLife>
Message-ID: <1270133228.4658.25.camel@pyrimidine.igb.uiuc.edu>

Yes, the more details posted (and more discussion) the better the
proposal will be.  I encourage you to post something here or to join the
discussion on IRC (#obf-soc, or #bioperl).

chris

On Thu, 2010-04-01 at 09:10 -0400, Mark A. Jensen wrote:
> Hi Anil,
> Yes, everything is still fair game. I encourage you to contact Chris or me 
> directly, or go ahead an post your details to the list.
> cheers,
> MAJ
> ----- Original Message ----- 
> From: "Anil Lal" <anil_m_lal at yahoo.com>
> To: <bioperl-l at lists.open-bio.org>
> Sent: Tuesday, March 30, 2010 2:24 PM
> Subject: [Bioperl-l] GSoC 2010
> 
> 
> > Hello,
> >
> > I am a mid career software programmer and now transitioning in bioinformatics. 
> > I always had great interest in bioinformatics and only now am able to make a 
> > move to take classes.  I am currently enrolled in University of santa cruz 
> > extension classes.  I am very interested in GSoC 2010 and have identified 
> > potentially these two projects.Lightweight Sequence objects and Lazy Parsing 
> > mentored by Chris Fields and Perl Run Wrappers for External Programs in a 
> > Flash mentored by Mark Jenson.
> >
> > Please let me know if these projects are still available.  If yes, I will send 
> > in my application with more details
> >
> > Thanks a lot for your help.  I would be exciting to work in Bio Perl and 
> > contribute.
> >
> > Anil
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jun.yin at ucd.ie  Thu Apr  1 10:55:31 2010
From: jun.yin at ucd.ie (Jun Yin)
Date: Thu, 01 Apr 2010 15:55:31 +0100
Subject: [Bioperl-l] Application on BioPerl Summer of Code
Message-ID: <001a01cad1ab$60254af0$206fe0d0$%yin@ucd.ie>

Hi,

 

I am a Ph.D. student in Bioinformatics in University College Dublin. I am
very interested in the Google Summer of Code project, particularly the
BioPerl project on Bio::Align and Bio::Assembly. I just received very kind
help from pyrimidine and drycafe from IRC channel. They suggest I may mail
the application to the mail list, as attached. I am open to any suggestion
on my application. And I wonder whether there is any mentor could help me on
that project, since there is no mentor assigned so far.

 

Wait for your suggestions.

 

Cheers,

Jun Yin

Ph.D. student in U.C.D.

 

Bioinformatics Laboratory

Conway Institute

University College Dublin

 

-------------- next part --------------
A non-text attachment was scrubbed...
Name: JunYin_SummerCodeApplication.doc
Type: application/msword
Size: 43008 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100401/660d76de/attachment-0001.doc>

From maj at fortinbras.us  Thu Apr  1 11:44:16 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 1 Apr 2010 11:44:16 -0400
Subject: [Bioperl-l] root node branch length in newick
	treeswrittenincorrectly
In-Reply-To: <224D3F22-2747-4B5B-BD10-019B9F9DC1D2@sbc.su.se>
References: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se><D668ED32DC3744B4965E57D87D6EF2EE@NewLife>
	<224D3F22-2747-4B5B-BD10-019B9F9DC1D2@sbc.su.se>
Message-ID: <D2D4F9BB3B124C80BCD17D954F77AFF6@NewLife>

Looks like there's no is_root; that should be easily remedied.
I think I'll take a harder look at _write_tree_Helper() overall,
just for fun; my gut feeling is there is some redundant redundancy
there. Will have to do it later on today tho. cheers MAJ
----- Original Message ----- 
From: "Dave Messina" <David.Messina at sbc.su.se>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Thursday, April 01, 2010 10:32 AM
Subject: Re: [Bioperl-l] root node branch length in newick 
treeswrittenincorrectly


>
> On Apr 1, 2010, at 15:51, Mark A. Jensen wrote:
>
>> Hi Dave,
>> The spot in the code you're dealing with looks a little kludgy-- the branch 
>> length must fall through to $id when the node in the data file has branch 
>> length but no explicit id (like a root node), is that right?
>
> Well, I'm not exactly sure. :) But in case that's true, that's why I left the 
> original code's if block as an elsif.
>
> elsif ( defined $id || defined $bs ) {
>                    $data[-1] .= defined $bs ? $bs : $id;
> }
>
> There should probably be an
>
> else {
> warn "We should never reach this branch, should we?"
> }
>
> following that elsif just in case. Except the lack of an else{} before, I'm 
> not positive that the code isn't relying on the fallthrough.
>
>
>> Maybe it's more robust to to do a check whether a 'putative id' is actually a 
>> float, and shunt it into a branch length variable in that case. (course, 
>> maybe ids like "103748923.192934", which would make that bork)... hmm
>
> Yeah. Is there already a method to ask if a node is the root node?
>
> There's $tree->get_root_node() which is kinda close. But I think what we 
> really want is $node->is_root(). I didn't see that in Bio::Tree::NodeI.
>
> Does anyone know if that (or similar) exists?
>
>
> D
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From David.Messina at sbc.su.se  Thu Apr  1 12:08:49 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 1 Apr 2010 18:08:49 +0200
Subject: [Bioperl-l] root node branch length in newick
	treeswrittenincorrectly
In-Reply-To: <D2D4F9BB3B124C80BCD17D954F77AFF6@NewLife>
References: <1B1BEA46-A939-4D29-89D8-DBB0F577F4FE@sbc.su.se><D668ED32DC3744B4965E57D87D6EF2EE@NewLife>
	<224D3F22-2747-4B5B-BD10-019B9F9DC1D2@sbc.su.se>
	<D2D4F9BB3B124C80BCD17D954F77AFF6@NewLife>
Message-ID: <2BB6B8EE-D6CD-4267-A587-478266A9C1AF@sbc.su.se>

> Looks like there's no is_root; that should be easily remedied.

Yep, seems like it'd be generally useful. There is already an is_Leaf.


> I think I'll take a harder look at _write_tree_Helper() overall,


Awesome, thanks!


D


From hlapp at drycafe.net  Thu Apr  1 13:03:47 2010
From: hlapp at drycafe.net (Hilmar Lapp)
Date: Thu, 1 Apr 2010 13:03:47 -0400
Subject: [Bioperl-l] GSoC 2010
In-Reply-To: <717794.59615.qm@web37507.mail.mud.yahoo.com>
References: <717794.59615.qm@web37507.mail.mud.yahoo.com>
Message-ID: <AF8FD969-CF92-4847-8BEF-0FFF04E994E0@drycafe.net>

Hi Anil:

On Mar 30, 2010, at 2:24 PM, Anil Lal wrote:

> Please let me know if these projects are still available.


I'm not sure what you mean by that - projects are always available  
until the time a student has been accepted for them by Google. Until  
then, there is competition between students in any event, whether  
among the same project idea, or among different project ideas for the  
limited number of student slots an organization gets allocated. Did  
you mean whether anyone else so far has expressed interest in those  
project ideas?

	-hilmar
-- 
===========================================================
: Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net :
===========================================================





From rmb32 at cornell.edu  Thu Apr  1 17:07:24 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Thu, 01 Apr 2010 14:07:24 -0700
Subject: [Bioperl-l] summer code project on Bioperl
In-Reply-To: <7160acc75f99.4bb28b23@ucd.ie>
References: <7160acc75f99.4bb28b23@ucd.ie>
Message-ID: <4BB50B0C.4020105@cornell.edu>

Just so people know, Jun was taken care of in #obf-soc


Jun Yin wrote:
> Dear Sir or Madam,
> 
> I am a Ph.D. student in Bioinformatics in University College Dublin. I 
> saw the information for Google summer code project on Bioperl just 
> earlier today. I found the project on refactoring Bio::Align::AlignI and 
> Bio::Assembly are particular interesting to me. Would you like to send 
> me some information on that asap? I know it is a bit hustled to do that, 
> since it is almost deadline now. Otherwise, I will try my best to write 
> a proposal on that.
> 
> Concerning my relevant experience, I usually program in Perl and R 
> (bioconductor). My current research focuses on microarray design, 
> annotation and data mining. Please see my attached short CV. Besides, my 
> supervisor is Prof. Des Higgins, who is the author of the alignment 
> software Clustalw. It could be much beneficial to Bio::Align::AlignI, 
> which directly dealing with the input and output sequences from Clustalw 
> and other alignment softwares.
> 
> I have a few questions on the application procedure. I will appreciate 
> that if you can answer it asap. First, I saw the deadline for the 
> application on Google is April 9, but on Bioperl, it is April 2. Which 
> is the real deadline? Second, what is the request for the research 
> proposal, e.g. how many words/pages for it? Do I submit it to this email 
> address or through google summer code web site?
> 
> Thx in Advance,
> Jun Yin
> 
> Bioinformatics Lab,
> Conway Institute,
> University College Dublin
> 
> 
> ------------------------------------------------------------------------
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From rmb32 at cornell.edu  Thu Apr  1 17:09:23 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Thu, 01 Apr 2010 14:09:23 -0700
Subject: [Bioperl-l] Google summer of code
In-Reply-To: <95DC9D02-8DF7-4AFB-A29C-5F0401D58197@iscb.org>
References: <95DC9D02-8DF7-4AFB-A29C-5F0401D58197@iscb.org>
Message-ID: <4BB50B83.70006@cornell.edu>

Hi Benard,

Glad to hear you're interested.

Be sure to read through the OBF and GSoC wiki pages about the 
application process, and let us know if you have any questions.

We're also more than happy to help you edit your proposal on this list.

Hope this helps!

Rob

Benard Kulohoma wrote:
> Dear Sir, Madam,
> 
> Hello. I would like to express my interest in joining this group in the google summer of code.
> 
> I am especially interested in:  BioPerl 2.0 (and beyond)
> 
> Many thanks,
> Benard
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From hsa_rim at yahoo.co.in  Fri Apr  2 03:17:48 2010
From: hsa_rim at yahoo.co.in (shafeeq rim)
Date: Fri, 2 Apr 2010 12:47:48 +0530 (IST)
Subject: [Bioperl-l] Conserved SNP
Message-ID: <230283.30275.qm@web94610.mail.in2.yahoo.com>

Hi,

How to get the fllowing information from dbSNP / HapMap. If not there is there a method to find it ? BTW I know what synonymous / non synonymous are. 

1) non synonymous, conservative SNP
2) non conservative SNP 

Thanks


      The INTERNET now has a personality. YOURS! See your Yahoo! Homepage. http://in.yahoo.com/

From maj at fortinbras.us  Fri Apr  2 15:15:56 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Fri, 2 Apr 2010 15:15:56 -0400
Subject: [Bioperl-l] BlastPlus usage inquiry
In-Reply-To: <014401cad119$2d1467a0$873d36e0$@edu.hk>
References: <mailman.9.1266166804.5582.bioperl-l@lists.open-bio.org><AF897A25-E258-40DE-9A1E-C0AC0AD86A38@gmail.com>
	<014401cad119$2d1467a0$873d36e0$@edu.hk>
Message-ID: <6F4622C57C2F4D67B7A1B16E9926916D@NewLife>

Hi Ross --
Add the following option:

-num_threads 7

and see if it picks up the other CPUs--
cheers Mark
----- Original Message ----- 
From: "Ross KK Leung" <ross at cuhk.edu.hk>
To: "'Janine Arloth'" <janine.arloth at googlemail.com>; 
<bioperl-l at lists.open-bio.org>
Sent: Wednesday, March 31, 2010 5:28 PM
Subject: [Bioperl-l] BlastPlus usage inquiry


> Dear all,
>
> I know it is inappropriate to raise this question in bioperl but as I
> received no better response from NCBI and so have to ask in this group
> (because finally I'll use bioperl to call blastplus). I have already been
> using the latest blastplus (the command is blastn directly) and found the
> problem of running slow and inability to run in a parallel/multithread
> manner.
>
>
> Previously I was using non blastplus version 2.2.22 with the command
> blastall -p blastn -a 8 etc.
>
> With similar arguments as below except the word size was 12, my shell script
> for the same input and database finishes almost instantly. I notice that
> except word size and min raw gapped score were changed by me, nothing
> appears to differ from the previous version parameters. Moreover, when I top
> my process, I find it uses only one CPU instead of 7.
>
> What may be the problem for the script that makes the job running for a day
> and still hasn't finished?
>
> blastn -query $1 -db $2 -out $1_$2.xml -num_threads 7 -word_size 4 -gapopen
> 3 -gapextend 1 -penalty -2 -outfmt 5 -xdrop_ungap 30 -xdrop_gap 30
> -xdrop_gap_final 30 -min_raw_gapped_score 10
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From cjfields at illinois.edu  Fri Apr  2 15:41:16 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 02 Apr 2010 14:41:16 -0500
Subject: [Bioperl-l] BlastPlus usage inquiry
In-Reply-To: <6F4622C57C2F4D67B7A1B16E9926916D@NewLife>
References: <mailman.9.1266166804.5582.bioperl-l@lists.open-bio.org>
	<AF897A25-E258-40DE-9A1E-C0AC0AD86A38@gmail.com>
	<014401cad119$2d1467a0$873d36e0$@edu.hk>
	<6F4622C57C2F4D67B7A1B16E9926916D@NewLife>
Message-ID: <1270237276.3100.16.camel@pyrimidine.igb.uiuc.edu>

Glad to see it's not just me.  I just asked the same question the other
day and got a response (or non-response, dep. on how you look at it);
posted below.  This occurs irrespective of using the BioPerl BLAST+
modules or not, using -num-threads of 4 and 8. 

Interestingly, the legacy BLAST and -a works just fine (I'm using a dual
quad-core running ubuntu karmic 64-bit, 48G RAM).  It may be the
database size as they imply, but I would like to see this behavior
documented.  It's certainly unexpected.

chris

NCBI's response, followed by my post:
------------------------------------------------
Hello, 

In our 2.2.23+ linux x64 tests, threading is working. It may be that the
database is small enough not to invoke more than one thread, or that top
is not the best way to analyze this in blast+. With a large enough
search, user time should decrease with increasing cpu. Note that only
the search phases of the algorithms are multi-threaded; the traceback is
not. 
Best regards,
Wayne

_~___~___~__~__~_~
Wayne Matten, PhD
NCBI Public Services
mattenw at mail.nih.gov
------------------------------------------------
On Mar 31, 2010, at 6:12 PM, Chris Fields wrote: 
> I'm using BLAST+ and can't tell if threading is working properly (it
> doesn't appear to be if I can trust 'top').  With legacy BLAST I set
> -a
> to 4 (I'm running a dual quad-core ubuntu box, 9.10 64-bit) and can
> see
> the %CPU cranked up to 350-400% with top, but with BLAST+ this never
> exceeds 100%.  
> 
> Below is the actual command line:
> 
> /opt/local/blast-plus/bin/blastp -num_threads 4 -db
> ~/blastdb/apis_v2_aa
> -evalue 1e-5 -num_descriptions 10 -num_alignments 10 -query seqs.aa >
> out.blastp 2> error.log &
> 
> Snapshot of 'top':
> 
> Tasks: 292 total,   1 running, 291 sleeping,   0 stopped,   0 zombie
> Cpu(s):  1.0%us,  0.2%sy,  0.0%ni, 98.8%id,  0.0%wa,  0.0%hi,  0.0%si,
> 0.0%
> Mem:  49556108k total, 46352552k used,  3203556k free,   556224k
> buffers
> Swap: 29302536k total,    16852k used, 29285684k free, 42244628k
> cached
> 
>  PID USER      PR  NI  VIRT  RES  SHR S %CPU %MEM    TIME+
> COMMAND        
> 18195 cjfields  20   0  353m  19m  12m S  100  0.0   1:43.68
> blastp         
> 10536 cjfields  20   0  217m  18m  10m S    2  0.0   0:12.80
> gnome-terminal 
> 
> 
> chris


On Fri, 2010-04-02 at 15:15 -0400, Mark A. Jensen wrote:
> Hi Ross --
> Add the following option:
> 
> -num_threads 7
> 
> and see if it picks up the other CPUs--
> cheers Mark
> ----- Original Message ----- 
> From: "Ross KK Leung" <ross at cuhk.edu.hk>
> To: "'Janine Arloth'" <janine.arloth at googlemail.com>; 
> <bioperl-l at lists.open-bio.org>
> Sent: Wednesday, March 31, 2010 5:28 PM
> Subject: [Bioperl-l] BlastPlus usage inquiry
> 
> 
> > Dear all,
> >
> > I know it is inappropriate to raise this question in bioperl but as I
> > received no better response from NCBI and so have to ask in this group
> > (because finally I'll use bioperl to call blastplus). I have already been
> > using the latest blastplus (the command is blastn directly) and found the
> > problem of running slow and inability to run in a parallel/multithread
> > manner.
> >
> >
> > Previously I was using non blastplus version 2.2.22 with the command
> > blastall -p blastn -a 8 etc.
> >
> > With similar arguments as below except the word size was 12, my shell script
> > for the same input and database finishes almost instantly. I notice that
> > except word size and min raw gapped score were changed by me, nothing
> > appears to differ from the previous version parameters. Moreover, when I top
> > my process, I find it uses only one CPU instead of 7.
> >
> > What may be the problem for the script that makes the job running for a day
> > and still hasn't finished?
> >
> > blastn -query $1 -db $2 -out $1_$2.xml -num_threads 7 -word_size 4 -gapopen
> > 3 -gapextend 1 -penalty -2 -outfmt 5 -xdrop_ungap 30 -xdrop_gap 30
> > -xdrop_gap_final 30 -min_raw_gapped_score 10
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> > 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From biopython at maubp.freeserve.co.uk  Fri Apr  2 17:11:57 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Fri, 2 Apr 2010 22:11:57 +0100
Subject: [Bioperl-l] BlastPlus usage inquiry
In-Reply-To: <1270237276.3100.16.camel@pyrimidine.igb.uiuc.edu>
References: <mailman.9.1266166804.5582.bioperl-l@lists.open-bio.org>
	<AF897A25-E258-40DE-9A1E-C0AC0AD86A38@gmail.com>
	<014401cad119$2d1467a0$873d36e0$@edu.hk>
	<6F4622C57C2F4D67B7A1B16E9926916D@NewLife>
	<1270237276.3100.16.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <w2s320fb6e01004021411s37f0eca2m34f8d056240427ed@mail.gmail.com>

On Fri, Apr 2, 2010 at 8:41 PM, Chris Fields <cjfields at illinois.edu> wrote:
> Glad to see it's not just me. ?I just asked the same question the other
> day and got a response (or non-response, dep. on how you look at it);
> posted below. ?This occurs irrespective of using the BioPerl BLAST+
> modules or not, using -num-threads of 4 and 8.
>
> Interestingly, the legacy BLAST and -a works just fine (I'm using a dual
> quad-core running ubuntu karmic 64-bit, 48G RAM). ?It may be the
> database size as they imply, but I would like to see this behavior
> documented. ?It's certainly unexpected.

I was running the new blastp tool from BLAST+ today on a local
copy of NR, and using -num_threads 7 worked fine. This was on
a Mac Pro, with BLAST+ compiled from source. So it might be
down to the database size as the NCBI suggested.

Peter


From cjfields at illinois.edu  Fri Apr  2 17:24:28 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 02 Apr 2010 16:24:28 -0500
Subject: [Bioperl-l] BlastPlus usage inquiry
In-Reply-To: <w2s320fb6e01004021411s37f0eca2m34f8d056240427ed@mail.gmail.com>
References: <mailman.9.1266166804.5582.bioperl-l@lists.open-bio.org>
	<AF897A25-E258-40DE-9A1E-C0AC0AD86A38@gmail.com>
	<014401cad119$2d1467a0$873d36e0$@edu.hk>
	<6F4622C57C2F4D67B7A1B16E9926916D@NewLife>
	<1270237276.3100.16.camel@pyrimidine.igb.uiuc.edu>
	<w2s320fb6e01004021411s37f0eca2m34f8d056240427ed@mail.gmail.com>
Message-ID: <1270243468.6949.8.camel@pyrimidine.igb.uiuc.edu>

On Fri, 2010-04-02 at 22:11 +0100, Peter wrote:
> On Fri, Apr 2, 2010 at 8:41 PM, Chris Fields <cjfields at illinois.edu> wrote:
> > Glad to see it's not just me.  I just asked the same question the other
> > day and got a response (or non-response, dep. on how you look at it);
> > posted below.  This occurs irrespective of using the BioPerl BLAST+
> > modules or not, using -num-threads of 4 and 8.
> >
> > Interestingly, the legacy BLAST and -a works just fine (I'm using a dual
> > quad-core running ubuntu karmic 64-bit, 48G RAM).  It may be the
> > database size as they imply, but I would like to see this behavior
> > documented.  It's certainly unexpected.
> 
> I was running the new blastp tool from BLAST+ today on a local
> copy of NR, and using -num_threads 7 worked fine. This was on
> a Mac Pro, with BLAST+ compiled from source. So it might be
> down to the database size as the NCBI suggested.
> 
> Peter

I may try the same database on Mac to see what happens.  

chris


From chapmanb at 50mail.com  Fri Apr  2 09:06:21 2010
From: chapmanb at 50mail.com (Brad Chapman)
Date: Fri, 2 Apr 2010 09:06:21 -0400
Subject: [Bioperl-l] BOSC and OpenBio solution challenge reminder -- April
	15th
Message-ID: <20100402130621.GH36623@sobchak.mgh.harvard.edu>

Hello all;
A friendly reminder that the deadline for the Bioinformatics Open
Source Conference (BOSC) is coming up on April 15th:

http://www.open-bio.org/wiki/BOSC_2010

This is a great opportunity to discuss code and biology with fellow
developers.

One session which I'd like to emphasize is the OpenBio Solution
Challenge, a section of talks that describes how to solve practical
problems in bioinformatics using a variety of approaches:

http://www.open-bio.org/wiki/SolutionChallenge

Any toolkit developers who are interested in giving a talk are
encouraged to submit an abstract for the challenge. We have some initial
project ideas on the page and welcome your feedback for other useful
workflows that would emphasize the advantages of using open source
toolkits to solve biological problems. Please copy messages to the
OpenBio mailing list as a central point for discussion and
questions:

http://lists.open-bio.org/mailman/listinfo/open-bio-l

Looking forward to seeing everyone in July,
Brad

BOSC contact and dates:
Date: July 9-10, 2010
Location: Boston, Massachusetts, USA
BOSC 2010 web site: http://www.open-bio.org/wiki/BOSC_2010
Abstract submission via Open Conference System site:  http://events.open-bio.org/BOSC2010/openconf.php
E-mail: bosc at open-bio.org
Bosc-announce list:  http://lists.open-bio.org/mailman/listinfo/bosc-announce

Important Dates
April 15: Abstract deadline
May 5:  Notification of accepted abstracts
May 28: Early Registration Discount Cut-off date
July 8-9:  Codefest 2010
July 9-10: BOSC 2010
August 15:  Manuscript deadline for BOSC 2010 Proceedings published in BMC Bioinformatics

From magnificient.kp at gmail.com  Fri Apr  2 10:28:23 2010
From: magnificient.kp at gmail.com (PRAVEEN KUMAR K P)
Date: Fri, 2 Apr 2010 19:58:23 +0530
Subject: [Bioperl-l] A google soc 2010 aspirant
Message-ID: <g2u3a2732f01004020728jd386600alde471717912ed3e9@mail.gmail.com>

dear sir,

i am student from india. I have some basic expereince with perl for
bioinformatics.
I have some sound and basic knowledge of life sciences and genome databses

-- 
with Regards,
Praveen Kumar(KP)

From tamaki-hideyuki at aist.go.jp  Fri Apr  2 16:24:34 2010
From: tamaki-hideyuki at aist.go.jp (=?ISO-2022-JP?B?GyRCNkxMWj0oOSwbKEI=?=)
Date: Fri, 2 Apr 2010 14:24:34 -0600
Subject: [Bioperl-l] the failed test for installation of Bioperl-run-1.6.1
Message-ID: <j2x316898671004021324k31f5cdddma94b43e48a73a8d5@mail.gmail.com>

To whom it may concern,



I have tried to install BioPerl-run-1.6.1.tar.gz using cpan command line.
Finally, I got the failed test massages as attached below.
Is this critical issue for my using BioPerl-run.
If so, can I ask you to tell me how I can solve this problem?

Thank you very much in advance.


Hideyuki Tamaki, phD



------------
ux-thread-multi /usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Seg.t line 7.
BEGIN failed--compilation aborted at t/Seg.t line 7.
t/Seg.t ....................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Semphy.t .................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Semphy.t line 7.
BEGIN failed--compilation aborted at t/Semphy.t line 7.
t/Semphy.t .................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/SeqBoot.t ................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/SeqBoot.t line 10.
BEGIN failed--compilation aborted at t/SeqBoot.t line 10.
t/SeqBoot.t ................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Signalp.t ................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Signalp.t line 7.
BEGIN failed--compilation aborted at t/Signalp.t line 7.
t/Signalp.t ................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Sim4.t ...................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Sim4.t line 7.
BEGIN failed--compilation aborted at t/Sim4.t line 7.
t/Sim4.t ...................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Simprot.t ................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Simprot.t line 11.
BEGIN failed--compilation aborted at t/Simprot.t line 11.
t/Simprot.t ................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/StandAloneFasta.t ........... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/StandAloneFasta.t line 8.
BEGIN failed--compilation aborted at t/StandAloneFasta.t line 8.
t/StandAloneFasta.t ........... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/TCoffee.t ................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/TCoffee.t line 7.
BEGIN failed--compilation aborted at t/TCoffee.t line 7.
t/TCoffee.t ................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/TigrAssembler.t ............. Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/TigrAssembler.t line 4.
BEGIN failed--compilation aborted at t/TigrAssembler.t line 4.
t/TigrAssembler.t ............. Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Tmhmm.t ..................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Tmhmm.t line 7.
BEGIN failed--compilation aborted at t/Tmhmm.t line 7.
t/Tmhmm.t ..................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/TribeMCL.t .................. Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/TribeMCL.t line 7.
BEGIN failed--compilation aborted at t/TribeMCL.t line 7.
t/TribeMCL.t .................. Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/Vista.t ..................... Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/Vista.t line 6.
BEGIN failed--compilation aborted at t/Vista.t line 6.
t/Vista.t ..................... Dubious, test returned 2 (wstat 512, 0x200)
No subtests run
t/tRNAscanSE.t ................ Can't locate Array/Compare.pm in @INC (@INC
contains: t/lib /root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/lib
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt/blib/arch
/root/.cpan/build/BioPerl-run-1.6.0-shnVwt
/usr/lib64/perl5/site_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/site_perl/5.8.8 /usr/lib/perl5/site_perl
/usr/lib64/perl5/vendor_perl/5.8.8/x86_64-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.8.8 /usr/lib/perl5/vendor_perl
/usr/lib64/perl5/5.8.8/x86_64-linux-thread-multi /usr/lib/perl5/5.8.8 .) at
t/lib/Test/Warn.pm line 228.
BEGIN failed--compilation aborted at t/lib/Test/Warn.pm line 228.
Compilation failed in require at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test/Warn.pm line 83.
Compilation failed in require at (eval 11) line 1.
BEGIN failed--compilation aborted at (eval 11) line 1.

BEGIN failed--compilation aborted at
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Test.pm line 152.
Compilation failed in require at t/tRNAscanSE.t line 8.
BEGIN failed--compilation aborted at t/tRNAscanSE.t line 8.
t/tRNAscanSE.t ................ Dubious, test returned 2 (wstat 512, 0x200)
No subtests run

Test Summary Report
-------------------
t/Amap.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/AnalysisFactory_soap.t    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Analysis_soap.t           (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Blat.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Clustalw.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Coil.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Consense.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/DBA.t                     (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/DrawGram.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/DrawTree.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/EMBOSS.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Ensembl.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Eponine.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Exonerate.t               (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/FootPrinter.t             (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Genemark.hmm.prokaryotic.t (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Genewise.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Genscan.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Gerp.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Glimmer2.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Glimmer3.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Gumby.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Hmmer.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Hyphy.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Kalign.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/LVB.t                     (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Lagan.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/MAFFT.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/MCS.t                     (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Match.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Mdust.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Meme.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Molphy.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Muscle.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Neighbor.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Njtree.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/PAML.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Pal2Nal.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/PhastCons.t               (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Phrap.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Phyml.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Primate.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Primer3.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Prints.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Probalign.t               (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Probcons.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Profile.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Promoterwise.t            (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/ProtDist.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/ProtPars.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Pseudowise.t              (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/QuickTree.t               (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/RepeatMasker.t            (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/SLR.t                     (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Seg.t                     (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Semphy.t                  (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/SeqBoot.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Signalp.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Sim4.t                    (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Simprot.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/StandAloneFasta.t         (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/TCoffee.t                 (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/TigrAssembler.t           (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Tmhmm.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/TribeMCL.t                (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/Vista.t                   (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
t/tRNAscanSE.t              (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: No plan found in TAP output
Files=67, Tests=0,  4 wallclock secs ( 0.17 usr  0.16 sys +  2.98 cusr  0.67
csys =  3.98 CPU)
Result: FAIL
Failed 67/67 test programs. 0/0 subtests failed.
  CJFIELDS/BioPerl-run-1.6.1.tar.gz
  ./Build test -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
  reports CJFIELDS/BioPerl-run-1.6.1.tar.gz
Running Build install
  make test had returned bad status, won't install without force
Failed during this command:
 CJFIELDS/BioPerl-run-1.6.1.tar.gz            : make_test NO

------------

From joanderson at ucdavis.edu  Fri Apr  2 20:22:34 2010
From: joanderson at ucdavis.edu (Johnathon Anderson)
Date: Fri, 2 Apr 2010 17:22:34 -0700
Subject: [Bioperl-l] Major BioPerl reorganization
Message-ID: <m2uf951ecd01004021722se80e746fq9c1ec6b57a8e108f@mail.gmail.com>

Hello Bio-PERL,

I am a genetics undergraduate senior at UC Davis that has been working in a
biomedical lab for 1.5 yr.  I am very much interested in your program,
however, I'm concerned that my skill level might be sub-par for the
project.  I do not have much programming experience.  I have taken two
bioinformatic courses (one of which had used various alignment programs
PHRED, PHRAP, etc) and I am currently taking my first full blown PERL course
(done with by summer) with Dr. Ian Korf which deals with manipulating data
received from a Solexa Sequencer.  I am game for the task, but i don't want
to be a hindrance to the group.  Any feedback you could provide would be
most appreciated.  Thank you.

-- 
Johnathon David Anderson

From cjfields at illinois.edu  Fri Apr  2 23:58:21 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 2 Apr 2010 22:58:21 -0500
Subject: [Bioperl-l] A google soc 2010 aspirant
In-Reply-To: <g2u3a2732f01004020728jd386600alde471717912ed3e9@mail.gmail.com>
References: <g2u3a2732f01004020728jd386600alde471717912ed3e9@mail.gmail.com>
Message-ID: <44CA53B7-F43D-4BE2-A867-5626EE5735FE@illinois.edu>

Praveen,

You should look at the specific information for the GSoC to get some project ideas and learn more about what to do.  Rob, is the deadline April 9 for proposals?

http://www.bioperl.org/wiki/Google_Summer_of_Code

chris

On Apr 2, 2010, at 9:28 AM, PRAVEEN KUMAR K P wrote:

> dear sir,
> 
> i am student from india. I have some basic expereince with perl for
> bioinformatics.
> I have some sound and basic knowledge of life sciences and genome databses
> 
> -- 
> with Regards,
> Praveen Kumar(KP)
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Sat Apr  3 00:03:31 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 2 Apr 2010 23:03:31 -0500
Subject: [Bioperl-l] Major BioPerl reorganization
In-Reply-To: <m2uf951ecd01004021722se80e746fq9c1ec6b57a8e108f@mail.gmail.com>
References: <m2uf951ecd01004021722se80e746fq9c1ec6b57a8e108f@mail.gmail.com>
Message-ID: <5F2206B5-DB2C-472D-9FB3-FA81EDE23F0E@illinois.edu>

Jonathan,

I'm assuming this is for the Google Summer of Code?  The best thing to do is come up with a proposal of what you intend on doing, probably discussing it on list here with the group (Rob and I may be the ones leading the reorganization project should a good proposal be awarded).  The following page has more information.  

http://www.bioperl.org/wiki/Google_Summer_of_Code

We're also on IRC quite a bit (#obf-soc and #bioperl on freenode).

chris

On Apr 2, 2010, at 7:22 PM, Johnathon Anderson wrote:

> Hello Bio-PERL,
> 
> I am a genetics undergraduate senior at UC Davis that has been working in a
> biomedical lab for 1.5 yr.  I am very much interested in your program,
> however, I'm concerned that my skill level might be sub-par for the
> project.  I do not have much programming experience.  I have taken two
> bioinformatic courses (one of which had used various alignment programs
> PHRED, PHRAP, etc) and I am currently taking my first full blown PERL course
> (done with by summer) with Dr. Ian Korf which deals with manipulating data
> received from a Solexa Sequencer.  I am game for the task, but i don't want
> to be a hindrance to the group.  Any feedback you could provide would be
> most appreciated.  Thank you.
> 
> -- 
> Johnathon David Anderson
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From rmb32 at cornell.edu  Sat Apr  3 13:34:47 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Sat, 03 Apr 2010 10:34:47 -0700
Subject: [Bioperl-l] A google soc 2010 aspirant
In-Reply-To: <44CA53B7-F43D-4BE2-A867-5626EE5735FE@illinois.edu>
References: <g2u3a2732f01004020728jd386600alde471717912ed3e9@mail.gmail.com>
	<44CA53B7-F43D-4BE2-A867-5626EE5735FE@illinois.edu>
Message-ID: <4BB77C37.7040708@cornell.edu>

Yes, proposals must be submitted to Google by April 9.

Rob

Chris Fields wrote:
> Praveen,
> 
> You should look at the specific information for the GSoC to get some project ideas and learn more about what to do.  Rob, is the deadline April 9 for proposals?
> 
> http://www.bioperl.org/wiki/Google_Summer_of_Code
> 
> chris
> 
> On Apr 2, 2010, at 9:28 AM, PRAVEEN KUMAR K P wrote:
> 
>> dear sir,
>>
>> i am student from india. I have some basic expereince with perl for
>> bioinformatics.
>> I have some sound and basic knowledge of life sciences and genome databses
>>
>> -- 
>> with Regards,
>> Praveen Kumar(KP)
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 


From rmb32 at cornell.edu  Sat Apr  3 16:09:27 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Sat, 03 Apr 2010 13:09:27 -0700
Subject: [Bioperl-l] Google Summer of Code is *ON* for OBF projects!
Message-ID: <4BB7A077.4070802@cornell.edu>

Hi all,

Reminder:  GSoC student proposals must be submitted to Google by April 
9th, 19:00 UTC.  That's less than a week away.

Students: you should ALREADY be working with mentors on the project 
mailing lists, they can help you get your proposal into shape.

So far, we have 5 proposals submitted to our org in Google's web app. 
Keep them coming, and let's see some really good ones!

Rob Buels
OBF GSoC 2010 Administrator


From rmb32 at cornell.edu  Sun Apr  4 12:41:31 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Sun, 04 Apr 2010 09:41:31 -0700
Subject: [Bioperl-l] Google Summer of Code
In-Reply-To: <h2q594925001004040927g51c179e6o869dcad4b01529ae@mail.gmail.com>
References: <h2q594925001004040927g51c179e6o869dcad4b01529ae@mail.gmail.com>
Message-ID: <4BB8C13B.3000103@cornell.edu>

Hello Murtaza,

The first point of contact for each project is the relevant project's 
mailing list, which in this case is bioperl-l at lists.open-bio.org.  I'm 
CCIng this there.

Keep in mind that the summer of code application deadline is April 9th, 
19:00 UTC, which is in just 5 days.

Rob

Murtaza wrote:
> Dear Robert,
> 
> I am interested in working on the project titled "Perl Run Wrappers for 
> External Programs in a Flash". I am current a student of medicine with 
> an active interest in programming and bioinformatics. I am quite 
> comfortable with learning new languages as need and I have also worked 
> with perl as well as XML in the past. 
> 
> I will really appreciate if you could put me in touch with the right 
> person for this project. If as part of summer of code, my medical 
> background and my skills and interest in computers can be used in a 
> better way besides this project, please do suggest such opportunities.
> 
> My primary objective in applying for summer of code is to experience 
> development of tools for bioinformatics before I go on to do some more 
> research in Cancer Genomics (a program I have been accepted into at the 
> University of Cambridge starting in Fall 2010).
> 
> I will look forward to your advice.
> 
> Best Regards,
> Murtaza
> 
> 
> 
> -- 
> Muhammed Murtaza
> nucleic at gmail.com <mailto:nucleic at gmail.com>
> 
> "Any good poet, in our age at least, must begin with the scientific view 
> of the world; and any scientist worth listening to must be something of 
> a poet, must possess the ability to communicate to the rest of us his 
> sense of love and wonder at what his work discovers."
> 
> -Edward Abbey, The Journey Home


From torsten.seemann at infotech.monash.edu.au  Sun Apr  4 20:42:28 2010
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 5 Apr 2010 10:42:28 +1000
Subject: [Bioperl-l] The Bioperl SVN server down?
Message-ID: <i2ha79f6a4b1004041742l2fd9fd71veb7c96ae5639bfe@mail.gmail.com>

FYI

The Bioperl SVN seems to be down:

% firefox http://code.open-bio.org/svnweb/index.cgi
The connection has timed out.
The server at code.open-bio.org is taking too long to respond.

% svn update
The connection has timed out.

% ping -v code.open-bio.org
PING code.open-bio.org (208.94.50.61) 56(84) bytes of data
<no response>


--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash
University, AUSTRALIA

From torsten.seemann at infotech.monash.edu.au  Sun Apr  4 20:46:03 2010
From: torsten.seemann at infotech.monash.edu.au (Torsten Seemann)
Date: Mon, 5 Apr 2010 10:46:03 +1000
Subject: [Bioperl-l] Primer3 Redux
In-Reply-To: <BA754512-07BB-4CB1-88A5-8E0FE163BB87@illinois.edu>
References: <BA754512-07BB-4CB1-88A5-8E0FE163BB87@illinois.edu>
Message-ID: <v2ta79f6a4b1004041746iaddd4f86h6810b91dae701df5@mail.gmail.com>

Chris

I have been working on a Primer3 refactor (for $job) that is pretty much
> ready to go; I'll be adding it to bioperl-dev in a few days along with
> tests.  This'll also include a Primer3 wrapper.  It's a fairly major
> overhaul, so I'm using

the namespace Bio::Tools::Primer3Redux in the meantime so there are no API
> collisions (any other suggestions for a namespace are welcome).
>

This is fantastic!

I just wrote a bunch of primer3 2.x bioperl code, and when I ran it I
realised bioperl-live only had 1.x support... although the SVN is down at
the moment, I hope to test it soon when I can get access again.

--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash
University, AUSTRALIA

From cjfields at illinois.edu  Sun Apr  4 22:59:46 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 4 Apr 2010 21:59:46 -0500
Subject: [Bioperl-l] Primer3 Redux
In-Reply-To: <v2ta79f6a4b1004041746iaddd4f86h6810b91dae701df5@mail.gmail.com>
References: <BA754512-07BB-4CB1-88A5-8E0FE163BB87@illinois.edu>
	<v2ta79f6a4b1004041746iaddd4f86h6810b91dae701df5@mail.gmail.com>
Message-ID: <EF6C247B-2E3E-441C-9019-74AE1FA4189B@illinois.edu>


On Apr 4, 2010, at 7:46 PM, Torsten Seemann wrote:

> Chris
> 
> I have been working on a Primer3 refactor (for $job) that is pretty much
>> ready to go; I'll be adding it to bioperl-dev in a few days along with
>> tests.  This'll also include a Primer3 wrapper.  It's a fairly major
>> overhaul, so I'm using
> 
> the namespace Bio::Tools::Primer3Redux in the meantime so there are no API
>> collisions (any other suggestions for a namespace are welcome).
>> 
> 
> This is fantastic!
> 
> I just wrote a bunch of primer3 2.x bioperl code, and when I ran it I
> realised bioperl-live only had 1.x support... although the SVN is down at
> the moment, I hope to test it soon when I can get access again.
> 
> --Torsten Seemann
> --Victorian Bioinformatics Consortium, Dept. Microbiology, Monash
> University, AUSTRALIA


Torsten,

I have committed the code to bioperl-dev.  It basically wraps primer3 (either 1.x or 2.x) and parses output.  I haven't added tests yet, but in some of my preliminary work it appeared to work just fine.  It's also possible I'll change the internals at some point to be less, um, hacky, but the API should remain the same.

I'll probably release it as a self-contained package to CPAN at some point.

chris

From jason at bioperl.org  Mon Apr  5 02:01:53 2010
From: jason at bioperl.org (Jason Stajich)
Date: Sun, 04 Apr 2010 23:01:53 -0700
Subject: [Bioperl-l] [Fwd:  The Bioperl SVN server down?]
In-Reply-To: <i2ha79f6a4b1004041742l2fd9fd71veb7c96ae5639bfe@mail.gmail.com>
References: <i2ha79f6a4b1004041742l2fd9fd71veb7c96ae5639bfe@mail.gmail.com>
Message-ID: <4BB97CD1.5020606@bioperl.org>

This has been a persistent problem.  I am not sure what Chris's feeling 
is on resolving this more substantially.

In the meantime (or perhaps for the future) you can check it out from 
google code SVN mirror.
http://code.google.com/p/bioperl/source/checkout

-jason

-------- Original Message --------
From: 	Torsten Seemann <torsten.seemann at infotech.monash.edu.au>
Subject: 	[Bioperl-l] The Bioperl SVN server down?
Date: 	Mon, 5 Apr 2010 10:42:28 +1000
To: 	BioPerl List <Bioperl-l at lists.open-bio.org>



FYI

The Bioperl SVN seems to be down:

% firefox http://code.open-bio.org/svnweb/index.cgi
The connection has timed out.
The server at code.open-bio.org is taking too long to respond.

% svn update
The connection has timed out.

% ping -v code.open-bio.org
PING code.open-bio.org (208.94.50.61) 56(84) bytes of data
<no response>


--Torsten Seemann
--Victorian Bioinformatics Consortium, Dept. Microbiology, Monash
University, AUSTRALIA
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From rmb32 at cornell.edu  Sun Apr  4 00:37:38 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Sat, 03 Apr 2010 21:37:38 -0700
Subject: [Bioperl-l] Reminder: GSoC student applications due April 9,
	19:00 UTC
Message-ID: <4BB81792.8060001@cornell.edu>

Hi all,

Sending this again with a different subject line, just in case.

GSoC student proposals must be submitted to Google through their web 
application by *April 9th, 19:00 UTC*.  That's less than a week away.

Students: you should ALREADY be working with mentors on the project
mailing lists, they can help you get your proposal into shape.

So far, we have 6 proposals submitted to our org in Google's web app.
Keep them coming, and keep them good!

Rob Buels
OBF GSoC 2010 Administrator



From david.k.kovalic at monsanto.com  Mon Apr  5 14:28:19 2010
From: david.k.kovalic at monsanto.com (KOVALIC, DAVID K [AG/1000])
Date: Mon, 5 Apr 2010 13:28:19 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing (multiple)
	fastq files failure
Message-ID: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>

Hi,

Using the example code for this module I get an error building an index
file:

		>index_fastq Run101_s11_test_index
100108_SOLEXA-02_0101_PE_61810AAXX/s_1_1_sequence.txt
		sdbm store returned -1, errno 22, key
"SOLEXA-02_0001:1:55:1110:290#0/1" at
/bli/lib/SunOS/perl5/site_perl/5.6.1/Bio/Index/Abstract.pm line 714,
<FASTQ> line 30369077.

The code to build index file/retrieve sequences works on small test file
but not the real data (fasyq file from single Illumina GAII lane). Here
is the code for building the index.

Index_fastq:
		# Complete code for making an index for several
		# fastq files
		use Bio::Index::Fastq;
		use strict;

		unless (scalar @ARGV >= 2){die "ERROR index_fastq:
Usage: index_fastq <index file name> <(list of) fastq file(s) to index>
\n\n"}

		my $Index_File_Name = shift;
		my $inx = Bio::Index::Fastq->new('-filename' =>
$Index_File_Name,'-write_flag' => 1);
		   $inx->make_index(@ARGV);

Any idea what the problem might be and how to fix it? Let me know if you
have any insight. Thanks,

David



---------------------------------------------------------------------------------------------------------
This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.


All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
---------------------------------------------------------------------------------------------------------



From jason at bioperl.org  Mon Apr  5 18:53:19 2010
From: jason at bioperl.org (Jason Stajich)
Date: Mon, 05 Apr 2010 15:53:19 -0700
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
Message-ID: <4BBA69DF.6060508@bioperl.org>

Hi David - I am not sure this is going to be the right tool for the job.

I'm concerned that none of the Bio::Index:: will really work for 
Illumina/NGS size data because once you get beyond about 4M hash keys 
things slow down quite dramatically and/or don't finish.

I think we have to consider SQLite implementations or some more explicit 
way to handle larger keysize for hashes in the DB_File or BerkeleyDB 
approach.
A similar slow problem can be seen if you just index a fastq converted 
fasta file from a single Illumina lane.

I ended up writing a simple DBD::SQLite db storage system for my NGS 
data but I don't think it is very space efficient and there are probably 
some better ways to go about this that some of the indexing schemes that 
the NGS alignment software programs have applied.  I assume other people 
have hit this problem but I've not seen much discussion.

-jason

KOVALIC, DAVID K [AG/1000] wrote, On 4/5/10 11:28 AM:
> Hi,
>
> Using the example code for this module I get an error building an index
> file:
>
> 		>index_fastq Run101_s11_test_index
> 100108_SOLEXA-02_0101_PE_61810AAXX/s_1_1_sequence.txt
> 		sdbm store returned -1, errno 22, key
> "SOLEXA-02_0001:1:55:1110:290#0/1" at
> /bli/lib/SunOS/perl5/site_perl/5.6.1/Bio/Index/Abstract.pm line 714,
> <FASTQ>  line 30369077.
>
> The code to build index file/retrieve sequences works on small test file
> but not the real data (fasyq file from single Illumina GAII lane). Here
> is the code for building the index.
>
> Index_fastq:
> 		# Complete code for making an index for several
> 		# fastq files
> 		use Bio::Index::Fastq;
> 		use strict;
>
> 		unless (scalar @ARGV>= 2){die "ERROR index_fastq:
> Usage: index_fastq<index file name>  <(list of) fastq file(s) to index>
> \n\n"}
>
> 		my $Index_File_Name = shift;
> 		my $inx = Bio::Index::Fastq->new('-filename' =>
> $Index_File_Name,'-write_flag' =>  1);
> 		   $inx->make_index(@ARGV);
>
> Any idea what the problem might be and how to fix it? Let me know if you
> have any insight. Thanks,
>
> David
>
>
>
> ---------------------------------------------------------------------------------------------------------
> This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.
>
>
> All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
> ---------------------------------------------------------------------------------------------------------
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>    

From biopython at maubp.freeserve.co.uk  Mon Apr  5 19:15:28 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 6 Apr 2010 00:15:28 +0100
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <4BBA69DF.6060508@bioperl.org>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<4BBA69DF.6060508@bioperl.org>
Message-ID: <h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>

On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich <jason at bioperl.org> wrote:
> Hi David - I am not sure this is going to be the right tool for the job.
>
> I'm concerned that none of the Bio::Index:: will really work for
> Illumina/NGS size data because once you get beyond about 4M hash
> keys things slow down quite dramatically and/or don't finish.
>
> I think we have to consider SQLite implementations or some more
> explicit way to handle larger keysize for hashes in the DB_File or
> BerkeleyDB approach. A similar slow problem can be seen if you
> just index a fastq converted fasta file from a single Illumina lane.

Another example, and this was in Python rather than Perl, but
SQLite got a thumbs up over an in house hash based approach:

http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.html

I think a new SQLite based Bio* OBF successor to the existing
BDB based OBDA standard for indexing files could be very interesting.

Peter

From cjfields at illinois.edu  Mon Apr  5 19:57:02 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 5 Apr 2010 18:57:02 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<4BBA69DF.6060508@bioperl.org>
	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>
Message-ID: <F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>

On Apr 5, 2010, at 6:15 PM, Peter wrote:

> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich <jason at bioperl.org> wrote:
>> Hi David - I am not sure this is going to be the right tool for the job.
>> 
>> I'm concerned that none of the Bio::Index:: will really work for
>> Illumina/NGS size data because once you get beyond about 4M hash
>> keys things slow down quite dramatically and/or don't finish.
>> 
>> I think we have to consider SQLite implementations or some more
>> explicit way to handle larger keysize for hashes in the DB_File or
>> BerkeleyDB approach. A similar slow problem can be seen if you
>> just index a fastq converted fasta file from a single Illumina lane.
> 
> Another example, and this was in Python rather than Perl, but
> SQLite got a thumbs up over an in house hash based approach:
> 
> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.html
> 
> I think a new SQLite based Bio* OBF successor to the existing
> BDB based OBDA standard for indexing files could be very interesting.
> 
> Peter

Would be nice to get some ideas performance-wise with some data sets.  SQLite is a very easy option (I'm using it routinely as well).

chris

From jun.yin at ucd.ie  Tue Apr  6 08:36:10 2010
From: jun.yin at ucd.ie (Jun Yin)
Date: Tue, 06 Apr 2010 13:36:10 +0100
Subject: [Bioperl-l] Application on BioPerl Summer of Code
In-Reply-To: <mailman.5232.1270134569.3372.bioperl-l@lists.open-bio.org>
References: <mailman.5232.1270134569.3372.bioperl-l@lists.open-bio.org>
Message-ID: <009201cad585$bc809330$3581b990$%yin@ucd.ie>

Dear all,

As you know, the application deadline is coming. I am still waiting for your
kind feedback on my proposal. I am planning to work on " (BioPerl) Alignment
Subsystem Refactoring ". Will anyone want to talk with me on that project,
and be the mentor?

My proposal is here:
http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100401/660d76de/
attachment.doc

My IRC is Jun, always online :)

Cheers,
Jun Yin
Ph.D.?student in U.C.D.

Bioinformatics Laboratory
Conway Institute
University College Dublin


 

__________ Information from ESET Smart Security, version of virus signature
database 5003 (20100406) __________

The message was checked by ESET Smart Security.

http://www.eset.com
 



From cjfields at illinois.edu  Tue Apr  6 10:16:14 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 6 Apr 2010 09:16:14 -0500
Subject: [Bioperl-l] Application on BioPerl Summer of Code
In-Reply-To: <009201cad585$bc809330$3581b990$%yin@ucd.ie>
References: <mailman.5232.1270134569.3372.bioperl-l@lists.open-bio.org>
	<009201cad585$bc809330$3581b990$%yin@ucd.ie>
Message-ID: <D79620A3-0672-4BED-B3BF-DDDC0B563076@illinois.edu>

Jun, 

You should definitely submit this to the GSoC OBF site; the proposal can be revised there.

It's a very good start, though the timeline needs some more detail.  For instance, it includes the community bonding period (first two goals).  That should be separate.  Separating those leaves three milestones, including two spanning over a month and the last one (cleanup).  Personally I'm not too concerned about the down-time in June-July unless we're running tight on milestones.

Overall, I think this is a very good approach to the problem at hand; I like the idea of possibly including BW compression.  You may want to check already-implemented tools along those lines; this might be beyond the stated goals, but it would be nice if time permits.  The ideas in the project may require creating another AlignI-like interface, but I don't necessarily consider that a bad thing. ;> 

chris

On Apr 6, 2010, at 7:36 AM, Jun Yin wrote:

> Dear all,
> 
> As you know, the application deadline is coming. I am still waiting for your
> kind feedback on my proposal. I am planning to work on " (BioPerl) Alignment
> Subsystem Refactoring ". Will anyone want to talk with me on that project,
> and be the mentor?
> 
> My proposal is here:
> http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100401/660d76de/
> attachment.doc
> 
> My IRC is Jun, always online :)
> 
> Cheers,
> Jun Yin
> Ph.D. student in U.C.D.
> 
> Bioinformatics Laboratory
> Conway Institute
> University College Dublin
> 
> 
> 
> 
> __________ Information from ESET Smart Security, version of virus signature
> database 5003 (20100406) __________
> 
> The message was checked by ESET Smart Security.
> 
> http://www.eset.com
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields1 at gmail.com  Tue Apr  6 10:54:38 2010
From: cjfields1 at gmail.com (Christopher Fields)
Date: Tue, 6 Apr 2010 09:54:38 -0500
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <87aatht1r0.fsf@renormalist.net>
References: <87aatht1r0.fsf@renormalist.net>
Message-ID: <41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>

Forwarding on to the mail list.  My hands are pretty full for the next couple of weeks, but I'll see what I can do from my end.

Anyone have something they can contribute to this?

chris

On Apr 6, 2010, at 3:37 AM, Steffen Schwigon wrote:

> Hi!
> 
> I'm currently collecting workloads for Perl that are worth
> benchmarking in order to generate numbers with which in turn I hope to
> create a long-term use case (and maybe even a business-case for
> someone) where Perl could be improved.
> 
> The near-term goal is just getting benchmark numbers.
> 
> You seem to be active in Bio-Perl. 
> I saw you in the GSoC 2010 announcement.
> 
> Could you provide me examples of heavy workloads that I could run and
> that are meaningful to users/consumers of Bio-Perl?
> 
> I would need it ready prepared so that I can start it with just
> dependencies from CPAN as I don't know anything about Bio-Perl.
> 
> Ideally something that leverages parallelism suited for
> multi-core/multi-cpu machines.
> 
> Initially I would integrate this into my Benchmark::Perl::Formance
> suite on CPAN but the background of this effort is to make it
> ?corporate? relevant.
> 
> Feel free to pass-through this request to someone more appropriate.
> 
> Thanks.
> 
> Kind regards,
> Steffen 
> -- 
> Steffen Schwigon <ss5@@renormalist.net>
> Dresden Perl Mongers <http://dresden-pm.org/>



From rmb32 at cornell.edu  Tue Apr  6 12:11:32 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Tue, 06 Apr 2010 09:11:32 -0700
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
References: <87aatht1r0.fsf@renormalist.net>
	<41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
Message-ID: <4BBB5D34.4060108@cornell.edu>

Steffen:  what kind of ballpark runtimes do you want for each benchmark? 
    1 hour? 12 hours? 1 day?

Rob

Christopher Fields wrote:
> Forwarding on to the mail list.  My hands are pretty full for the next couple of weeks, but I'll see what I can do from my end.
> 
> Anyone have something they can contribute to this?
> 
> chris
> 
> On Apr 6, 2010, at 3:37 AM, Steffen Schwigon wrote:
> 
>> Hi!
>>
>> I'm currently collecting workloads for Perl that are worth
>> benchmarking in order to generate numbers with which in turn I hope to
>> create a long-term use case (and maybe even a business-case for
>> someone) where Perl could be improved.
>>
>> The near-term goal is just getting benchmark numbers.
>>
>> You seem to be active in Bio-Perl. 
>> I saw you in the GSoC 2010 announcement.
>>
>> Could you provide me examples of heavy workloads that I could run and
>> that are meaningful to users/consumers of Bio-Perl?
>>
>> I would need it ready prepared so that I can start it with just
>> dependencies from CPAN as I don't know anything about Bio-Perl.
>>
>> Ideally something that leverages parallelism suited for
>> multi-core/multi-cpu machines.
>>
>> Initially I would integrate this into my Benchmark::Perl::Formance
>> suite on CPAN but the background of this effort is to make it
>> ?corporate? relevant.
>>
>> Feel free to pass-through this request to someone more appropriate.
>>
>> Thanks.
>>
>> Kind regards,
>> Steffen 
>> -- 
>> Steffen Schwigon <ss5@@renormalist.net>
>> Dresden Perl Mongers <http://dresden-pm.org/>
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From nucleic at gmail.com  Mon Apr  5 18:43:34 2010
From: nucleic at gmail.com (Murtaza)
Date: Tue, 6 Apr 2010 04:28:34 +0545
Subject: [Bioperl-l] Google Summer of Code
In-Reply-To: <4BB8C13B.3000103@cornell.edu>
References: <h2q594925001004040927g51c179e6o869dcad4b01529ae@mail.gmail.com>
	<4BB8C13B.3000103@cornell.edu>
Message-ID: <n2q594925001004051543j68ef79ahf26ab1231f005e39@mail.gmail.com>

Hi everyone,

Looking forward to a reply regarding my interest to work on Google
Summer of Code BioPerl projects.

Thank you,
Murtaza

On Sun, Apr 4, 2010 at 10:41 PM, Robert Buels <rmb32 at cornell.edu> wrote:
> Hello Murtaza,
>
> The first point of contact for each project is the relevant project's
> mailing list, which in this case is bioperl-l at lists.open-bio.org. ?I'm CCIng
> this there.
>
> Keep in mind that the summer of code application deadline is April 9th,
> 19:00 UTC, which is in just 5 days.
>
> Rob
>
> Murtaza wrote:
>>
>> Dear Robert,
>>
>> I am interested in working on the project titled "Perl Run Wrappers for
>> External Programs in a Flash". I am current a student of medicine with an
>> active interest in programming and bioinformatics. I am quite comfortable
>> with learning new languages as need and I have also worked with perl as well
>> as XML in the past.
>> I will really appreciate if you could put me in touch with the right
>> person for this project. If as part of summer of code, my medical background
>> and my skills and interest in computers can be used in a better way besides
>> this project, please do suggest such opportunities.
>>
>> My primary objective in applying for summer of code is to experience
>> development of tools for bioinformatics before I go on to do some more
>> research in Cancer Genomics (a program I have been accepted into at the
>> University of Cambridge starting in Fall 2010).
>>
>> I will look forward to your advice.
>>
>> Best Regards,
>> Murtaza
>>
>>
>>
>> --
>> Muhammed Murtaza
>> nucleic at gmail.com <mailto:nucleic at gmail.com>
>>
>> "Any good poet, in our age at least, must begin with the scientific view
>> of the world; and any scientist worth listening to must be something of a
>> poet, must possess the ability to communicate to the rest of us his sense of
>> love and wonder at what his work discovers."
>>
>> -Edward Abbey, The Journey Home
>
>



-- 
Muhammed Murtaza
nucleic at gmail.com

"Any good poet, in our age at least, must begin with the scientific
view of the world; and any scientist worth listening to must be
something of a poet, must possess the ability to communicate to the
rest of us his sense of love and wonder at what his work discovers."

-Edward Abbey, The Journey Home


From priyanka.hpj at gmail.com  Tue Apr  6 05:02:04 2010
From: priyanka.hpj at gmail.com (Priyanka Joshi)
Date: Tue, 6 Apr 2010 14:32:04 +0530
Subject: [Bioperl-l] Regarding google summer of code 2010
In-Reply-To: <q2y5e9d159a1004060145oc73ac152xf6755466e24a134c@mail.gmail.com>
References: <q2y5e9d159a1004060145oc73ac152xf6755466e24a134c@mail.gmail.com>
Message-ID: <k2t5e9d159a1004060202ze56e608ewa17f21b9a339623d@mail.gmail.com>

---------- Forwarded message ----------
From: Priyanka Joshi <priyanka.hpj at gmail.com>
Date: Tue, Apr 6, 2010 at 2:15 PM
Subject: Regarding google summer of code 2010
To: phylosoc at nescent.org


Dear Sir,
I am an undergraduate student majoring in Bioinformatics at Institute of
Bioinformatics and Biotechnology, University of Pune, Pune, India. I am
interested in participating in the google summer of code 2010 and work
towards developing a code for open source. i am particulary interested in
network biology, hidden markov models and neural networks with a keen
interest in developing code for the analyses of cancer genomes, their
genetic networks and evolution. Please if you could help me choose a project
so that I can learn and creatively develop something during my summers.
Please find my CV as an attachment. Also, briefly, I am mentioning my
computational skills:

?         Platform: Windows NT/95/2000/XP/Vista, Linux

?         Programming/ Scripting languages Languages: C, Perl,
Python(Basics)

?         Database: MS Access

?         Sequence Analysis: FASTA, BLAST suite

?         Softwares: R Statistical Computing (Basics), Matlab, MODELLER,
AutoDock, Hex, Phylip, Pymol, Rasmol, RasTop
Please help me choose a project and guide me. Looking forward to hearing
from you.
Thanking you in anticipation
With Regards
Priyanka Joshi
4th year Undergraduate Student
Institute of Bioinformatics and Biotechnology
University of Pune
Pune-411007
India
Ph: +919637436773
email: priyanka_0982000 at yahoo.co.in, priyanka.hpj at gmail.com
-------------- next part --------------
A non-text attachment was scrubbed...
Name: CV.Priyanka Joshi.2003format.doc
Type: application/msword
Size: 95744 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100406/3c8ffe95/attachment-0001.doc>

From jun.yin at ucd.ie  Tue Apr  6 08:56:10 2010
From: jun.yin at ucd.ie (Jun Yin)
Date: Tue, 06 Apr 2010 13:56:10 +0100
Subject: [Bioperl-l] Application on BioPerl Summer of Code
References: <mailman.5232.1270134569.3372.bioperl-l@lists.open-bio.org>
Message-ID: <009301cad588$87b5fd40$9721f7c0$%yin@ucd.ie>

Hi,

Please refer to this proposal. I just added a few things, e.g. link of my
published Perl scripts and a few sentences on the interest for project.

Cheers,
Jun Yin
Ph.D.?student in U.C.D.

Bioinformatics Laboratory
Conway Institute
University College Dublin


-----Original Message-----
From: Jun Yin [mailto:jun.yin at ucd.ie] 
Sent: Tuesday, April 06, 2010 1:36 PM
To: 'bioperl-l at lists.open-bio.org'
Subject: RE: Application on BioPerl Summer of Code 

Dear all,

As you know, the application deadline is coming. I am still waiting for your
kind feedback on my proposal. I am planning to work on " (BioPerl) Alignment
Subsystem Refactoring ". Will anyone want to talk with me on that project,
and be the mentor?

My proposal is here:
http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100401/660d76de/
attachment.doc

My IRC is Jun, always online :)

Cheers,
Jun Yin
Ph.D.?student in U.C.D.

Bioinformatics Laboratory
Conway Institute
University College Dublin


 

__________ Information from ESET Smart Security, version of virus signature
database 5003 (20100406) __________

The message was checked by ESET Smart Security.

http://www.eset.com
 
 

__________ Information from ESET Smart Security, version of virus signature
database 5003 (20100406) __________

The message was checked by ESET Smart Security.

http://www.eset.com
 
-------------- next part --------------
A non-text attachment was scrubbed...
Name: JunYin_SummerCodeApplication0406.doc
Type: application/msword
Size: 43520 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100406/4a768405/attachment-0001.doc>

From ss5 at renormalist.net  Tue Apr  6 12:42:43 2010
From: ss5 at renormalist.net (Steffen Schwigon)
Date: Tue, 06 Apr 2010 18:42:43 +0200
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <4BBB5D34.4060108@cornell.edu> (Robert Buels's message of "Tue\,
	06 Apr 2010 09\:11\:32 -0700")
References: <87aatht1r0.fsf@renormalist.net>
	<41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
	<4BBB5D34.4060108@cornell.edu>
Message-ID: <87ochwr0qk.fsf@renormalist.net>

Robert Buels <rmb32 at cornell.edu> writes:
> Steffen: what kind of ballpark runtimes do you want for each
> benchmark?  1 hour? 12 hours? 1 day?

1h would be enough, I think.

It should be just big enough to not be completed within seconds when
switching from my everyday desktop to a fast 16+ core machine.

So if in doubt, I would also take a look at the 12h run?

Thanks.

Kind regards,
Steffen 
-- 
Steffen Schwigon <ss5 at renormalist.net>
Dresden Perl Mongers <http://dresden-pm.org/>


From robert.bradbury at gmail.com  Tue Apr  6 15:01:11 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Tue, 6 Apr 2010 15:01:11 -0400
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <87ochwr0qk.fsf@renormalist.net>
References: <87aatht1r0.fsf@renormalist.net>
	<41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
	<4BBB5D34.4060108@cornell.edu> <87ochwr0qk.fsf@renormalist.net>
Message-ID: <p2zdeaa866a1004061201rd940b44fx21c7f94ba864b0c4@mail.gmail.com>

>From my experience with even old desktop machines (2.8 GHz Pentium
Prescott) it is hard to get anything that takes an hour (even Firefox
or Chrome build from source in a few hours).  Creating genome indexes
usually only takes a couple of minutes.  Single gene blast homology
searches (which are generally done in C, not Perl) of entire genomes
only take a couple of minutes.

If you want something that takes an hour its going to have to be very
wide or very deep (low homology searches?; lots of gene searches
across many genomes?)  The only things I can think of that require
that much CPU are whole genome assembly (which I don't recall BioPerl
being designed to do) or perhaps chromosomal synteny searches across
multiple genomes (which I also don't recall BioPerl handling).

The problem that one has (since one is benchmarking Perl) is the
identification of CPU intensive tasks which have not already been
dropped down to the level of using C code instead of Perl.  (Also as
an aside, one might cite the trend to move even the C code into the
GPU as I believe has been done for projects like SETI at HOME,
Folding at HOME, etc.  If its CPU intensive it is likely to be recoded to
take advantage of the best available hardware).

If one is going to do Perl benchmarking one needs to identify those
applications which are best implemented in Perl and are not
easily/have not been re-implemented in C or driven down to the
hardware level.  So one really needs suggestions from the user
community as to what kinds of work fit that description that one could
construct benchmarks around.

On 4/6/10, Steffen Schwigon <ss5 at renormalist.net> wrote:
> Robert Buels <rmb32 at cornell.edu> writes:
>> Steffen: what kind of ballpark runtimes do you want for each
>> benchmark?  1 hour? 12 hours? 1 day?
>
> 1h would be enough, I think.
>
> It should be just big enough to not be completed within seconds when
> switching from my everyday desktop to a fast 16+ core machine.
>
> So if in doubt, I would also take a look at the 12h run?
>
> Thanks.
>
> Kind regards,
> Steffen
> --
> Steffen Schwigon <ss5 at renormalist.net>
> Dresden Perl Mongers <http://dresden-pm.org/>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From tristan.lefebure at gmail.com  Tue Apr  6 15:33:21 2010
From: tristan.lefebure at gmail.com (Tristan Lefebure)
Date: Tue, 6 Apr 2010 15:33:21 -0400
Subject: [Bioperl-l] Bio::Index::BlastTable->fetch_report
Message-ID: <201004061533.22259.tristan.lefebure@gmail.com>

Hello,

I am fetching blast results from an indexed blast table. 
Everything works great except when a sequence shows no hit 
to anything. Because of the table format, the protein does 
not show up in the table, and when you try to fetch the 
report, you get something like that:



my $p = 'Sag4|SAL_2304';
my $inx = Bio::Index::BlastTable->new(-filename => $blastdb,
                                   -write_flag => 0);
my $blast_result = $inx->fetch_report($p);


------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Unable to find a record for Sag4|SAL_2304 in the flat 
file index
STACK: Error::throw
STACK: Bio::Root::Root::throw /opt/src/bioperl-
live//Bio/Root/Root.pm:368
STACK: Bio::Index::Abstract::get_stream /opt/src/bioperl-
live//Bio/Index/Abstract.pm:306
STACK: Bio::Index::BlastTable::fetch_report 
/opt/src/bioperl-live//Bio/Index/BlastTable.pm:162


I think that there is not much we can do, but would it be 
possible to have fetch_report() just return an error or an 
empty result, instead of an error? Any other way to detect 
and skip sequences that have no hits would also work....


Thanks!

--Tristan

From tristan.lefebure at gmail.com  Tue Apr  6 15:45:23 2010
From: tristan.lefebure at gmail.com (Tristan Lefebure)
Date: Tue, 6 Apr 2010 12:45:23 -0700 (PDT)
Subject: [Bioperl-l] Bio::Index::BlastTable->fetch_report
In-Reply-To: <201004061533.22259.tristan.lefebure@gmail.com>
References: <201004061533.22259.tristan.lefebure@gmail.com>
Message-ID: <32a15d99-4b57-47b0-8929-2878366af9b5@z4g2000yqa.googlegroups.com>

> Any other way to detect
> and skip sequences that have no hits would also work....

replying to myself: what about having a is_a_query() methods in this
module?

That would make something like:


my $p = 'Sag4|SAL_2304';
my $inx = Bio::Index::BlastTable->new(-filename => $blastdb,
                                   -write_flag => 0);
if($inx->is_a_query($p)) {
       my $blast_result = $inx->fetch_report($p);
}


????

From cjfields at illinois.edu  Tue Apr  6 15:47:59 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 6 Apr 2010 14:47:59 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<4BBA69DF.6060508@bioperl.org>
	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>
	<F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>
	<B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>
Message-ID: <2829AFCF-3F90-451A-AC27-5196041FCA73@illinois.edu>

No problem, it points to issue in the current implementation that need addressing.

Jason, you thinking we just need to replace BDB with SQLite, or you thinking something else?  

chris

On Apr 6, 2010, at 2:38 PM, KOVALIC, DAVID K [AG/1000] wrote:

> Guys,
> 
> Thanks for information; it is good to know what the problem is.
> 
> I am afraid I am not much of a programmer so I am not liable to be much
> help with any work switching out the back-end. I can however volunteer
> for testing purposes if this helps at all.
> 
> I think this is just a case of NGS data volumes having overtaken a
> previously adequate implementations.
> 
> David
> 
> 
> -----Original Message-----
> From: Chris Fields [mailto:cjfields at illinois.edu] 
> Sent: Monday, April 05, 2010 6:57 PM
> To: Peter
> Cc: Jason Stajich; KOVALIC, DAVID K [AG/1000]; bioperl-l at bioperl.org
> Subject: Re: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
> (multiple) fastq files failure
> 
> On Apr 5, 2010, at 6:15 PM, Peter wrote:
> 
>> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich <jason at bioperl.org>
> wrote:
>>> Hi David - I am not sure this is going to be the right tool for the
> job.
>>> 
>>> I'm concerned that none of the Bio::Index:: will really work for
>>> Illumina/NGS size data because once you get beyond about 4M hash
>>> keys things slow down quite dramatically and/or don't finish.
>>> 
>>> I think we have to consider SQLite implementations or some more
>>> explicit way to handle larger keysize for hashes in the DB_File or
>>> BerkeleyDB approach. A similar slow problem can be seen if you
>>> just index a fastq converted fasta file from a single Illumina lane.
>> 
>> Another example, and this was in Python rather than Perl, but
>> SQLite got a thumbs up over an in house hash based approach:
>> 
>> 
> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.htm
> l
>> 
>> I think a new SQLite based Bio* OBF successor to the existing
>> BDB based OBDA standard for indexing files could be very interesting.
>> 
>> Peter
> 
> Would be nice to get some ideas performance-wise with some data sets.
> SQLite is a very easy option (I'm using it routinely as well).
> 
> chris
> 
> ---------------------------------------------------------------------------------------------------------
> This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.
> 
> 
> All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
> ---------------------------------------------------------------------------------------------------------
> 



From jason at bioperl.org  Tue Apr  6 16:28:18 2010
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 06 Apr 2010 13:28:18 -0700
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <2829AFCF-3F90-451A-AC27-5196041FCA73@illinois.edu>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<4BBA69DF.6060508@bioperl.org>
	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>
	<F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>
	<B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>
	<2829AFCF-3F90-451A-AC27-5196041FCA73@illinois.edu>
Message-ID: <4BBB9962.4060000@bioperl.org>

I think it is a SQLite is a good solution but I still found things a bit 
slow when I was storing all the data in the db, but if we are instead 
just indexing byte offsets in the file (which is what the current 
indexing is doing) maybe it will perform well enough.

One question on implementing this is do we want to have plug-in 
implementations to the Bio::Index:: classes (and Bio::DB::Fasta as well 
I would think) that can abstract the indexing method or just a new 
implementation as Bio::Index::FastqSQLite...   Or we can just replace 
BDB/DB_File with SQLite and now have a new required dependency?

I'd want to also look at the solutions employed in some of the short 
read aligners if they do index the fastq files in any other way.

-jason
Chris Fields wrote, On 4/6/10 12:47 PM:
> No problem, it points to issue in the current implementation that need addressing.
>
> Jason, you thinking we just need to replace BDB with SQLite, or you thinking something else?
>
> chris
>
> On Apr 6, 2010, at 2:38 PM, KOVALIC, DAVID K [AG/1000] wrote:
>
>    
>> Guys,
>>
>> Thanks for information; it is good to know what the problem is.
>>
>> I am afraid I am not much of a programmer so I am not liable to be much
>> help with any work switching out the back-end. I can however volunteer
>> for testing purposes if this helps at all.
>>
>> I think this is just a case of NGS data volumes having overtaken a
>> previously adequate implementations.
>>
>> David
>>
>>
>> -----Original Message-----
>> From: Chris Fields [mailto:cjfields at illinois.edu]
>> Sent: Monday, April 05, 2010 6:57 PM
>> To: Peter
>> Cc: Jason Stajich; KOVALIC, DAVID K [AG/1000]; bioperl-l at bioperl.org
>> Subject: Re: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
>> (multiple) fastq files failure
>>
>> On Apr 5, 2010, at 6:15 PM, Peter wrote:
>>
>>      
>>> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich<jason at bioperl.org>
>>>        
>> wrote:
>>      
>>>> Hi David - I am not sure this is going to be the right tool for the
>>>>          
>> job.
>>      
>>>> I'm concerned that none of the Bio::Index:: will really work for
>>>> Illumina/NGS size data because once you get beyond about 4M hash
>>>> keys things slow down quite dramatically and/or don't finish.
>>>>
>>>> I think we have to consider SQLite implementations or some more
>>>> explicit way to handle larger keysize for hashes in the DB_File or
>>>> BerkeleyDB approach. A similar slow problem can be seen if you
>>>> just index a fastq converted fasta file from a single Illumina lane.
>>>>          
>>> Another example, and this was in Python rather than Perl, but
>>> SQLite got a thumbs up over an in house hash based approach:
>>>
>>>
>>>        
>> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.htm
>> l
>>      
>>> I think a new SQLite based Bio* OBF successor to the existing
>>> BDB based OBDA standard for indexing files could be very interesting.
>>>
>>> Peter
>>>        
>> Would be nice to get some ideas performance-wise with some data sets.
>> SQLite is a very easy option (I'm using it routinely as well).
>>
>> chris
>>
>> ---------------------------------------------------------------------------------------------------------
>> This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.
>>
>>
>> All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
>> ---------------------------------------------------------------------------------------------------------
>>
>>      
>
>    

From david.k.kovalic at monsanto.com  Tue Apr  6 15:38:11 2010
From: david.k.kovalic at monsanto.com (KOVALIC, DAVID K [AG/1000])
Date: Tue, 6 Apr 2010 14:38:11 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<4BBA69DF.6060508@bioperl.org>
	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>
	<F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>
Message-ID: <B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>

Guys,

Thanks for information; it is good to know what the problem is.

I am afraid I am not much of a programmer so I am not liable to be much
help with any work switching out the back-end. I can however volunteer
for testing purposes if this helps at all.

I think this is just a case of NGS data volumes having overtaken a
previously adequate implementations.

David


-----Original Message-----
From: Chris Fields [mailto:cjfields at illinois.edu] 
Sent: Monday, April 05, 2010 6:57 PM
To: Peter
Cc: Jason Stajich; KOVALIC, DAVID K [AG/1000]; bioperl-l at bioperl.org
Subject: Re: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
(multiple) fastq files failure

On Apr 5, 2010, at 6:15 PM, Peter wrote:

> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich <jason at bioperl.org>
wrote:
>> Hi David - I am not sure this is going to be the right tool for the
job.
>> 
>> I'm concerned that none of the Bio::Index:: will really work for
>> Illumina/NGS size data because once you get beyond about 4M hash
>> keys things slow down quite dramatically and/or don't finish.
>> 
>> I think we have to consider SQLite implementations or some more
>> explicit way to handle larger keysize for hashes in the DB_File or
>> BerkeleyDB approach. A similar slow problem can be seen if you
>> just index a fastq converted fasta file from a single Illumina lane.
> 
> Another example, and this was in Python rather than Perl, but
> SQLite got a thumbs up over an in house hash based approach:
> 
>
http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.htm
l
> 
> I think a new SQLite based Bio* OBF successor to the existing
> BDB based OBDA standard for indexing files could be very interesting.
> 
> Peter

Would be nice to get some ideas performance-wise with some data sets.
SQLite is a very easy option (I'm using it routinely as well).

chris

---------------------------------------------------------------------------------------------------------
This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.


All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
---------------------------------------------------------------------------------------------------------



From ss5 at renormalist.net  Tue Apr  6 18:35:54 2010
From: ss5 at renormalist.net (Steffen Schwigon)
Date: Wed, 07 Apr 2010 00:35:54 +0200
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <p2zdeaa866a1004061201rd940b44fx21c7f94ba864b0c4@mail.gmail.com>
	(Robert Bradbury's message of "Tue\, 6 Apr 2010 15\:01\:11 -0400")
References: <87aatht1r0.fsf@renormalist.net>
	<41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
	<4BBB5D34.4060108@cornell.edu> <87ochwr0qk.fsf@renormalist.net>
	<p2zdeaa866a1004061201rd940b44fx21c7f94ba864b0c4@mail.gmail.com>
Message-ID: <87mxxgmcol.fsf@renormalist.net>

Robert Bradbury <robert.bradbury at gmail.com> writes:
> Creating genome indexes usually only takes a couple of minutes.
> Single gene blast homology searches (which are generally done in C,
> not Perl) of entire genomes only take a couple of minutes.

Then I would also take the ?some minutes? workloads.
I just said 1h because I thought I had a choice.


> If you want something that takes an hour its going to have to be very
> wide or very deep (low homology searches?; lots of gene searches
> across many genomes?)  The only things I can think of that require
> that much CPU are whole genome assembly (which I don't recall BioPerl
> being designed to do) or perhaps chromosomal synteny searches across
> multiple genomes (which I also don't recall BioPerl handling).

I do not understand that but for my purposes I just trust you and I
think it just needs to be ?typical? for Bio-Perl use-cases.

It's like with SpamAssassin: they provide a corpus of known spam/ham
mails and I just process it like it's in the README; and fortunately
it takes some minutes or at least noticeably many seconds.


> If one is going to do Perl benchmarking one needs to identify those
> applications which are best implemented in Perl and are not
> easily/have not been re-implemented in C or driven down to the
> hardware level.

Yep. That's what I'm looking for. And some of that Bio-Perl *has* to
be Perl for a reason, hasn't it?

That's why I'm asking here. And feel free to point me to other Perl
problem domains worth to ask if you know one?

Thanks.

Kind regards,
Steffen 
-- 
Steffen Schwigon <ss5 at renormalist.net>
Dresden Perl Mongers <http://dresden-pm.org/>


From bachar.cheaib at etu.upmc.fr  Wed Apr  7 05:02:58 2010
From: bachar.cheaib at etu.upmc.fr (Bachar CHEAIB)
Date: Wed, 07 Apr 2010 11:02:58 +0200
Subject: [Bioperl-l] (no subject)
Message-ID: <20100407110258.2emhtg7eo0oc4scs@webmail.etu.upmc.fr>

Dear developers, professors,

Good morning,

I'm currently a student preparing a diploma titled "Etudes Sup?rieures  
en m?tag?nomique comparative et bioinformatique" in "Universit? Pierre  
et Marie Curie" Paris. In fact, I have pursued a Professional Master a  
tow years ago at "Universit? de Clermond Ferrand II".

I know a few modules in Bio-Perl, but I missed experiences in  
development. I would like to learn more and more in your community.  
I'm very interested on developing modules in BIOPERL, for example, the  
project titled "Perl Run Wrappers for External Programs in a Flash".  
For this, I solicit your help for guiding me in a Summer School or an  
other program format to acquire a development skills in bioperl.

This desirable experience will be necessary for me to apply for a phd  
programs in Evolutionary Bioinformatics .

I will grateful for your advice and your help

Kindly Regards,

Bashar cheaib.





From till.bayer at kaust.edu.sa  Wed Apr  7 09:25:22 2010
From: till.bayer at kaust.edu.sa (Till Bayer)
Date: Wed, 07 Apr 2010 16:25:22 +0300
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <1C35356D-97E7-49B3-9C6D-41C6CCAB6A56@gmail.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>	<4BBA69DF.6060508@bioperl.org>	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>	<F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>	<B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>	<2829AFCF-3F90-451A-AC27-5196041FCA73@illinois.edu>
	<4BBB9962.4060000@bioperl.org> <4BBC2485.2050808@kaust.edu.sa>
	<4BBC2770.30602@bioperl.org>
	<1C35356D-97E7-49B3-9C6D-41C6CCAB6A56@gmail.com>
Message-ID: <4BBC87C2.7080905@kaust.edu.sa>

Hey Chris,

 > This does sound like a very good solution, would just need a max 
value to trigger the warning.

A problem may be that the module does not know the number of fastq 
entries before it gets done indexing. Or does the index go into memory 
first and is dumped into the DB afterwards?
If not maybe the warning could be triggered by the fastq file size? 
That's hardly accurate, but better than nothing...

Cheers,

Till

On 4/7/2010 3:36 PM, Christopher Fields wrote:
> Jason, Till,
>
> Did you notice who the author was?  That would be our own Mark Jensen!  ;>
>
> http://search.cpan.org/~majensen/SQLite_File-0.02/
>
> This does sound like a very good solution, would just need a max value to trigger the warning.  I'll still need to look over the FASTQ index module to ensure it's indexing correctly (I think it does in most cases), but this should be much easier to implement.
>
> chris
>
> On Apr 7, 2010, at 1:34 AM, Jason Stajich wrote:
>
>> Thanks Till!  That might solve the problem quite well and would be worth a benchmarking attempt to see what happens.
>>
>> -jason
>> Till Bayer wrote, On 4/6/10 11:21 PM:
>>> Hey,
>>>
>>> there is also SQLite_File, which has DB_File emulation and can be used with AnyDBM_File to just store the offsets. It adds another layer, but you could avoid another module or a required dependency, I guess.
>>> Maybe there could be a warning like 'you are indexing large fastq file, this would work better if DBD::SQLite was installed'.
>>>
>>> Cheers,
>>>
>>> Till
>>>
>>>
>>> On 4/6/2010 11:28 PM, Jason Stajich wrote:
>>>> I think it is a SQLite is a good solution but I still found things a bit
>>>> slow when I was storing all the data in the db, but if we are instead
>>>> just indexing byte offsets in the file (which is what the current
>>>> indexing is doing) maybe it will perform well enough.
>>>>
>>>> One question on implementing this is do we want to have plug-in
>>>> implementations to the Bio::Index:: classes (and Bio::DB::Fasta as well
>>>> I would think) that can abstract the indexing method or just a new
>>>> implementation as Bio::Index::FastqSQLite... Or we can just replace
>>>> BDB/DB_File with SQLite and now have a new required dependency?
>>>>
>>>> I'd want to also look at the solutions employed in some of the short
>>>> read aligners if they do index the fastq files in any other way.
>>>>
>>>> -jason
>>>> Chris Fields wrote, On 4/6/10 12:47 PM:
>>>>> No problem, it points to issue in the current implementation that need
>>>>> addressing.
>>>>>
>>>>> Jason, you thinking we just need to replace BDB with SQLite, or you
>>>>> thinking something else?
>>>>>
>>>>> chris
>>>>>
>>>>> On Apr 6, 2010, at 2:38 PM, KOVALIC, DAVID K [AG/1000] wrote:
>>>>>
>>>>>> Guys,
>>>>>>
>>>>>> Thanks for information; it is good to know what the problem is.
>>>>>>
>>>>>> I am afraid I am not much of a programmer so I am not liable to be much
>>>>>> help with any work switching out the back-end. I can however volunteer
>>>>>> for testing purposes if this helps at all.
>>>>>>
>>>>>> I think this is just a case of NGS data volumes having overtaken a
>>>>>> previously adequate implementations.
>>>>>>
>>>>>> David
>>>>>>
>>>>>>
>>>>>> -----Original Message-----
>>>>>> From: Chris Fields [mailto:cjfields at illinois.edu]
>>>>>> Sent: Monday, April 05, 2010 6:57 PM
>>>>>> To: Peter
>>>>>> Cc: Jason Stajich; KOVALIC, DAVID K [AG/1000]; bioperl-l at bioperl.org
>>>>>> Subject: Re: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
>>>>>> (multiple) fastq files failure
>>>>>>
>>>>>> On Apr 5, 2010, at 6:15 PM, Peter wrote:
>>>>>>
>>>>>>> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich<jason at bioperl.org>
>>>>>> wrote:
>>>>>>>> Hi David - I am not sure this is going to be the right tool for the
>>>>>> job.
>>>>>>>> I'm concerned that none of the Bio::Index:: will really work for
>>>>>>>> Illumina/NGS size data because once you get beyond about 4M hash
>>>>>>>> keys things slow down quite dramatically and/or don't finish.
>>>>>>>>
>>>>>>>> I think we have to consider SQLite implementations or some more
>>>>>>>> explicit way to handle larger keysize for hashes in the DB_File or
>>>>>>>> BerkeleyDB approach. A similar slow problem can be seen if you
>>>>>>>> just index a fastq converted fasta file from a single Illumina lane.
>>>>>>> Another example, and this was in Python rather than Perl, but
>>>>>>> SQLite got a thumbs up over an in house hash based approach:
>>>>>> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.htm
>>>>>> l
>>>>>>> I think a new SQLite based Bio* OBF successor to the existing
>>>>>>> BDB based OBDA standard for indexing files could be very interesting.
>>>>>>>
>>>>>>> Peter
>>>>>> Would be nice to get some ideas performance-wise with some data sets.
>>>>>> SQLite is a very easy option (I'm using it routinely as well).
>>>>>>
>>>>>> chris
>>>>>>
>>>>>> ---------------------------------------------------------------------------------------------------------
>>>>>>
>>>>>> This e-mail message may contain privileged and/or confidential
>>>>>> information, and is intended to be received only by persons entitled
>>>>>> to receive such information. If you have received this e-mail in
>>>>>> error, please notify the sender immediately. Please delete it and all
>>>>>> attachments from any servers, hard drives or any other media. Other
>>>>>> use of this e-mail by you is strictly prohibited.
>>>>>>
>>>>>>
>>>>>> All e-mails and attachments sent and received are subject to
>>>>>> monitoring, reading and archival by Monsanto, including its
>>>>>> subsidiaries. The recipient of this e-mail is solely responsible for
>>>>>> checking for the presence of "Viruses" or other "Malware". Monsanto,
>>>>>> along with its subsidiaries, accepts no liability for any damage
>>>>>> caused by any such code transmitted by or accompanying this e-mail or
>>>>>> any attachment.
>>>>>> ---------------------------------------------------------------------------------------------------------
>>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


-- 
Till Bayer
4700 King Abdullah University for Science and Technology
Building 2, Room 4231-W16
Thuwal 23955-6900
Saudi Arabia
Phone: +96628082373

From MEC at stowers.org  Wed Apr  7 11:25:05 2010
From: MEC at stowers.org (Cook, Malcolm)
Date: Wed, 7 Apr 2010 10:25:05 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple)	fastq files failure
In-Reply-To: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>

c.f. http://github.com/acr/screed
 
 

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of KOVALIC, DAVID K [AG/1000]
Sent: Monday, April 05, 2010 1:28 PM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing (multiple) fastq files failure

Hi,

Using the example code for this module I get an error building an index
file:

		>index_fastq Run101_s11_test_index
100108_SOLEXA-02_0101_PE_61810AAXX/s_1_1_sequence.txt
		sdbm store returned -1, errno 22, key
"SOLEXA-02_0001:1:55:1110:290#0/1" at
/bli/lib/SunOS/perl5/site_perl/5.6.1/Bio/Index/Abstract.pm line 714, <FASTQ> line 30369077.

The code to build index file/retrieve sequences works on small test file but not the real data (fasyq file from single Illumina GAII lane). Here is the code for building the index.

Index_fastq:
		# Complete code for making an index for several
		# fastq files
		use Bio::Index::Fastq;
		use strict;

		unless (scalar @ARGV >= 2){die "ERROR index_fastq:
Usage: index_fastq <index file name> <(list of) fastq file(s) to index> \n\n"}

		my $Index_File_Name = shift;
		my $inx = Bio::Index::Fastq->new('-filename' => $Index_File_Name,'-write_flag' => 1);
		   $inx->make_index(@ARGV);

Any idea what the problem might be and how to fix it? Let me know if you have any insight. Thanks,

David



---------------------------------------------------------------------------------------------------------
This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited.


All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment.
---------------------------------------------------------------------------------------------------------


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From biopython at maubp.freeserve.co.uk  Wed Apr  7 11:45:54 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 16:45:54 +0100
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
Message-ID: <q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>

On Wed, Apr 7, 2010 at 4:25 PM, Cook, Malcolm <MEC at stowers.org> wrote:
> c.f. http://github.com/acr/screed

That's the python thing I referred to earlier, which turned out to be much
slower than SQLite (comparing storing the FASTQ data in an indexed
form, not just storing the file offsets):

http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.html
http://ivory.idyll.org/blog/mar-10/storing-and-retrieving-sequences.html

Peter

From artg at cs.nyu.edu  Wed Apr  7 12:14:55 2010
From: artg at cs.nyu.edu (ARTHUR GOLDBERG)
Date: Wed, 7 Apr 2010 12:14:55 -0400
Subject: [Bioperl-l] Support for KEGG
Message-ID: <8380301F-837E-44A3-95CB-72932ED1B290@cs.nyu.edu>

Hi

Does Bioperl support Kegg non-sequence data such as pathways?  
(Bio::SeqIO::kegg supports KEGG sequence data.)
For example, Kegg's web services interface provides loads of access to  
Kegg pathway, gene and enzyme info. However, even it doesn't support  
things like the pathway hierarchy distributed in files in ftp://ftp.genome.jp/pub/kegg/brite/organisms/ 
.

BR
A



Arthur P. Goldberg, PhD

Research Scientist in Bioinformatics
Plant Systems Biology Laboratory
www.virtualplant.org

Visiting Academic
Computer Science Department
Courant Institute of Mathematical Sciences
www.cs.nyu.edu/artg

artg at cs.nyu.edu
New York University
212 995-4918
Coruzzi Lab
8th Floor Silver Building
1009 Silver Center
100 Washington Sq East
New York NY 10003-6688




From umjsm at leeds.ac.uk  Wed Apr  7 12:23:49 2010
From: umjsm at leeds.ac.uk (Joan Segura Mora)
Date: Wed, 07 Apr 2010 17:23:49 +0100
Subject: [Bioperl-l] parsing blast reports
Message-ID: <1270657429.18061.6.camel@limm-pc1254>

Dear bioperl developers,

I am using bioperl to parse a Blast report. I am using the object
Bio::SearchIO. In all the examples that I have found the constructor
method read the report from a file, EX:

my $in = new Bio::SearchIO(-format => 'blast', 
                           -file   => 'report.bls'); 

I would like to know if the constructor can get the blast report from a perl variable ($report_bls)

thanks a lot,
Joan


-- 
Joan Segura Mora
PhD Research Fellow
Leeds Institute of Molecular Medicine
Section of Experimental Therapeutics
Wellcome Trust Brenner Building
St. James's University Hospital
Leeds LS9 7TF
United Kingdom

phone: +44 (0) 113 3438817


From cjfields at illinois.edu  Wed Apr  7 13:07:32 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 12:07:32 -0500
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <1270657429.18061.6.camel@limm-pc1254>
References: <1270657429.18061.6.camel@limm-pc1254>
Message-ID: <1270660052.12446.12.camel@pyrimidine.igb.uiuc.edu>

Joan,

Yes; use IO::String, like so:

use IO::String;

my $fh = IO::String->new($report_bls);
my $in = Bio::SearchIO->new(-format => 'blast', 
                            -fh     => $fh);

# the rest as normal

chris

On Wed, 2010-04-07 at 17:23 +0100, Joan Segura Mora wrote:
> Dear bioperl developers,
> 
> I am using bioperl to parse a Blast report. I am using the object
> Bio::SearchIO. In all the examples that I have found the constructor
> method read the report from a file, EX:
> 
> my $in = new Bio::SearchIO(-format => 'blast', 
>                            -file   => 'report.bls'); 
> 
> I would like to know if the constructor can get the blast report from a perl variable ($report_bls)
> 
> thanks a lot,
> Joan
> 
> 



From biopython at maubp.freeserve.co.uk  Wed Apr  7 13:08:16 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 18:08:16 +0100
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
	<q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
	<1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <q2j320fb6e01004071008i2242c2d9h374b5933625238f3@mail.gmail.com>

On Wed, Apr 7, 2010 at 5:56 PM, Chris Fields <cjfields at illinois.edu> wrote:
>
> I think we're going with the AnyDBM option, which allows SQLite if
> requested (via Mark's SQLite_DBM).
>
> chris

Hi Chris,

Does Mark's SQLite_DBM already have an SQLite schema defined? I'd
idealy like us to agree something shared with other Bio* libraries (a new
OBDA standard using SQLite instead of BDB). I was thinking something
along these lines if we want to support an index for multiple files:

* meta - table with string key/values (in particular to hold a schema version
number, plus perhaps the tool which built the index)

* offsets - table with entry accessions, file number, file offset

* files - table with filenames, file type (e.g. FASTA), datestamp
(so we can spot if the index is older than the file and needs to be
updated), perhaps other things like if the file is compressed (gzip,
bz2, ...).

If some kind of shared SQLite index schema (whatever it looks like)
does seem like a good idea to you guys (BioPerl), should we move
this discussion over to open-bio-l at lists.open-bio.org?

Regards,

Peter

From David.Messina at sbc.su.se  Wed Apr  7 13:19:39 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Wed, 7 Apr 2010 19:19:39 +0200
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <1270657429.18061.6.camel@limm-pc1254>
References: <1270657429.18061.6.camel@limm-pc1254>
Message-ID: <C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>

Hi Joan,

In recent versions of Perl, you can open a string as if it were a file:

open(my $fh, "<", \$string) or die "couldn't open $string as a file: $!\n";

And then you'd pass the filehandle to SearchIO instead of a filename:

my $in = new Bio::SearchIO(-format => 'blast', 
                          -fh   => $fh); 


More details here:

http://www.perl.com/pub/a/2003/08/21/perlcookbook.html?page=2


Dave


From cjfields at illinois.edu  Wed Apr  7 12:56:39 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 11:56:39 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
	<q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
Message-ID: <1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>

I think we're going with the AnyDBM option, which allows SQLite if
requested (via Mark's SQLite_DBM).  

chris

On Wed, 2010-04-07 at 16:45 +0100, Peter wrote:
> On Wed, Apr 7, 2010 at 4:25 PM, Cook, Malcolm <MEC at stowers.org> wrote:
> > c.f. http://github.com/acr/screed
> 
> That's the python thing I referred to earlier, which turned out to be much
> slower than SQLite (comparing storing the FASTQ data in an indexed
> form, not just storing the file offsets):
> 
> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.html
> http://ivory.idyll.org/blog/mar-10/storing-and-retrieving-sequences.html
> 
> Peter
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Wed Apr  7 13:53:17 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 12:53:17 -0500
Subject: [Bioperl-l] Support for KEGG
In-Reply-To: <8380301F-837E-44A3-95CB-72932ED1B290@cs.nyu.edu>
References: <8380301F-837E-44A3-95CB-72932ED1B290@cs.nyu.edu>
Message-ID: <1270662797.12446.59.camel@pyrimidine.igb.uiuc.edu>

No, not really.  I tend to do anything related to KEGG in R/BioC, but we
would be open for anyone wanting to add something.

Thinking about this, it probably wouldn't be hard to do if one exploited
the SQLite KEGG db that R has. 

chris

On Wed, 2010-04-07 at 12:14 -0400, ARTHUR GOLDBERG wrote:
> Hi
> 
> Does Bioperl support Kegg non-sequence data such as pathways?  
> (Bio::SeqIO::kegg supports KEGG sequence data.)
> For example, Kegg's web services interface provides loads of access to  
> Kegg pathway, gene and enzyme info. However, even it doesn't support  
> things like the pathway hierarchy distributed in files in ftp://ftp.genome.jp/pub/kegg/brite/organisms/ 
> .
> 
> BR
> A
> 
> 
> 
> Arthur P. Goldberg, PhD
> 
> Research Scientist in Bioinformatics
> Plant Systems Biology Laboratory
> www.virtualplant.org
> 
> Visiting Academic
> Computer Science Department
> Courant Institute of Mathematical Sciences
> www.cs.nyu.edu/artg
> 
> artg at cs.nyu.edu
> New York University
> 212 995-4918
> Coruzzi Lab
> 8th Floor Silver Building
> 1009 Silver Center
> 100 Washington Sq East
> New York NY 10003-6688
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Wed Apr  7 13:56:04 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 12:56:04 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <q2j320fb6e01004071008i2242c2d9h374b5933625238f3@mail.gmail.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
	<q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
	<1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>
	<q2j320fb6e01004071008i2242c2d9h374b5933625238f3@mail.gmail.com>
Message-ID: <1270662964.12446.62.camel@pyrimidine.igb.uiuc.edu>

On Wed, 2010-04-07 at 18:08 +0100, Peter wrote:
> On Wed, Apr 7, 2010 at 5:56 PM, Chris Fields <cjfields at illinois.edu> wrote:
> >
> > I think we're going with the AnyDBM option, which allows SQLite if
> > requested (via Mark's SQLite_DBM).
> >
> > chris
> 
> Hi Chris,
> 
> Does Mark's SQLite_DBM already have an SQLite schema defined? I'd
> idealy like us to agree something shared with other Bio* libraries (a new
> OBDA standard using SQLite instead of BDB). I was thinking something
> along these lines if we want to support an index for multiple files:
> 
> * meta - table with string key/values (in particular to hold a schema version
> number, plus perhaps the tool which built the index)
> 
> * offsets - table with entry accessions, file number, file offset
> 
> * files - table with filenames, file type (e.g. FASTA), datestamp
> (so we can spot if the index is older than the file and needs to be
> updated), perhaps other things like if the file is compressed (gzip,
> bz2, ...).
> 
> If some kind of shared SQLite index schema (whatever it looks like)
> does seem like a good idea to you guys (BioPerl), should we move
> this discussion over to open-bio-l at lists.open-bio.org?
> 
> Regards,
> 
> Peter

I think this is a good idea for ODBA-based modules, but Bio::Index::*
modules aren't ODBA-compliant (at least that I know of); it's a simple
key-value hash pairing I believe.  Bio::Flat* are ODBA-compliant,
though, so it's worth exploring this.

chris




From cjfields at illinois.edu  Wed Apr  7 13:58:36 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 12:58:36 -0500
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>
References: <1270657429.18061.6.camel@limm-pc1254>
	<C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>
Message-ID: <1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>

Forgot about that one, much simpler.

chris

On Wed, 2010-04-07 at 19:19 +0200, Dave Messina wrote:
> Hi Joan,
> 
> In recent versions of Perl, you can open a string as if it were a file:
> 
> open(my $fh, "<", \$string) or die "couldn't open $string as a file: $!\n";
> 
> And then you'd pass the filehandle to SearchIO instead of a filename:
> 
> my $in = new Bio::SearchIO(-format => 'blast', 
>                           -fh   => $fh); 
> 
> 
> More details here:
> 
> http://www.perl.com/pub/a/2003/08/21/perlcookbook.html?page=2
> 
> 
> Dave
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Wed Apr  7 14:06:49 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Wed, 7 Apr 2010 20:06:49 +0200
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>
References: <1270657429.18061.6.camel@limm-pc1254>
	<C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>
	<1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <40181AA4-104B-4CB6-8C07-65E626674C0B@sbc.su.se>

> Forgot about that one, much simpler.

Me too, until I was doing this same thing a couple days ago... :)



D


From biopython at maubp.freeserve.co.uk  Wed Apr  7 14:09:11 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 19:09:11 +0100
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <1270662964.12446.62.camel@pyrimidine.igb.uiuc.edu>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
	<q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
	<1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>
	<q2j320fb6e01004071008i2242c2d9h374b5933625238f3@mail.gmail.com>
	<1270662964.12446.62.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <v2m320fb6e01004071109made43fd8z61723cbc1774c85f@mail.gmail.com>

On Wed, Apr 7, 2010 at 6:56 PM, Chris Fields <cjfields at illinois.edu> wrote:
>Peter wrote:
>> Hi Chris,
>>
>> Does Mark's SQLite_DBM already have an SQLite schema defined? I'd
>> idealy like us to agree something shared with other Bio* libraries (a new
>> OBDA standard using SQLite instead of BDB). I was thinking something
>> along these lines if we want to support an index for multiple files:
>>
>> * meta - table with string key/values (in particular to hold a schema version
>> number, plus perhaps the tool which built the index)
>>
>> * offsets - table with entry accessions, file number, file offset
>>
>> * files - table with filenames, file type (e.g. FASTA), datestamp
>> (so we can spot if the index is older than the file and needs to be
>> updated), perhaps other things like if the file is compressed (gzip,
>> bz2, ...).
>>
>> If some kind of shared SQLite index schema (whatever it looks like)
>> does seem like a good idea to you guys (BioPerl), should we move
>> this discussion over to open-bio-l at lists.open-bio.org?
>>
>> Regards,
>>
>> Peter
>
> I think this is a good idea for ODBA-based modules, but Bio::Index::*
> modules aren't ODBA-compliant (at least that I know of); it's a simple
> key-value hash pairing I believe. ?Bio::Flat* are ODBA-compliant,
> though, so it's worth exploring this.
>
> chris

I didn't appreciate BioPerl had more than one indexing back end
(Bio::Index versus Bio::Flat).

Peter


From cjfields at illinois.edu  Wed Apr  7 14:41:25 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 13:41:25 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
 (multiple) fastq files failure
In-Reply-To: <v2m320fb6e01004071109made43fd8z61723cbc1774c85f@mail.gmail.com>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>
	<BD62CBAC4395B94096109020651BE2EC1301E3D510@EXCHMB-02.stowers-institute.org>
	<q2v320fb6e01004070845oc2b127b1uef9360e554320fdd@mail.gmail.com>
	<1270659399.12446.0.camel@pyrimidine.igb.uiuc.edu>
	<q2j320fb6e01004071008i2242c2d9h374b5933625238f3@mail.gmail.com>
	<1270662964.12446.62.camel@pyrimidine.igb.uiuc.edu>
	<v2m320fb6e01004071109made43fd8z61723cbc1774c85f@mail.gmail.com>
Message-ID: <1270665685.17725.5.camel@pyrimidine.igb.uiuc.edu>

On Wed, 2010-04-07 at 19:09 +0100, Peter wrote:
> On Wed, Apr 7, 2010 at 6:56 PM, Chris Fields <cjfields at illinois.edu> wrote:
> >Peter wrote:...
> >
> > I think this is a good idea for ODBA-based modules, but Bio::Index::*
> > modules aren't ODBA-compliant (at least that I know of); it's a simple
> > key-value hash pairing I believe.  Bio::Flat* are ODBA-compliant,
> > though, so it's worth exploring this.
> >
> > chris
> 
> I didn't appreciate BioPerl had more than one indexing back end
> (Bio::Index versus Bio::Flat).
> 
> Peter

Yes, which makes it more confusing unfortunately (there is actually a
third commonly-used one, Bio::DB::Fasta).  We should try moving towards
ODBA compliance, maybe integrating some of the speedups that
Bio::DB::Fasta uses for our purposes.  

chris



From bosborne11 at verizon.net  Wed Apr  7 13:53:42 2010
From: bosborne11 at verizon.net (Brian Osborne)
Date: Wed, 07 Apr 2010 13:53:42 -0400
Subject: [Bioperl-l] Support for KEGG
In-Reply-To: <8380301F-837E-44A3-95CB-72932ED1B290@cs.nyu.edu>
References: <8380301F-837E-44A3-95CB-72932ED1B290@cs.nyu.edu>
Message-ID: <544DF2E2-676F-449A-B911-76AD6E5F63AA@verizon.net>

Arthur,

The only support for network retrieval or analysis in Bioperl is found in bioperl-network:

http://www.bioperl.org/wiki/Network_package

I'm not sure if this is what you are looking for, or not. There is no support for KEGG data in bioperl-network.

Brian O.


On Apr 7, 2010, at 12:14 PM, ARTHUR GOLDBERG wrote:

> Hi
> 
> Does Bioperl support Kegg non-sequence data such as pathways? (Bio::SeqIO::kegg supports KEGG sequence data.)
> For example, Kegg's web services interface provides loads of access to Kegg pathway, gene and enzyme info. However, even it doesn't support things like the pathway hierarchy distributed in files in ftp://ftp.genome.jp/pub/kegg/brite/organisms/.
> 
> BR
> A
> 
> 
> 
> Arthur P. Goldberg, PhD
> 
> Research Scientist in Bioinformatics
> Plant Systems Biology Laboratory
> www.virtualplant.org
> 
> Visiting Academic
> Computer Science Department
> Courant Institute of Mathematical Sciences
> www.cs.nyu.edu/artg
> 
> artg at cs.nyu.edu
> New York University
> 212 995-4918
> Coruzzi Lab
> 8th Floor Silver Building
> 1009 Silver Center
> 100 Washington Sq East
> New York NY 10003-6688
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From greg at ebi.ac.uk  Wed Apr  7 15:40:03 2010
From: greg at ebi.ac.uk (Gregory Jordan)
Date: Wed, 7 Apr 2010 20:40:03 +0100
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <40181AA4-104B-4CB6-8C07-65E626674C0B@sbc.su.se>
References: <1270657429.18061.6.camel@limm-pc1254>
	<C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se> 
	<1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>
	<40181AA4-104B-4CB6-8C07-65E626674C0B@sbc.su.se>
Message-ID: <z2j4ba171b81004071240na111a19dj876412e8c4ef1884@mail.gmail.com>

This particular trick isn't *too* ugly, but why don't we just add a
"-string" parameter to the Bio::Root::IO module? Then, Bioperl users
wouldn't have to independently discover the string filehandle trick every
time they find themselves wanting to use a string instead of a file or
handle. Personally, I've discovered, forgotten, and re-discovered this
particular one more than once already.

The _initialize_io method in Bio::Root::IO already deals with two mutually
exclusive input parameters ("file" and "fh"); is there a good reason why not
to add a third and just include the string filehandle bit within that
method?

greg

On 7 April 2010 19:06, Dave Messina <David.Messina at sbc.su.se> wrote:

> > Forgot about that one, much simpler.
>
> Me too, until I was doing this same thing a couple days ago... :)
>
>
>
> D
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From cjfields at illinois.edu  Wed Apr  7 17:47:51 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 16:47:51 -0500
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <z2j4ba171b81004071240na111a19dj876412e8c4ef1884@mail.gmail.com>
References: <1270657429.18061.6.camel@limm-pc1254>
	<C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>
	<1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>
	<40181AA4-104B-4CB6-8C07-65E626674C0B@sbc.su.se>
	<z2j4ba171b81004071240na111a19dj876412e8c4ef1884@mail.gmail.com>
Message-ID: <1270676871.18964.125.camel@pyrimidine.igb.uiuc.edu>

We could do that for convenience, just another option.

chris

On Wed, 2010-04-07 at 20:40 +0100, Gregory Jordan wrote:
> This particular trick isn't *too* ugly, but why don't we just add a
> "-string" parameter to the Bio::Root::IO module? Then, Bioperl users
> wouldn't have to independently discover the string filehandle trick every
> time they find themselves wanting to use a string instead of a file or
> handle. Personally, I've discovered, forgotten, and re-discovered this
> particular one more than once already.
> 
> The _initialize_io method in Bio::Root::IO already deals with two mutually
> exclusive input parameters ("file" and "fh"); is there a good reason why not
> to add a third and just include the string filehandle bit within that
> method?
> 
> greg
> 
> On 7 April 2010 19:06, Dave Messina <David.Messina at sbc.su.se> wrote:
> 
> > > Forgot about that one, much simpler.
> >
> > Me too, until I was doing this same thing a couple days ago... :)
> >
> >
> >
> > D
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From joycelin12 at gmail.com  Tue Apr  6 21:18:54 2010
From: joycelin12 at gmail.com (lin yu)
Date: Wed, 7 Apr 2010 09:18:54 +0800
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
Message-ID: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>

Hi

I am from a part-time student from NUS. May i suggest the following project:
Accessing R phylogenetic tools from BioPerl Actually this project was
initially proposed by the Phyloinformatics Summer of Code 2010, however the
programming language is in Python and I have no prior experience in that
language. Therefore, I would like to propose the use of BioPerl in access R
phlyogenetic tools or the combination of R and BioPerl in other similar
applications like microarray analysis etc. Would it be possible? I would
like to know the answer as soon as possible as I can edit my proposal in the
case. Thank you.
-- 
Best regards
Joyce Lin

From lincoln.stein at gmail.com  Wed Apr  7 17:01:20 2010
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Wed, 7 Apr 2010 17:01:20 -0400
Subject: [Bioperl-l] [Gmod-gbrowse] Gmod-gbrowse Digest, Vol 47, Issue 25
In-Reply-To: <1448A38A42714048B9C53E473E13CCF00306F603@davis.hmgc.mcw.edu>
References: <mailman.194535.1270670495.4911.gmod-gbrowse@lists.sourceforge.net>
	<1448A38A42714048B9C53E473E13CCF00306F603@davis.hmgc.mcw.edu>
Message-ID: <t2r6dce9a0b1004071401y8c117a5pfcf47debfce776b1@mail.gmail.com>

It should not be necessary to install any of these prerequisites to get a
successful CPAN install of BioPerl! Is this an issue on Snow Leopard?

Lincoln

2010/4/7 Jayaraman, Pushkala <pjayaraman at mcw.edu>

>  Hello,
>
> In response to the Bioperl installation using Cpan, I had to try it
> atleast 4 times to get a final successful installation.
>
> I guess some of the Pre requisite packages that cpan gets have not passed
> too many tests and if one of them fails, all of them fail.
>
> Here is a list of the packages that I had to install manually (some, I
> used a version just before the latest one..)first before running Bio Perl
> installation from Cpan.
>
> 1.      Bundle??BioPerl(installed this first) then installed some of the
> root dependencies.
>
> 2.      Ace
>
> 3.      XML??DOM2
>
> 4.      Bio??ASN1??Entrezgene 1.091 (this gave me lots of trouble!)
>
> 5.      XML??Parser 2.36
>
> 6.      SOAP??Lite
>
> 7.      XML??Twig (this one also kept failing)
>
> 8.      LibXML??Perl (another trouble maker)
>
> 9.      XML??DOM 1.44
>
> 10.     XML??DOM??XPATH 0.14
>
> 11.     BioPerl 1.61 using CPAN
>
>  Hope this helps!
>
> Pushkala
>
>  -----Original Message-----
> From: gmod-gbrowse-request at lists.sourceforge.net [
> mailto:gmod-gbrowse-request at lists.sourceforge.net<gmod-gbrowse-request at lists.sourceforge.net>
> ]
> Sent: Wednesday, April 07, 2010 3:02 PM
> To: gmod-gbrowse at lists.sourceforge.net
> Subject: Gmod-gbrowse Digest, Vol 47, Issue 25
>
> Send Gmod-gbrowse mailing list submissions to
>
>         gmod-gbrowse at lists.sourceforge.net
>
> To subscribe or unsubscribe via the World Wide Web, visit
>
>         https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> or, via email, send a message with subject or body 'help' to
>
>         gmod-gbrowse-request at lists.sourceforge.net
>
> You can reach the person managing the list at
>
>         gmod-gbrowse-owner at lists.sourceforge.net
>
> When replying, please edit your Subject line so it is more specific
>
> than "Re: Contents of Gmod-gbrowse digest..."
>
> Today's Topics:
>
>    1. libgd installers for Mac OS X 10.5 and 10.6 (Scott Cain)
>
>    2. Re: Installation Problem (Halian)
>
>    3. Re: Installation Problem (Scott Cain)
>
>    4. Re: Installation Problem (Chris Fields)
>
>    5. Re: Snow Leopard installation issues (James M. Nolan)
>
> ----------------------------------------------------------------------
>
> Message: 1
>
> Date: Wed, 7 Apr 2010 14:35:28 -0400
>
> From: Scott Cain <scott at scottcain.net>
>
> Subject: [Gmod-gbrowse] libgd installers for Mac OS X 10.5 and 10.6
>
> To: "Gbrowse (E-mail)" <gmod-gbrowse at lists.sourceforge.net>
>
> Message-ID:
>
>         <z2o4536f7701004071135q6d622265hd80ad83c5388f3bd at mail.gmail.com>
>
> Content-Type: text/plain; charset=ISO-8859-1
>
> Hello,
>
> I've taken a foray into creating double click installers (pkg files)
>
> for libgd for Mac OS X Leopard and Snow Leopard.  As this is a first
>
> attempt, they may still be a little rough, but in my hands they seem
>
> to do what they are supposed to do.  I put them on sourceforge if
>
> anyone would like to try them out.
>
> Leopard:
>
>
> https://sourceforge.net/projects/gmod/files/Generic%20Genome%20Browser/libgd-MacOSX/20100406/gmod%20libgd%20Leopard.pkg/download
>
> Snow Leopard:
>
>
> https://sourceforge.net/projects/gmod/files/Generic%20Genome%20Browser/libgd-MacOSX/20100406/gmod%20libgd%20Snow%20Leopard.pkg/download
>
> Scott
>
> --
>
> ------------------------------------------------------------------------
>
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
>
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>
> Ontario Institute for Cancer Research
>
>
> ------------------------------
>
> Message: 2
>
> Date: Wed, 7 Apr 2010 18:44:57 +0000 (UTC)
>
> From: Halian <halianlian at gmail.com>
>
> Subject: Re: [Gmod-gbrowse] Installation Problem
>
> To: gmod-gbrowse at lists.sourceforge.net
>
> Message-ID: <loom.20100407T204343-410 at post.gmane.org>
>
> Content-Type: text/plain; charset=us-ascii
>
>
> Scott, trying to install Bio::Root::Version using this command:
>
> perl -MCPAN -e 'install Bio::Root::Version'
>
> I get this message, and then the installation dies:
>
> Test Summary Report
>
> -------------------
>
> t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)
>
>   Failed test:  2
>
>   Non-zero exit status: 255
>
>   Parse errors: Bad plan.  You planned 52 tests but ran 3.
>
> Files=2, Tests=13,  3 wallclock secs ( 0.08 usr  0.02 sys +  1.46 cusr
> 0.18
>
> csys =  1.74 CPU)
>
> Result: FAIL
>
> Failed 1/2 test programs. 1/13 subtests failed.
>
>   LDS/Bio-Graphics-2.02.tar.gz
>
>   ./Build test -- NOT OK
>
> //hint// to see the cpan-testers results for installing this module, try:
>
>   reports LDS/Bio-Graphics-2.02.tar.gz
>
> Running Build install
>
>   make test had returned bad status, won't install without force
>
> Running install for module 'Bio::Root::Version'
>
> Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz
>
>   Has already been unwrapped into directory
> /root/.cpan/build/BioPerl-1.6.1-gppvM8
>
>   Has already been made
>
> Running Build test
>
>   Has already been tested within this command
>
> Running Build install
>
>   make test had returned bad status, won't install without force
>
>
>
>
>
> ------------------------------
>
> Message: 3
>
> Date: Wed, 7 Apr 2010 15:06:04 -0400
>
> From: Scott Cain <scott at scottcain.net>
>
> Subject: Re: [Gmod-gbrowse] Installation Problem
>
> To: Halian <halianlian at gmail.com>
>
> Cc: gmod-gbrowse at lists.sourceforge.net
>
> Message-ID:
>
>         <q2m4536f7701004071206t5954d4a7x16b683826a6d90bf at mail.gmail.com>
>
> Content-Type: text/plain; charset=ISO-8859-1
>
> Well, shoot, that's not terribly informative: since the tests already
>
> failed for BioPerl, it's not telling us what tests failed.  Can you
>
> try installing BioPerl on the command line?  You can either go into
>
> the .cpan/build directory and do it there, or get a fresh tarball from
>
> bioperl.org:
>
>   http://bioperl.org/DIST/BioPerl-1.6.1.tar.gz
>
> and then do
>
>   perl Build.PL
>
>   ./Build
>
>   ./Build test
>
>   (sudo) ./Build install
>
> and let us know how that goes.  After BioPerl is installed,
>
> Bio::Graphics should install, assuming you already have libgd.
>
> Scott
>
> On Wed, Apr 7, 2010 at 2:44 PM, Halian <halianlian at gmail.com> wrote:
>
> >
>
> >
>
> > Scott, trying to install Bio::Root::Version using this command:
>
> >
>
> > perl -MCPAN -e 'install Bio::Root::Version'
>
> >
>
> > I get this message, and then the installation dies:
>
> >
>
> >
>
> > Test Summary Report
>
> > -------------------
>
> > t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)
>
> > ?Failed test: ?2
>
> > ?Non-zero exit status: 255
>
> > ?Parse errors: Bad plan. ?You planned 52 tests but ran 3.
>
> > Files=2, Tests=13, ?3 wallclock secs ( 0.08 usr ?0.02 sys + ?1.46 cusr
> ?0.18
>
> > csys = ?1.74 CPU)
>
> > Result: FAIL
>
> > Failed 1/2 test programs. 1/13 subtests failed.
>
> > ?LDS/Bio-Graphics-2.02.tar.gz
>
> > ?./Build test -- NOT OK
>
> > //hint// to see the cpan-testers results for installing this module, try:
>
> > ?reports LDS/Bio-Graphics-2.02.tar.gz
>
> > Running Build install
>
> > ?make test had returned bad status, won't install without force
>
> > Running install for module 'Bio::Root::Version'
>
> > Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz
>
> > ?Has already been unwrapped into directory
> /root/.cpan/build/BioPerl-1.6.1-gppvM8
>
> > ?Has already been made
>
> > Running Build test
>
> > ?Has already been tested within this command
>
> > Running Build install
>
> > ?make test had returned bad status, won't install without force
>
> >
>
> >
>
> >
>
> >
>
> >
> ------------------------------------------------------------------------------
>
> > Download Intel&#174; Parallel Studio Eval
>
> > Try the new software tools for yourself. Speed compiling, find bugs
>
> > proactively, and fine-tune applications for parallel performance.
>
> > See why Intel Parallel Studio got high marks during beta.
>
> > http://p.sf.net/sfu/intel-sw-dev
>
> > _______________________________________________
>
> > Gmod-gbrowse mailing list
>
> > Gmod-gbrowse at lists.sourceforge.net
>
> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> >
>
>
> --
>
> ------------------------------------------------------------------------
>
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
>
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>
> Ontario Institute for Cancer Research
>
>
> ------------------------------
>
> Message: 4
>
> Date: Wed, 07 Apr 2010 14:19:42 -0500
>
> From: Chris Fields <cjfields at illinois.edu>
>
> Subject: Re: [Gmod-gbrowse] Installation Problem
>
> To: Scott Cain <scott at scottcain.net>
>
> Cc: Halian <halianlian at gmail.com>, gmod-gbrowse at lists.sourceforge.net
>
> Message-ID: <1270667982.18964.6.camel at pyrimidine.igb.uiuc.edu>
>
> Content-Type: text/plain; charset="UTF-8"
>
> Scott,
>
> What is the specific failure on BioPerl-1.6.1?  Do we need to push out a
>
> new point release soon?
>
> chris
>
> On Wed, 2010-04-07 at 15:06 -0400, Scott Cain wrote:
>
> > Well, shoot, that's not terribly informative: since the tests already
>
> > failed for BioPerl, it's not telling us what tests failed.  Can you
>
> > try installing BioPerl on the command line?  You can either go into
>
> > the .cpan/build directory and do it there, or get a fresh tarball from
>
> > bioperl.org:
>
> >
>
> >   http://bioperl.org/DIST/BioPerl-1.6.1.tar.gz
>
> >
>
> > and then do
>
> >
>
> >   perl Build.PL
>
> >   ./Build
>
> >   ./Build test
>
> >   (sudo) ./Build install
>
> >
>
> > and let us know how that goes.  After BioPerl is installed,
>
> > Bio::Graphics should install, assuming you already have libgd.
>
> >
>
> > Scott
>
> >
>
> >
>
> > On Wed, Apr 7, 2010 at 2:44 PM, Halian <halianlian at gmail.com> wrote:
>
> > >
>
> > >
>
> > > Scott, trying to install Bio::Root::Version using this command:
>
> > >
>
> > > perl -MCPAN -e 'install Bio::Root::Version'
>
> > >
>
> > > I get this message, and then the installation dies:
>
> > >
>
> > >
>
> > > Test Summary Report
>
> > > -------------------
>
> > > t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)
>
> > >  Failed test:  2
>
> > >  Non-zero exit status: 255
>
> > >  Parse errors: Bad plan.  You planned 52 tests but ran 3.
>
> > > Files=2, Tests=13,  3 wallclock secs ( 0.08 usr  0.02 sys +  1.46 cusr
> 0.18
>
> > > csys =  1.74 CPU)
>
> > > Result: FAIL
>
> > > Failed 1/2 test programs. 1/13 subtests failed.
>
> > >  LDS/Bio-Graphics-2.02.tar.gz
>
> > >  ./Build test -- NOT OK
>
> > > //hint// to see the cpan-testers results for installing this module,
> try:
>
> > >  reports LDS/Bio-Graphics-2.02.tar.gz
>
> > > Running Build install
>
> > >  make test had returned bad status, won't install without force
>
> > > Running install for module 'Bio::Root::Version'
>
> > > Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz
>
> > >  Has already been unwrapped into directory
> /root/.cpan/build/BioPerl-1.6.1-gppvM8
>
> > >  Has already been made
>
> > > Running Build test
>
> > >  Has already been tested within this command
>
> > > Running Build install
>
> > >  make test had returned bad status, won't install without force
>
> > >
>
> > >
>
> > >
>
> > >
>
> > >
> ------------------------------------------------------------------------------
>
> > > Download Intel&#174; Parallel Studio Eval
>
> > > Try the new software tools for yourself. Speed compiling, find bugs
>
> > > proactively, and fine-tune applications for parallel performance.
>
> > > See why Intel Parallel Studio got high marks during beta.
>
> > > http://p.sf.net/sfu/intel-sw-dev
>
> > > _______________________________________________
>
> > > Gmod-gbrowse mailing list
>
> > > Gmod-gbrowse at lists.sourceforge.net
>
> > > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> > >
>
> >
>
> >
>
> >
>
>
>
>
> ------------------------------
>
> Message: 5
>
> Date: Wed, 7 Apr 2010 15:47:55 -0400 (EDT)
>
> From: "James M. Nolan" <jnolan at ggc.edu>
>
> Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues
>
> To: Scott Cain <scott at scottcain.net>
>
> Cc: "Gbrowse \(E-mail\)" <gmod-gbrowse at lists.sourceforge.net>
>
> Message-ID:
>
>         <543850330.392212.1270669675992.JavaMail.root at zmail1.ggc.edu>
>
> Content-Type: text/plain; charset="utf-8"
>
>
> Hi Scott,
>
> Thanks for the package, but it looks like I am still having problems. I
> removed my php directories, so I think I am not having conflicts there. I
> was having trouble with getting the fink /sw directories out of my paths,
> but got that fixed after altering .cshrc and restarting the Terminal.app I
> noticed the architecture errors and noticed the env was not set as Lincoln
> had said so I used the provided fix, I did make uninstall for GD.pm and
> tried again, but I still get architecture errors when I try to install GD
> manually from source. In cpan it says "GD is up to date (2.44)."
>
> I am thinking I need to format and start all over with clean Snow Leopard
> and see if the suggested fixes work from there. Any suggestions on the order
> which to do things are welcome. My output from env and installation attempts
> below.
>
> Thanks again,
>
> Jim
>
>
> PATH=/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/X11/bin
>
> TMPDIR=/var/folders/kW/kW+4EXfs2RahNU+1YxaEY++++TQ/-Tmp-/
>
> SHELL=/bin/tcsh
>
> HOME=/Users/jnolan
>
> USER=jnolan
>
> LOGNAME=jnolan
>
> DISPLAY=/tmp/launch-K05jvu/org.x:0
>
> SSH_AUTH_SOCK=/tmp/launch-fn7sGB/Listeners
>
> Apple_PubSub_Socket_Render=/tmp/launch-VaqsGP/Render
>
> COMMAND_MODE=unix2003
>
> __CF_USER_TEXT_ENCODING=0x1F7:0:0
>
> TERM_PROGRAM=Apple_Terminal
>
> TERM_PROGRAM_VERSION=273
>
> LANG=en_US.UTF-8
>
> TERM=xterm-color
>
> HOSTTYPE=intel-mac
>
> VENDOR=apple
>
> OSTYPE=darwin
>
> MACHTYPE=x86_64
>
> SHLVL=1
>
> PWD=/Users/jnolan/Desktop/server/GD-2.44
>
> GROUP=staff
>
> HOST=host-9-116.clb-b2.ggc.usg.edu
>
> REMOTEHOST=
>
> STADENROOT=/usr/ebiotools/bin
>
> VERSIONER_PERL_PREFER_32_BIT=yes
>
> VERSIONER_PERL_VERSION=5.8.9
>
>
>
>
>
>
> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make clean
>
> rm -f \
>
> *.a core \
>
> core.[0-9] blib/arch/auto/GD/extralibs.all \
>
> core.[0-9][0-9] GD.bso \
>
> pm_to_blib.ts core.[0-9][0-9][0-9][0-9] \
>
> GD.x GD.bs \
>
> perl tmon.out \
>
> *.o pm_to_blib \
>
> blib/arch/auto/GD/extralibs.ld blibdirs.ts \
>
> core.[0-9][0-9][0-9][0-9][0-9] *perl.core \
>
> core.*perl.*.? Makefile.aperl \
>
> perl GD.def \
>
> core.[0-9][0-9][0-9] mon.out \
>
> libGD.def perlmain.c \
>
> perl.exe so_locations \
>
> GD.exp GD.c
>
> rm -rf \
>
> blib
>
> mv Makefile Makefile.old > /dev/null 2>&1
>
> [host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PLNotice: Type
> perl Makefile.PL -h for command-line option summary.
>
> Configuring for libgd version 2.0.36.
>
> Checking for stray libgd header files...none found.
>
> Included Features: GD_PNG GD_GIF GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY
> GD_ANIMGIF GD_FTCIRCLE VERSION_33
>
> GD library used from: /usr
>
> Checking if your kit is complete...
>
> Looks good
>
> Writing Makefile for GD
>
> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make/usr/bin/perl
> GD/Image.pm.PLS GD/Image.pm
>
> Extracting Image.pm (with variable substitutions)
>
> cp GD/Polyline.pm blib/lib/GD/Polyline.pm
>
> cp qd.pl blib/lib/qd.pl
>
> cp GD/Image.pm blib/lib/GD/Image.pm
>
> cp GD.pm blib/lib/GD.pm
>
> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
>
> cp GD/Simple.pm blib/lib/GD/Simple.pm
>
> cp GD/Polygon.pm blib/lib/GD/Polygon.pm
>
> cp GD/Group.pm blib/lib/GD/Group.pm
>
> /usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap
> /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs > GD.xsc
> && mv GD.xsc GD.c
>
> gcc-4.2 -c -I/usr/include -Wformat=0 -Os -DVERSION=\"2.44\"
> -DXS_VERSION=\"2.44\"
> "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE" -DHAVE_FT
> -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33 -DHAVE_UNCLOSEDPOLY
> -DHAVE_FTCIRCLE GD.c
>
> GD.xs: In function ?XS_GD__Image_STORABLE_thaw?:
>
> GD.xs:923: warning: cast from pointer to integer of different size
>
> Running Mkbootstrap for GD ()
>
> chmod 644 GD.bs
>
> rm -f blib/arch/auto/GD/GD.bundle
>
> LD_RUN_PATH="/usr/lib" gcc-4.2 -mmacosx-version-min=10.6 -arch i386 -arch
> ppc -bundle -undefined dynamic_lookup -L/usr/local/lib GD.o -o
> blib/arch/auto/GD/GD.bundle \
>
> -L/usr/lib -lpng -lz -liconv -lgd \
>
> ld: warning: in GD.o, file is not of required architecture
>
> ld: warning: in /usr/local/lib/libpng.dylib, file is not of required
> architecture
>
> ld: warning: in /usr/lib/libgd.dylib, file is not of required architecture
>
> ld: warning: in GD.o, file is not of required architecture
>
> ld: warning: in /usr/local/lib/libpng.dylib, file is not of required
> architecture
>
> ld: warning: in /usr/lib/libgd.dylib, file is not of required architecture
>
> chmod 755 blib/arch/auto/GD/GD.bundle
>
> cp GD.bs blib/arch/auto/GD/GD.bs
>
> chmod 644 blib/arch/auto/GD/GD.bs
>
> /usr/bin/perl "-Iblib/arch" "-Iblib/lib" bdf_scripts/bdf2gdfont.PLS
> bdf_scripts/bdf2gdfont.pl
>
> Extracting bdf2gdfont.pl (with variable substitutions)
>
> cp bdf_scripts/bdf2gdfont.pl blib/script/bdf2gdfont.pl
>
> /usr/bin/perl "-MExtUtils::MY" -e "MY->fixin(shift)" blib/script/
> bdf2gdfont.pl
>
> Manifying blib/man1/bdf2gdfont.pl.1
>
> Manifying blib/man3/GD::Polyline.3pm
>
> Manifying blib/man3/GD::Image.3pm
>
> Manifying blib/man3/GD::Simple.3pm
>
> Manifying blib/man3/GD.3pm
>
> Manifying blib/man3/GD::Polygon.3pm
>
> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make test PERL_DL_NONLAZY=1
> /usr/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib',
> 'blib/arch')" t/*.t
>
> t/GD.t ........ Can't find 'boot_GD' symbol in
> ./blib/arch/auto/GD/GD.bundle
>
> at t/GD.t line 14
>
> Compilation failed in require at t/GD.t line 14.
>
> BEGIN failed--compilation aborted at t/GD.t line 14.
>
> t/GD.t ........ Dubious, test returned 2 (wstat 512, 0x200)
>
> Failed 12/12 subtests
>
> t/Polyline.t .. Can't find 'boot_GD' symbol in
> /Users/jnolan/Desktop/server/GD-2.44/blib/arch/auto/GD/GD.bundle
>
> at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45
>
> Compilation failed in require at
> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45.
>
> BEGIN failed--compilation aborted at
> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45.
>
> Compilation failed in require at t/Polyline.t line 10.
>
> BEGIN failed--compilation aborted at t/Polyline.t line 10.
>
> t/Polyline.t .. Dubious, test returned 2 (wstat 512, 0x200)
>
> Failed 1/1 subtests
>
> Test Summary Report
>
> -------------------
>
> t/GD.t (Wstat: 512 Tests: 1 Failed: 1)
>
> Failed test: 1
>
> Non-zero exit status: 2
>
> Parse errors: Bad plan. You planned 12 tests but ran 1.
>
> t/Polyline.t (Wstat: 512 Tests: 0 Failed: 0)
>
> Non-zero exit status: 2
>
> Parse errors: Bad plan. You planned 1 tests but ran 0.
>
> Files=2, Tests=1, 0 wallclock secs ( 0.02 usr 0.01 sys + 0.07 cusr 0.02
> csys = 0.12 CPU)
>
> Result: FAIL
>
> Failed 2/2 test programs. 1/1 subtests failed.
>
> make: *** [test_dynamic] Error 2
>
> ----- Original Message -----
>
> From: "Scott Cain" <scott at scottcain.net>
>
> To: "James M. Nolan" <jnolan at ggc.edu>
>
> Cc: "Gavin Sherlock" <sherlock at genome.stanford.edu>, "Gbrowse (E-mail)" <
> gmod-gbrowse at lists.sourceforge.net>, "Lincoln Stein" <
> lincoln.stein at gmail.com>
>
> Sent: Tuesday, April 6, 2010 11:53:08 AM
>
> Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues
>
> Hi James,
>
> Attached is my first crack at a libgd installer for Snow Leopard. I
>
> tested it on my mac mini that is running Snow Leopard, but it isn't a
>
> good test, since I already had a working copy of libgd on the machine.
>
> I would have liked to test it on a "virgin" system, but I don't have
>
> one at the moment, so if you'd like to be a guinea pig, have at it.
>
> After you run this installer, you should be able to install GD from
>
> the cpan shell. Let us know how it goes.
>
> Scott
>
> On Fri, Apr 2, 2010 at 3:02 PM, James M. Nolan <jnolan at ggc.edu> wrote:
>
> > Just my style! Thanks!
>
> > Jim
>
> > ----- Original Message -----
>
> > From: "Scott Cain" <scott at scottcain.net>
>
> > To: "Lincoln Stein" <lincoln.stein at gmail.com>
>
> > Cc: "James M. Nolan" <jnolan at ggc.edu>, "Gavin Sherlock"
>
> > <sherlock at genome.stanford.edu>, "Gbrowse (E-mail)"
>
> > <gmod-gbrowse at lists.sourceforge.net>
>
> > Sent: Friday, April 2, 2010 12:46:34 PM GMT -05:00 US/Canada Eastern
>
> > Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues
>
> >
>
> > Hi Lincoln,
>
> >
>
> > I've been reading about building "flat packages" for Mac OS X, which
>
> > is a form of double click installer. It should be fairly simple and
>
> > I'll see if I can have one ready for installing libgd next week.
>
> >
>
> > Scott
>
> >
>
> >
>
> > On Thu, Apr 1, 2010 at 4:31 PM, Lincoln Stein <lincoln.stein at gmail.com>
>
> > wrote:
>
> >> Hi James,
>
> >> It might be better to track down and destroy all copies php, php5, libgd
>
>
> >> and
>
> >> gd.h, then reinstall libgd so that there is one and only one true copy,
>
> >> and
>
> >> install GD.so.
>
> >> Alternatively, why doesn't someone on the mailing list who has GD
> already
>
> >> installed just bundle up the binary lib files and mail it to James? I
>
> >> think
>
> >> he has been tortured enough. It would be sufficient to send him
>
> >> libgd.bundle
>
> >> from the system lib directory and the contents of the "blib" directory
> of
>
> >> the built GD distribution.
>
> >> Lincoln
>
> >>
>
> >> On Thu, Apr 1, 2010 at 3:51 PM, James M. Nolan <jnolan at ggc.edu> wrote:
>
> >>>
>
> >>> Found it, twice! but not on the path. It got installed with php. I had
>
> >>> installed it because earlier installation instructions for gbrowse had
>
> >>> suggested it I think:
>
> >>> /usr/include/php/ext/gd/libgd/gd.h
>
> >>> /usr/local/php5/include/php/ext/gd/libgd/gd.h
>
> >>> I don't know how I got two versions of php installed, but the active
> one
>
> >>> seems to be in /usr/local/php/bin and includes installation of libgd
>
> >>> 2.0.34.
>
> >>> Should I delete all of both of these php installations, and if I need
> to
>
> >>> reinstall php, will it nuke the gd 2.0.36?
>
> >>>
>
> >>> I went ahead and tried installing libgd 2.0.36RC1.29 using
>
> >>> --without-fontconfig during configure and it installed
>
> >>> I then tried installing GD-2.44 and it failed as below. Please let me
>
> >>> know
>
> >>> whether I need to delete all of the php installation before I proceed.
> It
>
> >>> doesn't have an uninstaller, so I don't want to delete something I
>
> >>> shouldn't
>
> >>> Thanks
>
> >>> Jim
>
> >>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PL
>
> >>> Notice: Type perl Makefile.PL -h for command-line option summary.
>
> >>> Configuring for libgd version 2.0.36.
>
> >>> Checking for stray libgd header files...none found.
>
> >>> Included Features: GD_XPM GD_JPEG GD_FREETYPE GD_PNG GD_GIF
>
> >>> GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY GD_ANIMGIF GD_FTCIRCLE
>
> >>> VERSION_33
>
> >>> GD library used from: /usr/local
>
> >>> Checking if your kit is complete...
>
> >>> Looks good
>
> >>> Writing Makefile for GD
>
> >>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make
>
> >>> /usr/bin/perl GD/Image.pm.PLS GD/Image.pm
>
> >>> Extracting Image.pm (with variable substitutions)
>
> >>> cp GD/Polyline.pm blib/lib/GD/Polyline.pm
>
> >>> cp qd.pl blib/lib/qd.pl
>
> >>> cp GD/Image.pm blib/lib/GD/Image.pm
>
> >>> cp GD.pm blib/lib/GD.pm
>
> >>> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
>
> >>> cp GD/Simple.pm blib/lib/GD/Simple.pm
>
> >>> cp GD/Polygon.pm blib/lib/GD/Polygon.pm
>
> >>> cp GD/Group.pm blib/lib/GD/Group.pm
>
> >>> /usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap
>
> >>> /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs >
>
> >>> GD.xsc
>
> >>> && mv GD.xsc GD.c
>
> >>> gcc-4.2 -c -I/usr/local/include -Wformat=0 -Os -DVERSION=\"2.44\"
>
> >>> -DXS_VERSION=\"2.44\"
>
> >>> "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE"
>
> >>> -DHAVE_JPEG
>
> >>> -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33
>
> >>> -DHAVE_UNCLOSEDPOLY -DHAVE_FTCIRCLE GD.c
>
> >>> GD.xs: In function ?XS_GD__Image_STORABLE_thaw?:
>
> >>> GD.xs:923: warning: cast from pointer to integer of different size
>
> >>> Running Mkbootstrap for GD ()
>
> >>> chmod 644 GD.bs
>
> >>> rm -f blib/arch/auto/GD/GD.bundle
>
> >>> LD_RUN_PATH="/usr/X11/lib:/usr/local/lib:/usr/lib" gcc-4.2
>
> >>> -mmacosx-version-min=10.6 -arch i386 -arch ppc -bundle -undefined
>
> >>> dynamic_lookup -L/usr/local/lib GD.o -o blib/arch/auto/GD/GD.bundle \
>
> >>> -L/usr/local/lib -L/usr/X11/lib -L/usr/local/lib -lXpm -lX11 -ljpeg
>
> >>> -lfreetype -lpng12 -lz -liconv -lgd \
>
> >>>
>
> >>> ld: warning: in GD.o, file is not of required architecture
>
> >>> ld: warning: in /usr/local/lib/libjpeg.dylib, file is not of required
>
> >>> architecture
>
> >>> ld: warning: in /usr/local/lib/libfreetype.dylib, file is not of
> required
>
> >>> architecture
>
> >>> ld: warning: in /usr/local/lib/libgd.dylib, file is not of required
>
> >>> architecture
>
> >>> ld: warning: in GD.o, file is not of required architecture
>
> >>> ld: warning: in /usr/local/lib/libjpeg.dylib, file is not of required
>
> >>> architecture
>
> >>> ld: warning: in /usr/local/lib/libfreetype.dylib, file is not of
> required
>
> >>> architecture
>
> >>> ld: warning: in /usr/local/lib/libgd.dylib, file is not of required
>
> >>> architecture
>
> >>> chmod 755 blib/arch/auto/GD/GD.bundle
>
> >>> cp GD.bs blib/arch/auto/GD/GD.bs
>
> >>> chmod 644 blib/arch/auto/GD/GD.bs
>
> >>> /usr/bin/perl "-Iblib/arch" "-Iblib/lib" bdf_scripts/bdf2gdfont.PLS
>
> >>> bdf_scripts/bdf2gdfont.pl
>
> >>> Extracting bdf2gdfont.pl (with variable substitutions)
>
> >>> cp bdf_scripts/bdf2gdfont.pl blib/script/bdf2gdfont.pl
>
> >>> /usr/bin/perl "-MExtUtils::MY" -e "MY->fixin(shift)"
>
> >>> blib/script/bdf2gdfont.pl
>
> >>> Manifying blib/man1/bdf2gdfont.pl.1
>
> >>> Manifying blib/man3/GD::Polyline.3pm
>
> >>> Manifying blib/man3/GD::Image.3pm
>
> >>> Manifying blib/man3/GD::Simple.3pm
>
> >>> Manifying blib/man3/GD.3pm
>
> >>> Manifying blib/man3/GD::Polygon.3pm
>
> >>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make test
>
> >>> PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e"
>
> >>> "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
>
> >>> t/GD.t ........ Can't find 'boot_GD' symbol in
>
> >>> ./blib/arch/auto/GD/GD.bundle
>
> >>> at t/GD.t line 14
>
> >>> Compilation failed in require at t/GD.t line 14.
>
> >>> BEGIN failed--compilation aborted at t/GD.t line 14.
>
> >>> t/GD.t ........ Dubious, test returned 2 (wstat 512, 0x200)
>
> >>> Failed 12/12 subtests
>
> >>> t/Polyline.t .. Can't find 'boot_GD' symbol in
>
> >>> /Users/jnolan/Desktop/server/GD-2.44/blib/arch/auto/GD/GD.bundle
>
> >>> at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45
>
>
> >>> Compilation failed in require at
>
> >>> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45.
>
> >>> BEGIN failed--compilation aborted at
>
> >>> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45.
>
> >>> Compilation failed in require at t/Polyline.t line 10.
>
> >>> BEGIN failed--compilation aborted at t/Polyline.t line 10.
>
> >>> t/Polyline.t .. Dubious, test returned 2 (wstat 512, 0x200)
>
> >>> Failed 1/1 subtests
>
> >>> Test Summary Report
>
> >>> -------------------
>
> >>> t/GD.t (Wstat: 512 Tests: 1 Failed: 1)
>
> >>> Failed test: 1
>
> >>> Non-zero exit status: 2
>
> >>> Parse errors: Bad plan. You planned 12 tests but ran 1.
>
> >>> t/Polyline.t (Wstat: 512 Tests: 0 Failed: 0)
>
> >>> Non-zero exit status: 2
>
> >>> Parse errors: Bad plan. You planned 1 tests but ran 0.
>
> >>> Files=2, Tests=1, 0 wallclock secs ( 0.03 usr 0.01 sys + 0.07 cusr
>
> >>> 0.02 csys = 0.13 CPU)
>
> >>> Result: FAIL
>
> >>> Failed 2/2 test programs. 1/1 subtests failed.
>
> >>> make: *** [test_dynamic] Error 2
>
> >>>
>
> >>> ----- Original Message -----
>
> >>> From: "Lincoln Stein" <lincoln.stein at gmail.com>
>
> >>> To: "James M. Nolan" <jnolan at ggc.edu>
>
> >>> Cc: "Gavin Sherlock" <sherlock at genome.stanford.edu>, "Gbrowse
> (E-mail)"
>
> >>> <gmod-gbrowse at lists.sourceforge.net>, "Scott Cain" <
> scott at scottcain.net>
>
> >>> Sent: Thursday, April 1, 2010 1:52:21 PM
>
> >>> Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues
>
> >>>
>
> >>> These errors are saying that the gd.h header file can no longer be
> found
>
> >>> in the default search path. Is it there at all?
>
> >>> Lincoln
>
> >>>
>
> >>> On Thu, Apr 1, 2010 at 12:53 PM, James M. Nolan <jnolan at ggc.edu>
> wrote:
>
> >>>>
>
> >>>> I had gd 2.0.36RC1 but I don't think it was RC1.29, more on that at
> the
>
> >>>> bottom of message (see "-------Begin libgd attempt" ).
>
> >>>> I first tried removing the fink path from .cshrc and checked in a new
>
> >>>> window that the path was corrected. Installing GD.pm gave the
> following
>
> >>>> output with errors; I did not force.
>
> >>>> When it failed, I then tried uninstalling libgd and installing the
>
> >>>> latest
>
> >>>> iteration of 2.0.36.
>
> >>>> And my test of gd with php still works, but now that I uninstalled
> libgd
>
> >>>> the gdlib-config --version command is no longer found. I am mystified.
>
>
> >>>> Thanks
>
> >>>> Jim
>
> >>>> -----GD.pm installation
>
> >>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PL
>
> >>>> Notice: Type perl Makefile.PL -h for command-line option summary.
>
> >>>> Configuring for libgd version 2.0.36.
>
> >>>> Checking for stray libgd header files...none found.
>
> >>>> Included Features: GD_XPM GD_JPEG GD_FONTCONFIG GD_FREETYPE
>
> >>>> GD_PNG GD_GIF GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY GD_ANIMGIF
>
> >>>> GD_FTCIRCLE VERSION_33
>
> >>>> GD library used from: /usr/local
>
> >>>> Checking if your kit is complete...
>
> >>>> Looks good
>
> >>>> Note (probably harmless): No library found for -lgd
>
> >>>> Writing Makefile for GD
>
> >>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make
>
> >>>> /usr/bin/perl GD/Image.pm.PLS GD/Image.pm
>
> >>>> Extracting Image.pm (with variable substitutions)
>
> >>>> cp GD/Polyline.pm blib/lib/GD/Polyline.pm
>
> >>>> cp qd.pl blib/lib/qd.pl
>
> >>>> cp GD/Image.pm blib/lib/GD/Image.pm
>
> >>>> cp GD.pm blib/lib/GD.pm
>
> >>>> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD)
>
> >>>> cp GD/Simple.pm blib/lib/GD/Simple.pm
>
> >>>> cp GD/Polygon.pm blib/lib/GD/Polygon.pm
>
> >>>> cp GD/Group.pm blib/lib/GD/Group.pm
>
> >>>> /usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap
>
> >>>> /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs >
>
> >>>> GD.xsc
>
> >>>> && mv GD.xsc GD.c
>
> >>>> gcc-4.2 -c -I/usr/local/include -Wformat=0 -Os -DVERSION=\"2.44\"
>
> >>>> -DXS_VERSION=\"2.44\"
>
> >>>> "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE"
>
> >>>> -DHAVE_JPEG
>
> >>>> -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33
>
>
> >>>> -DHAVE_UNCLOSEDPOLY -DHAVE_FONTCONFIG -DHAVE_FTCIRCLE GD.c
>
> >>>> GD.xs:7:16: error: gd.h: No such file or directory
>
> >>>> GD.xs:8:21: error: gdfontg.h: No such file or directory
>
> >>>> GD.xs:9:21: error: gdfontl.h: No such file or directory
>
> >>>> GD.xs:10:22: error: gdfontmb.h: No such file or directory
>
> >>>> GD.xs:11:21: error: gdfonts.h: No such file or directory
>
> >>>> GD.xs:12:21: error: gdfontt.h: No such file or directory
>
> >>>> GD.xs:340: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__?
>
> >>>> before
>
> >>>> ?GD__Image?
>
> >>>> GD.xs:341: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__?
>
> >>>> before
>
> >>>> ?GD__Font?
>
> >>>> GD.xs:383: error: expected specifier-qualifier-list before ?gdIOCtx?
>
> >>>> GD.xs:391: error: expected ?)? before ?ctx?
>
> >>>> GD.xs:398: error: expected ?)? before ?ctx?
>
> >>>> GD.xs:414: error: expected ?)? before ?ctx?
>
> >>>> GD.xs:422: error: expected ?)? before ?ctx?
>
> >>>> GD.xs:427: error: expected ?)? before ?ctx?
>
> >>>> GD.xs:431: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__?
>
> >>>> before
>
> >>>> ?*? token
>
> >>>> GD.xs:452: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__?
>
> >>>> before
>
> >>>> ?gd_cloneDim?
>
> >>>> GD.xs:476: error: expected ?)? before ?src?
>
> >>>> GD.xs:505: error: expected ?)? before ?image?
>
> >>>> GD.c: In function ?XS_GD__Image__new?:
>
> >>>> GD.c:633: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:633: error: (Each undeclared identifier is reported only once
>
> >>>> GD.c:633: error: for each function it appears in.)
>
> >>>> GD.c:633: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:588: error: ?gdImagePtr? undeclared (first use in this function)
>
>
> >>>> GD.xs:588: error: expected ?;? before ?theImage?
>
> >>>> GD.xs:592: error: ?theImage? undeclared (first use in this function)
>
> >>>> GD.xs:592: error: expected ?;? before ?gdImageCreateTrueColor?
>
> >>>> GD.xs:594: error: expected ?;? before ?gdImageCreate?
>
> >>>> GD.xs:596: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromPng?:
>
> >>>> GD.c:697: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:697: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:615: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:615: error: expected ?;? before ?gdImageCreateFromPng?
>
> >>>> GD.xs: In function ?XS_GD__Image_newFromPngData?:
>
> >>>> GD.xs:627: error: ?gdIOCtx? undeclared (first use in this function)
>
> >>>> GD.xs:627: error: ?ctx? undeclared (first use in this function)
>
> >>>> GD.c:741: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:741: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:639: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:639: error: expected ?;? before ?gdImageCreateFromPngCtx?
>
> >>>> GD.c: In function ?XS_GD__Image_newFromGdData?:
>
> >>>> GD.c:782: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:782: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:658: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:658: error: expected ?;? before ?gdImageCreateFromGdPtr?
>
> >>>> GD.c: In function ?XS_GD__Image_newFromGd2Data?:
>
> >>>> GD.c:818: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:818: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:672: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:672: error: expected ?;? before ?gdImageCreateFromGd2Ptr?
>
> >>>> GD.xs: In function ?XS_GD__Image_newFromJpegData?:
>
> >>>> GD.xs:683: error: ?gdIOCtx? undeclared (first use in this function)
>
> >>>> GD.xs:683: error: ?ctx? undeclared (first use in this function)
>
> >>>> GD.c:864: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:864: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:695: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:695: error: expected ?;? before ?gdImageCreateFromJpegCtx?
>
> >>>> GD.xs: In function ?XS_GD__Image_newFromWBMPData?:
>
> >>>> GD.xs:710: error: ?gdIOCtx? undeclared (first use in this function)
>
> >>>> GD.xs:710: error: ?ctx? undeclared (first use in this function)
>
> >>>> GD.c:912: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:912: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:722: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:722: error: expected ?;? before ?gdImageCreateFromWBMPCtx?
>
> >>>> GD.c: In function ?XS_GD__Image__newFromXbm?:
>
> >>>> GD.c:948: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:948: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:735: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromGd?:
>
> >>>> GD.c:979: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:979: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:745: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromGd2?:
>
> >>>> GD.c:1010: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1010: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:755: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromJpeg?:
>
> >>>> GD.c:1052: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1052: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:773: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs: In function ?XS_GD__Image__newFromWBMP?:
>
> >>>> GD.xs:787: error: ?gdImagePtr? undeclared (first use in this function)
>
>
> >>>> GD.xs:787: error: expected ?;? before ?img?
>
> >>>> GD.c:1090: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1090: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:790: error: ?img? undeclared (first use in this function)
>
> >>>> GD.xs:797: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs: In function ?XS_GD__Image_newFromXpm?:
>
> >>>> GD.xs:807: error: ?gdImagePtr? undeclared (first use in this function)
>
>
> >>>> GD.xs:807: error: expected ?;? before ?img?
>
> >>>> GD.c:1132: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1132: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:811: error: ?img? undeclared (first use in this function)
>
> >>>> GD.xs:811: error: expected ?;? before ?gdImageCreateFromXpm?
>
> >>>> GD.xs:818: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromGd2Part?:
>
> >>>> GD.c:1180: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1180: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:837: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image__newFromGif?:
>
> >>>> GD.c:1222: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1222: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:855: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs: In function ?XS_GD__Image_newFromGifData?:
>
> >>>> GD.xs:865: error: ?gdIOCtx? undeclared (first use in this function)
>
> >>>> GD.xs:865: error: ?ctx? undeclared (first use in this function)
>
> >>>> GD.c:1264: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1264: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:877: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.xs:877: error: expected ?;? before ?gdImageCreateFromGifCtx?
>
> >>>> GD.c: In function ?XS_GD__Image_DESTROY?:
>
> >>>> GD.c:1297: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1297: error: expected ?;? before ?image?
>
> >>>> GD.c:1301: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_STORABLE_freeze?:
>
> >>>> GD.c:1329: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1329: error: expected ?;? before ?image?
>
> >>>> GD.c:1335: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:903: error: ?GD2_FMT_COMPRESSED? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:903: warning: assignment makes pointer from integer without a
> cast
>
> >>>> GD.xs: In function ?XS_GD__Image_STORABLE_thaw?:
>
> >>>> GD.xs:917: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.xs:917: error: expected ?;? before ?image?
>
> >>>> GD.xs:922: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_png?:
>
> >>>> GD.c:1407: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1407: error: expected ?;? before ?image?
>
> >>>> GD.c:1414: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:939: warning: cast to pointer from integer of different size
>
> >>>> GD.xs:941: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_jpeg?:
>
> >>>> GD.c:1458: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1458: error: expected ?;? before ?image?
>
> >>>> GD.c:1467: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:963: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_gifanimbegin?:
>
> >>>> GD.c:1514: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1514: error: expected ?;? before ?image?
>
> >>>> GD.c:1523: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:990: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_gifanimadd?:
>
> >>>> GD.c:1573: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1573: error: expected ?;? before ?image?
>
> >>>> GD.c:1579: error: expected ?;? before ?previm?
>
> >>>> GD.c:1584: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:1622: error: ?previm? undeclared (first use in this function)
>
> >>>> GD.xs:1015: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_gifanimend?:
>
> >>>> GD.c:1665: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1665: error: expected ?;? before ?image?
>
> >>>> GD.c:1670: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1034: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_wbmp?:
>
> >>>> GD.c:1708: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1708: error: expected ?;? before ?image?
>
> >>>> GD.c:1717: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1055: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_gif?:
>
> >>>> GD.c:1760: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1760: error: expected ?;? before ?image?
>
> >>>> GD.c:1768: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1079: warning: cast to pointer from integer of different size
>
> >>>> GD.c: In function ?XS_GD__Image_gd?:
>
> >>>> GD.c:1809: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1809: error: expected ?;? before ?image?
>
> >>>> GD.c:1814: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1102: warning: assignment makes pointer from integer without a
>
> >>>> cast
>
> >>>> GD.c: In function ?XS_GD__Image_gd2?:
>
> >>>> GD.c:1848: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1848: error: expected ?;? before ?image?
>
> >>>> GD.c:1853: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1117: error: ?GD2_FMT_COMPRESSED? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:1117: warning: assignment makes pointer from integer without a
>
> >>>> cast
>
> >>>> GD.c: In function ?XS_GD__Image_transparent?:
>
> >>>> GD.c:1887: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1887: error: expected ?;? before ?image?
>
> >>>> GD.c:1893: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_getBounds?:
>
> >>>> GD.c:1929: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1929: error: expected ?;? before ?image?
>
> >>>> GD.c:1933: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_isTrueColor?:
>
> >>>> GD.c:1967: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:1967: error: expected ?;? before ?image?
>
> >>>> GD.c:1973: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_trueColorToPalette?:
>
> >>>> GD.c:2002: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2002: error: expected ?;? before ?image?
>
> >>>> GD.c:2008: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:2022: error: ?gdMaxColors? undeclared (first use in this
> function)
>
> >>>> GD.c: In function ?XS_GD__Image_rgb?:
>
> >>>> GD.c:2050: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2050: error: expected ?;? before ?image?
>
> >>>> GD.c:2055: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_boundsSafe?:
>
> >>>> GD.c:2091: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2091: error: expected ?;? before ?image?
>
> >>>> GD.c:2099: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_getPixel?:
>
> >>>> GD.c:2130: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2130: error: expected ?;? before ?image?
>
> >>>> GD.c:2138: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setPixel?:
>
> >>>> GD.c:2167: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2167: error: expected ?;? before ?image?
>
> >>>> GD.c:2174: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyRotate90?:
>
> >>>> GD.c:2202: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2202: error: expected ?;? before ?src?
>
> >>>> GD.c:2203: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2207: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1240: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1242: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1242: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1246: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1246: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1249: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyRotate180?:
>
> >>>> GD.c:2247: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2247: error: expected ?;? before ?src?
>
> >>>> GD.c:2248: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2252: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1261: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1263: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1263: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1267: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1267: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1270: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyRotate270?:
>
> >>>> GD.c:2292: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2292: error: expected ?;? before ?src?
>
> >>>> GD.c:2293: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2297: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1282: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1284: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1284: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1288: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1288: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1291: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyFlipHorizontal?:
>
> >>>> GD.c:2337: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2337: error: expected ?;? before ?src?
>
> >>>> GD.c:2338: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2342: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1303: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1305: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1305: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1309: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1309: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1312: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyFlipVertical?:
>
> >>>> GD.c:2382: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2382: error: expected ?;? before ?src?
>
> >>>> GD.c:2383: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2387: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1324: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1326: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1326: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1330: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1330: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1333: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyTranspose?:
>
> >>>> GD.c:2427: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2427: error: expected ?;? before ?src?
>
> >>>> GD.c:2428: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2432: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1345: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1347: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1347: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1351: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1351: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1354: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyReverseTranspose?:
>
> >>>> GD.c:2472: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2472: error: expected ?;? before ?src?
>
> >>>> GD.c:2473: error: expected ?;? before ?RETVAL?
>
> >>>> GD.c:2477: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1366: error: expected ?;? before ?dst?
>
> >>>> GD.xs:1368: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.xs:1368: error: expected ?;? before ?gd_cloneDim?
>
> >>>> GD.xs:1372: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1372: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1375: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_rotate180?:
>
> >>>> GD.c:2517: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2517: error: expected ?;? before ?src?
>
> >>>> GD.c:2521: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1392: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1392: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1393: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1393: error: lvalue required as left operand of assignment
>
> >>>> GD.c: In function ?XS_GD__Image_copyRotated?:
>
> >>>> GD.c:2558: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2558: error: expected ?;? before ?dst?
>
> >>>> GD.c:2559: error: expected ?;? before ?src?
>
> >>>> GD.c:2570: error: ?dst? undeclared (first use in this function)
>
> >>>> GD.c:2579: error: ?src? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_flipHorizontal?:
>
> >>>> GD.c:2611: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2611: error: expected ?;? before ?src?
>
> >>>> GD.c:2615: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1431: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1431: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1432: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1432: error: lvalue required as left operand of assignment
>
> >>>> GD.c: In function ?XS_GD__Image_flipVertical?:
>
> >>>> GD.c:2652: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2652: error: expected ?;? before ?src?
>
> >>>> GD.c:2656: error: ?src? undeclared (first use in this function)
>
> >>>> GD.xs:1449: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1449: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1450: error: lvalue required as left operand of assignment
>
> >>>> GD.xs:1450: error: lvalue required as left operand of assignment
>
> >>>> GD.c: In function ?XS_GD__Image_line?:
>
> >>>> GD.c:2693: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2693: error: expected ?;? before ?image?
>
> >>>> GD.c:2702: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_dashedLine?:
>
> >>>> GD.c:2730: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2730: error: expected ?;? before ?image?
>
> >>>> GD.c:2739: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_openPolygon?:
>
> >>>> GD.c:2767: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2767: error: expected ?;? before ?image?
>
> >>>> GD.c:2773: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1494: error: ?gdPointPtr? undeclared (first use in this
> function)
>
> >>>> GD.xs:1494: error: expected ?;? before ?polyptr?
>
> >>>> GD.xs:1510: error: ?polyptr? undeclared (first use in this function)
>
> >>>> GD.xs:1510: error: expected ?;? before ?Perl_safesysmalloc?
>
> >>>> GD.c: In function ?XS_GD__Image_unclosedPolygon?:
>
> >>>> GD.c:2846: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2846: error: expected ?;? before ?image?
>
> >>>> GD.c:2852: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1550: error: ?gdPointPtr? undeclared (first use in this
> function)
>
> >>>> GD.xs:1550: error: expected ?;? before ?polyptr?
>
> >>>> GD.xs:1566: error: ?polyptr? undeclared (first use in this function)
>
> >>>> GD.xs:1566: error: expected ?;? before ?Perl_safesysmalloc?
>
> >>>> GD.c: In function ?XS_GD__Image_filledPolygon?:
>
> >>>> GD.c:2928: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:2928: error: expected ?;? before ?image?
>
> >>>> GD.c:2934: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:1609: error: ?gdPointPtr? undeclared (first use in this
> function)
>
> >>>> GD.xs:1609: error: expected ?;? before ?polyptr?
>
> >>>> GD.xs:1625: error: ?polyptr? undeclared (first use in this function)
>
> >>>> GD.xs:1625: error: expected ?;? before ?Perl_safesysmalloc?
>
> >>>> GD.c: In function ?XS_GD__Image_rectangle?:
>
> >>>> GD.c:3007: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3007: error: expected ?;? before ?image?
>
> >>>> GD.c:3016: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_filledRectangle?:
>
> >>>> GD.c:3044: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3044: error: expected ?;? before ?image?
>
> >>>> GD.c:3053: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_filledEllipse?:
>
> >>>> GD.c:3081: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3081: error: expected ?;? before ?image?
>
> >>>> GD.c:3090: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_arc?:
>
> >>>> GD.c:3118: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3118: error: expected ?;? before ?image?
>
> >>>> GD.c:3129: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_filledArc?:
>
> >>>> GD.c:3157: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3157: error: expected ?;? before ?image?
>
> >>>> GD.c:3169: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_fillToBorder?:
>
> >>>> GD.c:3203: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3203: error: expected ?;? before ?image?
>
> >>>> GD.c:3211: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_fill?:
>
> >>>> GD.c:3239: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3239: error: expected ?;? before ?image?
>
> >>>> GD.c:3246: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setBrush?:
>
> >>>> GD.c:3274: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3274: error: expected ?;? before ?image?
>
> >>>> GD.c:3275: error: expected ?;? before ?brush?
>
> >>>> GD.c:3279: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:3288: error: ?brush? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setTile?:
>
> >>>> GD.c:3316: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3316: error: expected ?;? before ?image?
>
> >>>> GD.c:3317: error: expected ?;? before ?tile?
>
> >>>> GD.c:3321: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:3330: error: ?tile? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setThickness?:
>
> >>>> GD.c:3358: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3358: error: expected ?;? before ?image?
>
> >>>> GD.c:3363: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setStyle?:
>
> >>>> GD.c:3391: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3391: error: expected ?;? before ?image?
>
> >>>> GD.c:3395: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorAllocate?:
>
> >>>> GD.c:3435: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3435: error: expected ?;? before ?image?
>
> >>>> GD.c:3444: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorAllocateAlpha?:
>
> >>>> GD.c:3473: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3473: error: expected ?;? before ?image?
>
> >>>> GD.c:3483: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorClosest?:
>
> >>>> GD.c:3512: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3512: error: expected ?;? before ?image?
>
> >>>> GD.c:3521: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorClosestAlpha?:
>
> >>>> GD.c:3550: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3550: error: expected ?;? before ?image?
>
> >>>> GD.c:3560: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorClosestHWB?:
>
> >>>> GD.c:3589: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3589: error: expected ?;? before ?image?
>
> >>>> GD.c:3598: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorExact?:
>
> >>>> GD.c:3627: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3627: error: expected ?;? before ?image?
>
> >>>> GD.c:3636: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorExactAlpha?:
>
> >>>> GD.c:3665: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3665: error: expected ?;? before ?image?
>
> >>>> GD.c:3675: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorResolve?:
>
> >>>> GD.c:3704: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3704: error: expected ?;? before ?image?
>
> >>>> GD.c:3713: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorResolveAlpha?:
>
> >>>> GD.c:3742: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3742: error: expected ?;? before ?image?
>
> >>>> GD.c:3752: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorsTotal?:
>
> >>>> GD.c:3781: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3781: error: expected ?;? before ?image?
>
> >>>> GD.c:3787: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_interlaced?:
>
> >>>> GD.c:3818: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3818: error: expected ?;? before ?image?
>
> >>>> GD.c:3824: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_compare?:
>
> >>>> GD.c:3859: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3859: error: expected ?;? before ?image1?
>
> >>>> GD.c:3860: error: expected ?;? before ?image2?
>
> >>>> GD.c:3866: error: ?image1? undeclared (first use in this function)
>
> >>>> GD.c:3875: error: ?image2? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_colorDeallocate?:
>
> >>>> GD.c:3904: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3904: error: expected ?;? before ?image?
>
> >>>> GD.c:3909: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copy?:
>
> >>>> GD.c:3937: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3937: error: expected ?;? before ?destination?
>
> >>>> GD.c:3938: error: expected ?;? before ?source?
>
> >>>> GD.c:3948: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:3957: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyResized?:
>
> >>>> GD.c:3985: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:3985: error: expected ?;? before ?destination?
>
> >>>> GD.c:3986: error: expected ?;? before ?source?
>
> >>>> GD.c:3998: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:4007: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyResampled?:
>
> >>>> GD.c:4035: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4035: error: expected ?;? before ?destination?
>
> >>>> GD.c:4036: error: expected ?;? before ?source?
>
> >>>> GD.c:4048: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:4057: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyMerge?:
>
> >>>> GD.c:4085: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4085: error: expected ?;? before ?destination?
>
> >>>> GD.c:4086: error: expected ?;? before ?source?
>
> >>>> GD.c:4097: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:4106: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_copyMergeGray?:
>
> >>>> GD.c:4134: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4134: error: expected ?;? before ?destination?
>
> >>>> GD.c:4135: error: expected ?;? before ?source?
>
> >>>> GD.c:4146: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:4155: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_paletteCopy?:
>
> >>>> GD.c:4183: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4183: error: expected ?;? before ?destination?
>
> >>>> GD.c:4184: error: expected ?;? before ?source?
>
> >>>> GD.c:4188: error: ?destination? undeclared (first use in this
> function)
>
> >>>> GD.c:4197: error: ?source? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_char?:
>
> >>>> GD.c:4225: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4225: error: expected ?;? before ?image?
>
> >>>> GD.c:4226: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4226: error: expected ?;? before ?font?
>
> >>>> GD.c:4234: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:4243: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_charUp?:
>
> >>>> GD.c:4271: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4271: error: expected ?;? before ?image?
>
> >>>> GD.c:4272: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4272: error: expected ?;? before ?font?
>
> >>>> GD.c:4280: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:4289: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_string?:
>
> >>>> GD.c:4317: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4317: error: expected ?;? before ?image?
>
> >>>> GD.c:4318: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4318: error: expected ?;? before ?font?
>
> >>>> GD.c:4326: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:4335: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_stringUp?:
>
> >>>> GD.c:4363: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4363: error: expected ?;? before ?image?
>
> >>>> GD.c:4364: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4364: error: expected ?;? before ?font?
>
> >>>> GD.c:4372: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c:4381: error: ?font? undeclared (first use in this function)
>
> >>>> GD.xs: In function ?XS_GD__Image_stringFT?:
>
> >>>> GD.xs:2153: error: ?gdImagePtr? undeclared (first use in this
> function)
>
> >>>> GD.xs:2153: error: expected ?;? before ?img?
>
> >>>> GD.xs:2163: error: ?gdFTStringExtra? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2163: error: expected ?;? before ?strex?
>
> >>>> GD.xs:2173: error: ?img? undeclared (first use in this function)
>
> >>>> GD.xs:2173: error: expected ?;? before ?tmp?
>
> >>>> GD.xs:2182: error: ?strex? undeclared (first use in this function)
>
> >>>> GD.xs:2186: error: ?gdFTEX_LINESPACE? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2190: error: ?gdFTEX_CHARMAP? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2192: error: ?gdFTEX_Unicode? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2194: error: ?gdFTEX_Shift_JIS? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2196: error: ?gdFTEX_Big5? undeclared (first use in this
> function)
>
> >>>> GD.xs:2202: error: ?gdFTEX_RESOLUTION? undeclared (first use in this
>
> >>>> function)
>
> >>>> GD.xs:2211: error: ?gdFTEX_DISABLE_KERNING? undeclared (first use in
>
> >>>> this
>
> >>>> function)
>
> >>>> GD.xs:2217: warning: assignment makes pointer from integer without a
>
> >>>> cast
>
> >>>> GD.xs:2221: warning: assignment makes pointer from integer without a
>
> >>>> cast
>
> >>>> GD.c: In function ?XS_GD__Image_stringFTCircle?:
>
> >>>> GD.c:4523: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4523: error: expected ?;? before ?image?
>
> >>>> GD.c:4543: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs:2262: warning: assignment makes pointer from integer without a
>
> >>>> cast
>
> >>>> GD.c: In function ?XS_GD__Image_useFontConfig?:
>
> >>>> GD.c:4596: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4596: error: expected ?;? before ?image?
>
> >>>> GD.c:4606: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_alphaBlending?:
>
> >>>> GD.c:4641: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4641: error: expected ?;? before ?image?
>
> >>>> GD.c:4646: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_saveAlpha?:
>
> >>>> GD.c:4674: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4674: error: expected ?;? before ?image?
>
> >>>> GD.c:4679: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_clip?:
>
> >>>> GD.c:4709: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4709: error: expected ?;? before ?image?
>
> >>>> GD.c:4717: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setAntiAliased?:
>
> >>>> GD.c:4757: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4757: error: expected ?;? before ?image?
>
> >>>> GD.c:4762: error: ?image? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Image_setAntiAliasedDontBlend?:
>
> >>>> GD.c:4790: error: ?GD__Image? undeclared (first use in this function)
>
> >>>> GD.c:4790: error: expected ?;? before ?image?
>
> >>>> GD.c:4796: error: ?image? undeclared (first use in this function)
>
> >>>> GD.xs: In function ?XS_GD__Font_load?:
>
> >>>> GD.xs:2383: error: ?gdFontPtr? undeclared (first use in this function)
>
>
> >>>> GD.xs:2383: error: expected ?;? before ?font?
>
> >>>> GD.c:4841: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4841: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2395: error: ?font? undeclared (first use in this function)
>
> >>>> GD.xs:2395: error: expected ?;? before ?Perl_safesysmalloc?
>
> >>>> GD.xs:2426: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_DESTROY?:
>
> >>>> GD.c:4910: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4910: error: expected ?;? before ?self?
>
> >>>> GD.c:4914: error: ?self? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_Small?:
>
> >>>> GD.c:4950: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4950: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2453: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_Large?:
>
> >>>> GD.c:4982: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:4982: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2464: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_Giant?:
>
> >>>> GD.c:5014: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5014: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2475: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_MediumBold?:
>
> >>>> GD.c:5046: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5046: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2486: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_Tiny?:
>
> >>>> GD.c:5078: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5078: error: expected ?;? before ?RETVAL?
>
> >>>> GD.xs:2497: error: ?RETVAL? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_nchars?:
>
> >>>> GD.c:5109: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5109: error: expected ?;? before ?font?
>
> >>>> GD.c:5115: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_offset?:
>
> >>>> GD.c:5144: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5144: error: expected ?;? before ?font?
>
> >>>> GD.c:5150: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_width?:
>
> >>>> GD.c:5179: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5179: error: expected ?;? before ?font?
>
> >>>> GD.c:5185: error: ?font? undeclared (first use in this function)
>
> >>>> GD.c: In function ?XS_GD__Font_height?:
>
> >>>> GD.c:5214: error: ?GD__Font? undeclared (first use in this function)
>
> >>>> GD.c:5214: error: expected ?;? before ?font?
>
> >>>> GD.c:5220: error: ?font? undeclared (first use in this function)
>
> >>>> make: *** [GD.o] Error 1
>
> >>>>
>
> >>>> -------END GD.pm attempt.
>
> >>>> -------Begin libgd attempt
>
> >>>>
>
> >>>> I then did make uninstall on libgd, downloaded 2.036RC1.29 and
> attempted
>
> >>>> to install and got the following errors output:
>
> >>>> [host-9-116:~/Desktop/server/gd-2.0.36RC1.29] jnolan% ./configure
>
> >>>> checking build system type... i386-apple-darwin10.3.0
>
> >>>> checking host system type... i386-apple-darwin10.3.0
>
> >>>> checking target system type... i386-apple-darwin10.3.0
>
> >>>> checking for a BSD-compatible install... /usr/bin/install -c
>
> >>>> checking whether build environment is sane... yes
>
> >>>> checking for a thread-safe mkdir -p... config/install-sh -c -d
>
> >>>> checking for gawk... no
>
> >>>> checking for mawk... no
>
> >>>> checking for nawk... no
>
> >>>> checking for awk... awk
>
> >>>> checking whether make sets $(MAKE)... yes
>
> >>>> checking if we are building a Cygwin target... no
>
> >>>> checking for gcc... gcc
>
> >>>> checking for C compiler default output file name... a.out
>
> >>>> checking whether the C compiler works... yes
>
> >>>> checking whether we are cross compiling... no
>
> >>>> checking for suffix of executables...
>
> >>>> checking for suffix of object files... o
>
> >>>> checking whether we are using the GNU C compiler... yes
>
> >>>> checking whether gcc accepts -g... yes
>
> >>>> checking for gcc option to accept ISO C89... none needed
>
> >>>> checking for style of include used by make... GNU
>
> >>>> checking dependency style of gcc... gcc3
>
> >>>> checking for gcc... (cached) gcc
>
> >>>> checking whether we are using the GNU C compiler... (cached) yes
>
> >>>> checking whether gcc accepts -g... (cached) yes
>
> >>>> checking for gcc option to accept ISO C89... (cached) none needed
>
> >>>> checking dependency style of gcc... (cached) gcc3
>
> >>>> checking for a BSD-compatible install... /usr/bin/install -c
>
> >>>> checking for a sed that does not truncate output... /usr/bin/sed
>
> >>>> checking for grep that handles long lines and -e... /usr/bin/grep
>
> >>>> checking for egrep... /usr/bin/grep -E
>
> >>>> checking for ld used by gcc...
>
> >>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld
>
> >>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld)
>
>
> >>>> is
>
> >>>> GNU ld... no
>
> >>>> checking for /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld option to
>
> >>>> reload object files... -r
>
> >>>> checking for BSD-compatible nm... /usr/bin/nm
>
> >>>> checking whether ln -s works... yes
>
> >>>> checking how to recognize dependent libraries... pass_all
>
> >>>> checking how to run the C preprocessor... gcc -E
>
> >>>> checking for ANSI C header files... yes
>
> >>>> checking for sys/types.h... yes
>
> >>>> checking for sys/stat.h... yes
>
> >>>> checking for stdlib.h... yes
>
> >>>> checking for string.h... yes
>
> >>>> checking for memory.h... yes
>
> >>>> checking for strings.h... yes
>
> >>>> checking for inttypes.h... yes
>
> >>>> checking for stdint.h... yes
>
> >>>> checking for unistd.h... yes
>
> >>>> checking dlfcn.h usability... yes
>
> >>>> checking dlfcn.h presence... yes
>
> >>>> checking for dlfcn.h... yes
>
> >>>> checking for g++... g++
>
> >>>> checking whether we are using the GNU C++ compiler... yes
>
> >>>> checking whether g++ accepts -g... yes
>
> >>>> checking dependency style of g++... gcc3
>
> >>>> checking how to run the C++ preprocessor... g++ -E
>
> >>>> checking for g77... no
>
> >>>> checking for xlf... no
>
> >>>> checking for f77... no
>
> >>>> checking for frt... no
>
> >>>> checking for pgf77... no
>
> >>>> checking for cf77... no
>
> >>>> checking for fort77... no
>
> >>>> checking for fl32... no
>
> >>>> checking for af77... no
>
> >>>> checking for xlf90... no
>
> >>>> checking for f90... no
>
> >>>> checking for pgf90... no
>
> >>>> checking for pghpf... no
>
> >>>> checking for epcf90... no
>
> >>>> checking for gfortran... no
>
> >>>> checking for g95... no
>
> >>>> checking for xlf95... no
>
> >>>> checking for f95... no
>
> >>>> checking for fort... no
>
> >>>> checking for ifort... no
>
> >>>> checking for ifc... no
>
> >>>> checking for efc... no
>
> >>>> checking for pgf95... no
>
> >>>> checking for lf95... no
>
> >>>> checking for ftn... no
>
> >>>> checking whether we are using the GNU Fortran 77 compiler... no
>
> >>>> checking whether accepts -g... no
>
> >>>> checking the maximum length of command line arguments... 196608
>
> >>>> checking command to parse /usr/bin/nm output from gcc object... rm:
>
> >>>> conftest.dSYM: is a directory
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> ok
>
> >>>> checking for objdir... .libs
>
> >>>> checking for ar... ar
>
> >>>> checking for ranlib... ranlib
>
> >>>> checking for strip... strip
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> checking if gcc supports -fno-rtti -fno-exceptions... rm:
> conftest.dSYM:
>
> >>>> is a directory
>
> >>>> no
>
> >>>> checking for gcc option to produce PIC... -fno-common
>
> >>>> checking if gcc PIC flag -fno-common works... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> yes
>
> >>>> checking if gcc static flag -static works... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> no
>
> >>>> checking if gcc supports -c -o file.o... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> yes
>
> >>>> checking whether the gcc linker
>
> >>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared
>
> >>>> libraries...
>
> >>>> yes
>
> >>>> checking dynamic linker characteristics... darwin10.3.0 dyld
>
> >>>> checking how to hardcode library paths into programs... immediate
>
> >>>> checking whether stripping libraries is possible... yes
>
> >>>> checking if libtool supports shared libraries... yes
>
> >>>> checking whether to build shared libraries... yes
>
> >>>> checking whether to build static libraries... yes
>
> >>>> configure: creating libtool
>
> >>>> appending configuration tag "CXX" to libtool
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> checking for ld used by g++...
>
> >>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld
>
> >>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld)
>
>
> >>>> is
>
> >>>> GNU ld... no
>
> >>>> checking whether the g++ linker
>
> >>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared
>
> >>>> libraries...
>
> >>>> yes
>
> >>>> checking for g++ option to produce PIC... -fno-common
>
> >>>> checking if g++ PIC flag -fno-common works... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> yes
>
> >>>> checking if g++ static flag -static works... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> no
>
> >>>> checking if g++ supports -c -o file.o... rm: conftest.dSYM: is a
>
> >>>> directory
>
> >>>> yes
>
> >>>> checking whether the g++ linker
>
> >>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared
>
> >>>> libraries...
>
> >>>> yes
>
> >>>> checking dynamic linker characteristics... darwin10.3.0 dyld
>
> >>>> checking how to hardcode library paths into programs... immediate
>
> >>>> appending configuration tag "F77" to libtool
>
> >>>> checking whether ln -s works... yes
>
> >>>> checking whether make sets $(MAKE)... (cached) yes
>
> >>>> checking for X... no
>
> >>>> checking for ANSI C header files... (cached) yes
>
> >>>> checking errno.h usability... yes
>
> >>>> checking errno.h presence... yes
>
> >>>> checking for errno.h... yes
>
> >>>> checking limits.h usability... yes
>
> >>>> checking limits.h presence... yes
>
> >>>> checking for limits.h... yes
>
> >>>> checking stddef.h usability... yes
>
> >>>> checking stddef.h presence... yes
>
> >>>> checking for stddef.h... yes
>
> >>>> checking for stdlib.h... (cached) yes
>
> >>>> checking for string.h... (cached) yes
>
> >>>> checking for unistd.h... (cached) yes
>
> >>>> checking for ld used by GCC...
>
> >>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld
>
> >>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld)
>
>
> >>>> is
>
> >>>> GNU ld... no
>
> >>>> checking for shared library run path origin... done
>
> >>>> checking for iconv... yes
>
> >>>> checking how to link with libiconv... -liconv
>
> >>>> checking for iconv declaration...
>
> >>>> extern size_t iconv (iconv_t cd, char * *inbuf, size_t
>
> >>>> *inbytesleft, char * *outbuf, size_t *outbytesleft);
>
> >>>> checking iconv.h usability... yes
>
> >>>> checking iconv.h presence... yes
>
> >>>> checking for iconv.h... yes
>
> >>>> checking whether iconv.h defines iconv_t... yes
>
> >>>> rm: conftest.dSYM: is a directory
>
> >>>> checking for sin... yes
>
> >>>> checking for deflate in -lz... yes
>
> >>>> checking for libpng12-config... /usr/X11/bin/libpng12-config
>
> >>>> checking for libpng-config... /usr/local/bin/libpng-config
>
> >>>> checking png.h usability... yes
>
> >>>> checking png.h presence... yes
>
> >>>> checking for png.h... yes
>
> >>>> checking for png_create_read_struct in -lpng12... yes
>
> >>>> checking for freetype-config... /usr/local/bin/freetype-config
>
> >>>> checking for FT_Init_FreeType in -lfreetype... yes
>
> >>>> checking ft2build.h usability... yes
>
> >>>> checking ft2build.h presence... yes
>
> >>>> checking for ft2build.h... yes
>
> >>>> checking for FcInit in -lfontconfig... yes
>
> >>>> checking for jpeg_set_defaults in -ljpeg... yes
>
> >>>> checking for XpmReadFileToXpmImage in -lXpm... yes
>
> >>>> checking for the pthreads library -lpthreads... no
>
> >>>> checking whether pthreads work without any flags... yes
>
> >>>> checking for joinable pthread attribute... PTHREAD_CREATE_JOINABLE
>
> >>>> checking if more special flags are required for pthreads...
>
> >>>> -D_THREAD_SAFE
>
> >>>> ** Configuration summary for gd 2.0.36:
>
> >>>> Support for PNG library: yes
>
> >>>> Support for JPEG library: yes
>
> >>>> Support for Freetype 2.x library: yes
>
> >>>> Support for Fontconfig library: yes
>
> >>>> Support for Xpm library: yes
>
> >>>> Support for pthreads: yes
>
> >>>> configure: creating ./config.status
>
> >>>> config.status: creating Makefile
>
> >>>> config.status: creating config/Makefile
>
> >>>> config.status: creating config/gdlib-config
>
> >>>> config.status: creating test/Makefile
>
> >>>> config.status: creating config.h
>
> >>>> config.status: executing depfiles commands
>
> >>>> [host-9-116:~/Desktop/server/gd-2.0.36RC1.29] jnolan% make
>
> >>>> make all-recursive
>
> >>>> Making all in config
>
> >>>> make[2]: Nothing to be done for `all'.
>
> >>>> Making all in test
>
> >>>> make[2]: Nothing to be done for `all'.
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD -MP -MF .deps/gd.Tpo
>
> >>>> -c
>
> >>>> -o gd.lo gd.c
>
> >>>> mkdir .libs
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd.Tpo -c gd.c -fno-common -DPIC -o .libs/gd.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd.Tpo -c gd.c -o gd.o >/dev/null 2>&1
>
> >>>> mv -f .deps/gd.Tpo .deps/gd.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo -MD -MP -MF
>
> >>>> .deps/gdfx.Tpo
>
> >>>> -c -o gdfx.lo gdfx.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gdfx.Tpo -c gdfx.c -fno-common -DPIC -o .libs/gdfx.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gdfx.Tpo -c gdfx.c -o gdfx.o >/dev/null 2>&1
>
> >>>> mv -f .deps/gdfx.Tpo .deps/gdfx.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_security.lo -MD -MP -MF
>
> >>>> .deps/gd_security.Tpo -c -o gd_security.lo gd_security.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT
>
> >>>> gd_security.lo
>
> >>>> -MD -MP -MF .deps/gd_security.Tpo -c gd_security.c -fno-common -DPIC
> -o
>
> >>>> .libs/gd_security.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT
>
> >>>> gd_security.lo
>
> >>>> -MD -MP -MF .deps/gd_security.Tpo -c gd_security.c -o gd_security.o
>
> >>>> >/dev/null 2>&1
>
> >>>> mv -f .deps/gd_security.Tpo .deps/gd_security.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo -MD -MP -MF
>
> >>>> .deps/gd_gd.Tpo -c -o gd_gd.lo gd_gd.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd_gd.Tpo -c gd_gd.c -fno-common -DPIC -o .libs/gd_gd.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd_gd.Tpo -c gd_gd.c -o gd_gd.o >/dev/null 2>&1
>
> >>>> mv -f .deps/gd_gd.Tpo .deps/gd_gd.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo -MD -MP -MF
>
> >>>> .deps/gd_gd2.Tpo -c -o gd_gd2.lo gd_gd2.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo
>
> >>>> -MD
>
> >>>> -MP -MF .deps/gd_gd2.Tpo -c gd_gd2.c -fno-common -DPIC -o
>
> >>>> .libs/gd_gd2.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo
>
> >>>> -MD
>
> >>>> -MP -MF .deps/gd_gd2.Tpo -c gd_gd2.c -o gd_gd2.o >/dev/null 2>&1
>
> >>>> mv -f .deps/gd_gd2.Tpo .deps/gd_gd2.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo -MD -MP -MF
>
> >>>> .deps/gd_io.Tpo -c -o gd_io.lo gd_io.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd_io.Tpo -c gd_io.c -fno-common -DPIC -o .libs/gd_io.o
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo
> -MD
>
> >>>> -MP
>
> >>>> -MF .deps/gd_io.Tpo -c gd_io.c -o gd_io.o >/dev/null 2>&1
>
> >>>> mv -f .deps/gd_io.Tpo .deps/gd_io.Plo
>
> >>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I.
>
> >>>> -I/usr/local/include/freetype2 -I/usr/local/include
>
> >>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_io_dp.lo -MD -MP -MF
>
> >>>> .deps/gd_io_dp.Tpo -c -o gd_io_dp.lo gd_io_dp.c
>
> >>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2
>
> >>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT
> gd_io_dp.lo
>
> >>>> -MD
>
> >>>> -MP -MF .deps/gd_io_dp.
>
> -------------- next part --------------
>
> An HTML attachment was scrubbed...
>
> ------------------------------
>
>
> ------------------------------------------------------------------------------
>
> Download Intel&#174; Parallel Studio Eval
>
> Try the new software tools for yourself. Speed compiling, find bugs
>
> proactively, and fine-tune applications for parallel performance.
>
> See why Intel Parallel Studio got high marks during beta.
>
> http://p.sf.net/sfu/intel-sw-dev
>
> ------------------------------
>
> _______________________________________________
>
> Gmod-gbrowse mailing list
>
> Gmod-gbrowse at lists.sourceforge.net
>
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
> End of Gmod-gbrowse Digest, Vol 47, Issue 25
>
> ********************************************
>
>
> ------------------------------------------------------------------------------
> Download Intel&#174; Parallel Studio Eval
> Try the new software tools for yourself. Speed compiling, find bugs
> proactively, and fine-tune applications for parallel performance.
> See why Intel Parallel Studio got high marks during beta.
> http://p.sf.net/sfu/intel-sw-dev
> _______________________________________________
> Gmod-gbrowse mailing list
> Gmod-gbrowse at lists.sourceforge.net
> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse
>
>


-- 
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa at oicr.on.ca>


From pjayaraman at mcw.edu  Wed Apr  7 17:05:35 2010
From: pjayaraman at mcw.edu (Jayaraman, Pushkala)
Date: Wed, 7 Apr 2010 16:05:35 -0500
Subject: [Bioperl-l] [Gmod-gbrowse] Gmod-gbrowse Digest, Vol 47, Issue 25
In-Reply-To: <t2r6dce9a0b1004071401y8c117a5pfcf47debfce776b1@mail.gmail.com>
References: <mailman.194535.1270670495.4911.gmod-gbrowse@lists.sourceforge.net>
	<1448A38A42714048B9C53E473E13CCF00306F603@davis.hmgc.mcw.edu>
	<t2r6dce9a0b1004071401y8c117a5pfcf47debfce776b1@mail.gmail.com>
Message-ID: <1448A38A42714048B9C53E473E13CCF00306F61F@davis.hmgc.mcw.edu>

No, 

I have a virtual OS (Red hat CENTOS ) running on my windows machine and hence I had to install everything from scratch. 

Pushkala

 

 

From: Lincoln Stein [mailto:lincoln.stein at gmail.com] 
Sent: Wednesday, April 07, 2010 4:01 PM
To: Jayaraman, Pushkala; BioPerl
Cc: gmod-gbrowse at lists.sourceforge.net
Subject: Re: [Gmod-gbrowse] Gmod-gbrowse Digest, Vol 47, Issue 25

 

It should not be necessary to install any of these prerequisites to get a successful CPAN install of BioPerl! Is this an issue on Snow Leopard?

 

Lincoln

2010/4/7 Jayaraman, Pushkala <pjayaraman at mcw.edu>

Hello, 

In response to the Bioperl installation using Cpan, I had to try it atleast 4 times to get a final successful installation. 

I guess some of the Pre requisite packages that cpan gets have not passed too many tests and if one of them fails, all of them fail. 

Here is a list of the packages that I had to install manually (some, I used a version just before the latest one..)first before running Bio Perl installation from Cpan. 

1.      Bundle??BioPerl(installed this first) then installed some of the root dependencies. 

2.      Ace

3.      XML??DOM2

4.      Bio??ASN1??Entrezgene 1.091 (this gave me lots of trouble!)

5.      XML??Parser 2.36

6.      SOAP??Lite

7.      XML??Twig (this one also kept failing)

8.      LibXML??Perl (another trouble maker)

9.      XML??DOM 1.44

10.     XML??DOM??XPATH 0.14

11.     BioPerl 1.61 using CPAN

 Hope this helps!

Pushkala

 

-----Original Message-----
From: gmod-gbrowse-request at lists.sourceforge.net [mailto:gmod-gbrowse-request at lists.sourceforge.net]
Sent: Wednesday, April 07, 2010 3:02 PM
To: gmod-gbrowse at lists.sourceforge.net
Subject: Gmod-gbrowse Digest, Vol 47, Issue 25

Send Gmod-gbrowse mailing list submissions to

        gmod-gbrowse at lists.sourceforge.net

To subscribe or unsubscribe via the World Wide Web, visit

        https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

or, via email, send a message with subject or body 'help' to

        gmod-gbrowse-request at lists.sourceforge.net

You can reach the person managing the list at

        gmod-gbrowse-owner at lists.sourceforge.net

When replying, please edit your Subject line so it is more specific

than "Re: Contents of Gmod-gbrowse digest..."

 

Today's Topics:

   1. libgd installers for Mac OS X 10.5 and 10.6 (Scott Cain)

   2. Re: Installation Problem (Halian)

   3. Re: Installation Problem (Scott Cain)

   4. Re: Installation Problem (Chris Fields)

   5. Re: Snow Leopard installation issues (James M. Nolan)

 

----------------------------------------------------------------------

Message: 1

Date: Wed, 7 Apr 2010 14:35:28 -0400

From: Scott Cain <scott at scottcain.net>

Subject: [Gmod-gbrowse] libgd installers for Mac OS X 10.5 and 10.6

To: "Gbrowse (E-mail)" <gmod-gbrowse at lists.sourceforge.net>

Message-ID:

        <z2o4536f7701004071135q6d622265hd80ad83c5388f3bd at mail.gmail.com>

Content-Type: text/plain; charset=ISO-8859-1

Hello,

I've taken a foray into creating double click installers (pkg files)

for libgd for Mac OS X Leopard and Snow Leopard.  As this is a first

attempt, they may still be a little rough, but in my hands they seem

to do what they are supposed to do.  I put them on sourceforge if

anyone would like to try them out.

Leopard:

https://sourceforge.net/projects/gmod/files/Generic%20Genome%20Browser/libgd-MacOSX/20100406/gmod%20libgd%20Leopard.pkg/download

Snow Leopard:

https://sourceforge.net/projects/gmod/files/Generic%20Genome%20Browser/libgd-MacOSX/20100406/gmod%20libgd%20Snow%20Leopard.pkg/download

 

Scott

-- 

------------------------------------------------------------------------

Scott Cain, Ph. D.                                   scott at scottcain dot net

GMOD Coordinator (http://gmod.org/)                     216-392-3087

Ontario Institute for Cancer Research

 

------------------------------

Message: 2

Date: Wed, 7 Apr 2010 18:44:57 +0000 (UTC)

From: Halian <halianlian at gmail.com>

Subject: Re: [Gmod-gbrowse] Installation Problem

To: gmod-gbrowse at lists.sourceforge.net

Message-ID: <loom.20100407T204343-410 at post.gmane.org>

Content-Type: text/plain; charset=us-ascii

 

Scott, trying to install Bio::Root::Version using this command:

perl -MCPAN -e 'install Bio::Root::Version'

I get this message, and then the installation dies:

 

Test Summary Report

-------------------

t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)

  Failed test:  2

  Non-zero exit status: 255

  Parse errors: Bad plan.  You planned 52 tests but ran 3.

Files=2, Tests=13,  3 wallclock secs ( 0.08 usr  0.02 sys +  1.46 cusr  0.18

csys =  1.74 CPU)

Result: FAIL

Failed 1/2 test programs. 1/13 subtests failed.

  LDS/Bio-Graphics-2.02.tar.gz

  ./Build test -- NOT OK

//hint// to see the cpan-testers results for installing this module, try:

  reports LDS/Bio-Graphics-2.02.tar.gz

Running Build install

  make test had returned bad status, won't install without force

Running install for module 'Bio::Root::Version'

Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz

  Has already been unwrapped into directory /root/.cpan/build/BioPerl-1.6.1-gppvM8

  Has already been made

Running Build test

  Has already been tested within this command

Running Build install

  make test had returned bad status, won't install without force







------------------------------

Message: 3

Date: Wed, 7 Apr 2010 15:06:04 -0400

From: Scott Cain <scott at scottcain.net>

Subject: Re: [Gmod-gbrowse] Installation Problem

To: Halian <halianlian at gmail.com>

Cc: gmod-gbrowse at lists.sourceforge.net

Message-ID:

        <q2m4536f7701004071206t5954d4a7x16b683826a6d90bf at mail.gmail.com>

Content-Type: text/plain; charset=ISO-8859-1

Well, shoot, that's not terribly informative: since the tests already

failed for BioPerl, it's not telling us what tests failed.  Can you

try installing BioPerl on the command line?  You can either go into

the .cpan/build directory and do it there, or get a fresh tarball from

bioperl.org:

  http://bioperl.org/DIST/BioPerl-1.6.1.tar.gz

and then do

  perl Build.PL

  ./Build

  ./Build test

  (sudo) ./Build install

and let us know how that goes.  After BioPerl is installed,

Bio::Graphics should install, assuming you already have libgd.

Scott

 

On Wed, Apr 7, 2010 at 2:44 PM, Halian <halianlian at gmail.com> wrote:

> 

> 

> Scott, trying to install Bio::Root::Version using this command:

> 

> perl -MCPAN -e 'install Bio::Root::Version'

> 

> I get this message, and then the installation dies:

> 

> 

> Test Summary Report

> -------------------

> t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)

> ?Failed test: ?2

> ?Non-zero exit status: 255

> ?Parse errors: Bad plan. ?You planned 52 tests but ran 3.

> Files=2, Tests=13, ?3 wallclock secs ( 0.08 usr ?0.02 sys + ?1.46 cusr ?0.18

> csys = ?1.74 CPU)

> Result: FAIL

> Failed 1/2 test programs. 1/13 subtests failed.

> ?LDS/Bio-Graphics-2.02.tar.gz

> ?./Build test -- NOT OK

> //hint// to see the cpan-testers results for installing this module, try:

> ?reports LDS/Bio-Graphics-2.02.tar.gz

> Running Build install

> ?make test had returned bad status, won't install without force

> Running install for module 'Bio::Root::Version'

> Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz

> ?Has already been unwrapped into directory /root/.cpan/build/BioPerl-1.6.1-gppvM8

> ?Has already been made

> Running Build test

> ?Has already been tested within this command

> Running Build install

> ?make test had returned bad status, won't install without force

> 

> 

> 

> 

> ------------------------------------------------------------------------------

> Download Intel&#174; Parallel Studio Eval

> Try the new software tools for yourself. Speed compiling, find bugs

> proactively, and fine-tune applications for parallel performance.

> See why Intel Parallel Studio got high marks during beta.

> http://p.sf.net/sfu/intel-sw-dev

> _______________________________________________

> Gmod-gbrowse mailing list

> Gmod-gbrowse at lists.sourceforge.net

> https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

> 

 

-- 

------------------------------------------------------------------------

Scott Cain, Ph. D.                                   scott at scottcain dot net

GMOD Coordinator (http://gmod.org/)                     216-392-3087

Ontario Institute for Cancer Research

 

------------------------------

Message: 4

Date: Wed, 07 Apr 2010 14:19:42 -0500

From: Chris Fields <cjfields at illinois.edu>

Subject: Re: [Gmod-gbrowse] Installation Problem

To: Scott Cain <scott at scottcain.net>

Cc: Halian <halianlian at gmail.com>, gmod-gbrowse at lists.sourceforge.net

Message-ID: <1270667982.18964.6.camel at pyrimidine.igb.uiuc.edu>

Content-Type: text/plain; charset="UTF-8"

Scott,

What is the specific failure on BioPerl-1.6.1?  Do we need to push out a

new point release soon?

chris

On Wed, 2010-04-07 at 15:06 -0400, Scott Cain wrote:

> Well, shoot, that's not terribly informative: since the tests already

> failed for BioPerl, it's not telling us what tests failed.  Can you

> try installing BioPerl on the command line?  You can either go into

> the .cpan/build directory and do it there, or get a fresh tarball from

> bioperl.org:

> 

>   http://bioperl.org/DIST/BioPerl-1.6.1.tar.gz

> 

> and then do

> 

>   perl Build.PL

>   ./Build

>   ./Build test

>   (sudo) ./Build install

> 

> and let us know how that goes.  After BioPerl is installed,

> Bio::Graphics should install, assuming you already have libgd.

> 

> Scott

> 

> 

> On Wed, Apr 7, 2010 at 2:44 PM, Halian <halianlian at gmail.com> wrote:

> >

> >

> > Scott, trying to install Bio::Root::Version using this command:

> >

> > perl -MCPAN -e 'install Bio::Root::Version'

> >

> > I get this message, and then the installation dies:

> >

> >

> > Test Summary Report

> > -------------------

> > t/BioGraphics.t (Wstat: 65280 Tests: 3 Failed: 1)

> >  Failed test:  2

> >  Non-zero exit status: 255

> >  Parse errors: Bad plan.  You planned 52 tests but ran 3.

> > Files=2, Tests=13,  3 wallclock secs ( 0.08 usr  0.02 sys +  1.46 cusr  0.18

> > csys =  1.74 CPU)

> > Result: FAIL

> > Failed 1/2 test programs. 1/13 subtests failed.

> >  LDS/Bio-Graphics-2.02.tar.gz

> >  ./Build test -- NOT OK

> > //hint// to see the cpan-testers results for installing this module, try:

> >  reports LDS/Bio-Graphics-2.02.tar.gz

> > Running Build install

> >  make test had returned bad status, won't install without force

> > Running install for module 'Bio::Root::Version'

> > Running Build for C/CJ/CJFIELDS/BioPerl-1.6.1.tar.gz

> >  Has already been unwrapped into directory /root/.cpan/build/BioPerl-1.6.1-gppvM8

> >  Has already been made

> > Running Build test

> >  Has already been tested within this command

> > Running Build install

> >  make test had returned bad status, won't install without force

> >

> >

> >

> >

> > ------------------------------------------------------------------------------

> > Download Intel&#174; Parallel Studio Eval

> > Try the new software tools for yourself. Speed compiling, find bugs

> > proactively, and fine-tune applications for parallel performance.

> > See why Intel Parallel Studio got high marks during beta.

> > http://p.sf.net/sfu/intel-sw-dev

> > _______________________________________________

> > Gmod-gbrowse mailing list

> > Gmod-gbrowse at lists.sourceforge.net

> > https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

> >

> 

> 

> 






------------------------------

Message: 5

Date: Wed, 7 Apr 2010 15:47:55 -0400 (EDT)

From: "James M. Nolan" <jnolan at ggc.edu>

Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues

To: Scott Cain <scott at scottcain.net>

Cc: "Gbrowse \(E-mail\)" <gmod-gbrowse at lists.sourceforge.net>

Message-ID:

        <543850330.392212.1270669675992.JavaMail.root at zmail1.ggc.edu>

Content-Type: text/plain; charset="utf-8"

 

Hi Scott, 

Thanks for the package, but it looks like I am still having problems. I removed my php directories, so I think I am not having conflicts there. I was having trouble with getting the fink /sw directories out of my paths, but got that fixed after altering .cshrc and restarting the Terminal.app I noticed the architecture errors and noticed the env was not set as Lincoln had said so I used the provided fix, I did make uninstall for GD.pm and tried again, but I still get architecture errors when I try to install GD manually from source. In cpan it says "GD is up to date (2.44)." 

 

I am thinking I need to format and start all over with clean Snow Leopard and see if the suggested fixes work from there. Any suggestions on the order which to do things are welcome. My output from env and installation attempts below. 

 

Thanks again, 

Jim 

 

PATH=/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/X11/bin 

TMPDIR=/var/folders/kW/kW+4EXfs2RahNU+1YxaEY++++TQ/-Tmp-/ 

SHELL=/bin/tcsh 

HOME=/Users/jnolan 

USER=jnolan 

LOGNAME=jnolan 

DISPLAY=/tmp/launch-K05jvu/org.x:0 

SSH_AUTH_SOCK=/tmp/launch-fn7sGB/Listeners 

Apple_PubSub_Socket_Render=/tmp/launch-VaqsGP/Render 

COMMAND_MODE=unix2003 

__CF_USER_TEXT_ENCODING=0x1F7:0:0 

TERM_PROGRAM=Apple_Terminal 

TERM_PROGRAM_VERSION=273 

LANG=en_US.UTF-8 

TERM=xterm-color 

HOSTTYPE=intel-mac 

VENDOR=apple 

OSTYPE=darwin 

MACHTYPE=x86_64 

SHLVL=1 

PWD=/Users/jnolan/Desktop/server/GD-2.44 

GROUP=staff 

HOST=host-9-116.clb-b2.ggc.usg.edu 

REMOTEHOST= 

STADENROOT=/usr/ebiotools/bin 

VERSIONER_PERL_PREFER_32_BIT=yes 

VERSIONER_PERL_VERSION=5.8.9 








[host-9-116:~/Desktop/server/GD-2.44] jnolan% make clean 

rm -f \ 

*.a core \ 

core.[0-9] blib/arch/auto/GD/extralibs.all \ 

core.[0-9][0-9] GD.bso \ 

pm_to_blib.ts core.[0-9][0-9][0-9][0-9] \ 

GD.x GD.bs \ 

perl tmon.out \ 

*.o pm_to_blib \ 

blib/arch/auto/GD/extralibs.ld blibdirs.ts \ 

core.[0-9][0-9][0-9][0-9][0-9] *perl.core \ 

core.*perl.*.? Makefile.aperl \ 

perl GD.def \ 

core.[0-9][0-9][0-9] mon.out \ 

libGD.def perlmain.c \ 

perl.exe so_locations \ 

GD.exp GD.c 

rm -rf \ 

blib 

mv Makefile Makefile.old > /dev/null 2>&1 

[host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PLNotice: Type perl Makefile.PL -h for command-line option summary. 

 

Configuring for libgd version 2.0.36. 

Checking for stray libgd header files...none found. 

 

Included Features: GD_PNG GD_GIF GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY GD_ANIMGIF GD_FTCIRCLE VERSION_33 

GD library used from: /usr 

Checking if your kit is complete... 

Looks good 

Writing Makefile for GD 

[host-9-116:~/Desktop/server/GD-2.44] jnolan% make/usr/bin/perl GD/Image.pm.PLS GD/Image.pm 

Extracting Image.pm (with variable substitutions) 

cp GD/Polyline.pm blib/lib/GD/Polyline.pm 

cp qd.pl blib/lib/qd.pl 

cp GD/Image.pm blib/lib/GD/Image.pm 

cp GD.pm blib/lib/GD.pm 

AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD) 

cp GD/Simple.pm blib/lib/GD/Simple.pm 

cp GD/Polygon.pm blib/lib/GD/Polygon.pm 

cp GD/Group.pm blib/lib/GD/Group.pm 

/usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs > GD.xsc && mv GD.xsc GD.c 

gcc-4.2 -c -I/usr/include -Wformat=0 -Os -DVERSION=\"2.44\" -DXS_VERSION=\"2.44\" "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE" -DHAVE_FT -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33 -DHAVE_UNCLOSEDPOLY -DHAVE_FTCIRCLE GD.c 

GD.xs: In function ?XS_GD__Image_STORABLE_thaw?: 

GD.xs:923: warning: cast from pointer to integer of different size 

Running Mkbootstrap for GD () 

chmod 644 GD.bs 

rm -f blib/arch/auto/GD/GD.bundle 

LD_RUN_PATH="/usr/lib" gcc-4.2 -mmacosx-version-min=10.6 -arch i386 -arch ppc -bundle -undefined dynamic_lookup -L/usr/local/lib GD.o -o blib/arch/auto/GD/GD.bundle \ 

-L/usr/lib -lpng -lz -liconv -lgd \ 

ld: warning: in GD.o, file is not of required architecture 

ld: warning: in /usr/local/lib/libpng.dylib, file is not of required architecture 

ld: warning: in /usr/lib/libgd.dylib, file is not of required architecture 

ld: warning: in GD.o, file is not of required architecture 

ld: warning: in /usr/local/lib/libpng.dylib, file is not of required architecture 

ld: warning: in /usr/lib/libgd.dylib, file is not of required architecture 

chmod 755 blib/arch/auto/GD/GD.bundle 

cp GD.bs blib/arch/auto/GD/GD.bs 

chmod 644 blib/arch/auto/GD/GD.bs 

/usr/bin/perl "-Iblib/arch" "-Iblib/lib" bdf_scripts/bdf2gdfont.PLS bdf_scripts/bdf2gdfont.pl 

Extracting bdf2gdfont.pl (with variable substitutions) 

cp bdf_scripts/bdf2gdfont.pl blib/script/bdf2gdfont.pl 

/usr/bin/perl "-MExtUtils::MY" -e "MY->fixin(shift)" blib/script/bdf2gdfont.pl 

Manifying blib/man1/bdf2gdfont.pl.1 

Manifying blib/man3/GD::Polyline.3pm 

Manifying blib/man3/GD::Image.3pm 

Manifying blib/man3/GD::Simple.3pm 

Manifying blib/man3/GD.3pm 

Manifying blib/man3/GD::Polygon.3pm 

[host-9-116:~/Desktop/server/GD-2.44] jnolan% make test PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t 

t/GD.t ........ Can't find 'boot_GD' symbol in ./blib/arch/auto/GD/GD.bundle 

at t/GD.t line 14 

Compilation failed in require at t/GD.t line 14. 

BEGIN failed--compilation aborted at t/GD.t line 14. 

t/GD.t ........ Dubious, test returned 2 (wstat 512, 0x200) 

Failed 12/12 subtests 

t/Polyline.t .. Can't find 'boot_GD' symbol in /Users/jnolan/Desktop/server/GD-2.44/blib/arch/auto/GD/GD.bundle 

at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45 

Compilation failed in require at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45. 

BEGIN failed--compilation aborted at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45. 

Compilation failed in require at t/Polyline.t line 10. 

BEGIN failed--compilation aborted at t/Polyline.t line 10. 

t/Polyline.t .. Dubious, test returned 2 (wstat 512, 0x200) 

Failed 1/1 subtests 

 

Test Summary Report 

------------------- 

t/GD.t (Wstat: 512 Tests: 1 Failed: 1) 

Failed test: 1 

Non-zero exit status: 2 

Parse errors: Bad plan. You planned 12 tests but ran 1. 

t/Polyline.t (Wstat: 512 Tests: 0 Failed: 0) 

Non-zero exit status: 2 

Parse errors: Bad plan. You planned 1 tests but ran 0. 

Files=2, Tests=1, 0 wallclock secs ( 0.02 usr 0.01 sys + 0.07 cusr 0.02 csys = 0.12 CPU) 

Result: FAIL 

Failed 2/2 test programs. 1/1 subtests failed. 

make: *** [test_dynamic] Error 2 

----- Original Message ----- 

From: "Scott Cain" <scott at scottcain.net> 

To: "James M. Nolan" <jnolan at ggc.edu> 

Cc: "Gavin Sherlock" <sherlock at genome.stanford.edu>, "Gbrowse (E-mail)" <gmod-gbrowse at lists.sourceforge.net>, "Lincoln Stein" <lincoln.stein at gmail.com> 

Sent: Tuesday, April 6, 2010 11:53:08 AM 

Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues 

Hi James, 

Attached is my first crack at a libgd installer for Snow Leopard. I 

tested it on my mac mini that is running Snow Leopard, but it isn't a 

good test, since I already had a working copy of libgd on the machine. 

I would have liked to test it on a "virgin" system, but I don't have 

one at the moment, so if you'd like to be a guinea pig, have at it. 

After you run this installer, you should be able to install GD from 

the cpan shell. Let us know how it goes. 

Scott 

 

On Fri, Apr 2, 2010 at 3:02 PM, James M. Nolan <jnolan at ggc.edu> wrote: 

> Just my style! Thanks! 

> Jim 

> ----- Original Message ----- 

> From: "Scott Cain" <scott at scottcain.net> 

> To: "Lincoln Stein" <lincoln.stein at gmail.com> 

> Cc: "James M. Nolan" <jnolan at ggc.edu>, "Gavin Sherlock" 

> <sherlock at genome.stanford.edu>, "Gbrowse (E-mail)" 

> <gmod-gbrowse at lists.sourceforge.net> 

> Sent: Friday, April 2, 2010 12:46:34 PM GMT -05:00 US/Canada Eastern 

> Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues 

> 

> Hi Lincoln, 

> 

> I've been reading about building "flat packages" for Mac OS X, which 

> is a form of double click installer. It should be fairly simple and 

> I'll see if I can have one ready for installing libgd next week. 

> 

> Scott 

> 

> 

> On Thu, Apr 1, 2010 at 4:31 PM, Lincoln Stein <lincoln.stein at gmail.com> 

> wrote: 

>> Hi James, 

>> It might be better to track down and destroy all copies php, php5, libgd 

>> and 

>> gd.h, then reinstall libgd so that there is one and only one true copy, 

>> and 

>> install GD.so. 

>> Alternatively, why doesn't someone on the mailing list who has GD already 

>> installed just bundle up the binary lib files and mail it to James? I 

>> think 

>> he has been tortured enough. It would be sufficient to send him 

>> libgd.bundle 

>> from the system lib directory and the contents of the "blib" directory of 

>> the built GD distribution. 

>> Lincoln 

>> 

>> On Thu, Apr 1, 2010 at 3:51 PM, James M. Nolan <jnolan at ggc.edu> wrote: 

>>> 

>>> Found it, twice! but not on the path. It got installed with php. I had 

>>> installed it because earlier installation instructions for gbrowse had 

>>> suggested it I think: 

>>> /usr/include/php/ext/gd/libgd/gd.h 

>>> /usr/local/php5/include/php/ext/gd/libgd/gd.h 

>>> I don't know how I got two versions of php installed, but the active one 

>>> seems to be in /usr/local/php/bin and includes installation of libgd 

>>> 2.0.34. 

>>> Should I delete all of both of these php installations, and if I need to 

>>> reinstall php, will it nuke the gd 2.0.36? 

>>> 

>>> I went ahead and tried installing libgd 2.0.36RC1.29 using 

>>> --without-fontconfig during configure and it installed 

>>> I then tried installing GD-2.44 and it failed as below. Please let me 

>>> know 

>>> whether I need to delete all of the php installation before I proceed. It 

>>> doesn't have an uninstaller, so I don't want to delete something I 

>>> shouldn't 

>>> Thanks 

>>> Jim 

>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PL 

>>> Notice: Type perl Makefile.PL -h for command-line option summary. 

>>> Configuring for libgd version 2.0.36. 

>>> Checking for stray libgd header files...none found. 

>>> Included Features: GD_XPM GD_JPEG GD_FREETYPE GD_PNG GD_GIF 

>>> GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY GD_ANIMGIF GD_FTCIRCLE 

>>> VERSION_33 

>>> GD library used from: /usr/local 

>>> Checking if your kit is complete... 

>>> Looks good 

>>> Writing Makefile for GD 

>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make 

>>> /usr/bin/perl GD/Image.pm.PLS GD/Image.pm 

>>> Extracting Image.pm (with variable substitutions) 

>>> cp GD/Polyline.pm blib/lib/GD/Polyline.pm 

>>> cp qd.pl blib/lib/qd.pl 

>>> cp GD/Image.pm blib/lib/GD/Image.pm 

>>> cp GD.pm blib/lib/GD.pm 

>>> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD) 

>>> cp GD/Simple.pm blib/lib/GD/Simple.pm 

>>> cp GD/Polygon.pm blib/lib/GD/Polygon.pm 

>>> cp GD/Group.pm blib/lib/GD/Group.pm 

>>> /usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap 

>>> /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs > 

>>> GD.xsc 

>>> && mv GD.xsc GD.c 

>>> gcc-4.2 -c -I/usr/local/include -Wformat=0 -Os -DVERSION=\"2.44\" 

>>> -DXS_VERSION=\"2.44\" 

>>> "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE" 

>>> -DHAVE_JPEG 

>>> -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33 

>>> -DHAVE_UNCLOSEDPOLY -DHAVE_FTCIRCLE GD.c 

>>> GD.xs: In function ?XS_GD__Image_STORABLE_thaw?: 

>>> GD.xs:923: warning: cast from pointer to integer of different size 

>>> Running Mkbootstrap for GD () 

>>> chmod 644 GD.bs 

>>> rm -f blib/arch/auto/GD/GD.bundle 

>>> LD_RUN_PATH="/usr/X11/lib:/usr/local/lib:/usr/lib" gcc-4.2 

>>> -mmacosx-version-min=10.6 -arch i386 -arch ppc -bundle -undefined 

>>> dynamic_lookup -L/usr/local/lib GD.o -o blib/arch/auto/GD/GD.bundle \ 

>>> -L/usr/local/lib -L/usr/X11/lib -L/usr/local/lib -lXpm -lX11 -ljpeg 

>>> -lfreetype -lpng12 -lz -liconv -lgd \ 

>>> 

>>> ld: warning: in GD.o, file is not of required architecture 

>>> ld: warning: in /usr/local/lib/libjpeg.dylib, file is not of required 

>>> architecture 

>>> ld: warning: in /usr/local/lib/libfreetype.dylib, file is not of required 

>>> architecture 

>>> ld: warning: in /usr/local/lib/libgd.dylib, file is not of required 

>>> architecture 

>>> ld: warning: in GD.o, file is not of required architecture 

>>> ld: warning: in /usr/local/lib/libjpeg.dylib, file is not of required 

>>> architecture 

>>> ld: warning: in /usr/local/lib/libfreetype.dylib, file is not of required 

>>> architecture 

>>> ld: warning: in /usr/local/lib/libgd.dylib, file is not of required 

>>> architecture 

>>> chmod 755 blib/arch/auto/GD/GD.bundle 

>>> cp GD.bs blib/arch/auto/GD/GD.bs 

>>> chmod 644 blib/arch/auto/GD/GD.bs 

>>> /usr/bin/perl "-Iblib/arch" "-Iblib/lib" bdf_scripts/bdf2gdfont.PLS 

>>> bdf_scripts/bdf2gdfont.pl 

>>> Extracting bdf2gdfont.pl (with variable substitutions) 

>>> cp bdf_scripts/bdf2gdfont.pl blib/script/bdf2gdfont.pl 

>>> /usr/bin/perl "-MExtUtils::MY" -e "MY->fixin(shift)" 

>>> blib/script/bdf2gdfont.pl 

>>> Manifying blib/man1/bdf2gdfont.pl.1 

>>> Manifying blib/man3/GD::Polyline.3pm 

>>> Manifying blib/man3/GD::Image.3pm 

>>> Manifying blib/man3/GD::Simple.3pm 

>>> Manifying blib/man3/GD.3pm 

>>> Manifying blib/man3/GD::Polygon.3pm 

>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make test 

>>> PERL_DL_NONLAZY=1 /usr/bin/perl "-MExtUtils::Command::MM" "-e" 

>>> "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t 

>>> t/GD.t ........ Can't find 'boot_GD' symbol in 

>>> ./blib/arch/auto/GD/GD.bundle 

>>> at t/GD.t line 14 

>>> Compilation failed in require at t/GD.t line 14. 

>>> BEGIN failed--compilation aborted at t/GD.t line 14. 

>>> t/GD.t ........ Dubious, test returned 2 (wstat 512, 0x200) 

>>> Failed 12/12 subtests 

>>> t/Polyline.t .. Can't find 'boot_GD' symbol in 

>>> /Users/jnolan/Desktop/server/GD-2.44/blib/arch/auto/GD/GD.bundle 

>>> at /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45 

>>> Compilation failed in require at 

>>> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45. 

>>> BEGIN failed--compilation aborted at 

>>> /Users/jnolan/Desktop/server/GD-2.44/blib/lib/GD/Polyline.pm line 45. 

>>> Compilation failed in require at t/Polyline.t line 10. 

>>> BEGIN failed--compilation aborted at t/Polyline.t line 10. 

>>> t/Polyline.t .. Dubious, test returned 2 (wstat 512, 0x200) 

>>> Failed 1/1 subtests 

>>> Test Summary Report 

>>> ------------------- 

>>> t/GD.t (Wstat: 512 Tests: 1 Failed: 1) 

>>> Failed test: 1 

>>> Non-zero exit status: 2 

>>> Parse errors: Bad plan. You planned 12 tests but ran 1. 

>>> t/Polyline.t (Wstat: 512 Tests: 0 Failed: 0) 

>>> Non-zero exit status: 2 

>>> Parse errors: Bad plan. You planned 1 tests but ran 0. 

>>> Files=2, Tests=1, 0 wallclock secs ( 0.03 usr 0.01 sys + 0.07 cusr 

>>> 0.02 csys = 0.13 CPU) 

>>> Result: FAIL 

>>> Failed 2/2 test programs. 1/1 subtests failed. 

>>> make: *** [test_dynamic] Error 2 

>>> 

>>> ----- Original Message ----- 

>>> From: "Lincoln Stein" <lincoln.stein at gmail.com> 

>>> To: "James M. Nolan" <jnolan at ggc.edu> 

>>> Cc: "Gavin Sherlock" <sherlock at genome.stanford.edu>, "Gbrowse (E-mail)" 

>>> <gmod-gbrowse at lists.sourceforge.net>, "Scott Cain" <scott at scottcain.net> 

>>> Sent: Thursday, April 1, 2010 1:52:21 PM 

>>> Subject: Re: [Gmod-gbrowse] Snow Leopard installation issues 

>>> 

>>> These errors are saying that the gd.h header file can no longer be found 

>>> in the default search path. Is it there at all? 

>>> Lincoln 

>>> 

>>> On Thu, Apr 1, 2010 at 12:53 PM, James M. Nolan <jnolan at ggc.edu> wrote: 

>>>> 

>>>> I had gd 2.0.36RC1 but I don't think it was RC1.29, more on that at the 

>>>> bottom of message (see "-------Begin libgd attempt" ). 

>>>> I first tried removing the fink path from .cshrc and checked in a new 

>>>> window that the path was corrected. Installing GD.pm gave the following 

>>>> output with errors; I did not force. 

>>>> When it failed, I then tried uninstalling libgd and installing the 

>>>> latest 

>>>> iteration of 2.0.36. 

>>>> And my test of gd with php still works, but now that I uninstalled libgd 

>>>> the gdlib-config --version command is no longer found. I am mystified. 

>>>> Thanks 

>>>> Jim 

>>>> -----GD.pm installation 

>>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% perl Makefile.PL 

>>>> Notice: Type perl Makefile.PL -h for command-line option summary. 

>>>> Configuring for libgd version 2.0.36. 

>>>> Checking for stray libgd header files...none found. 

>>>> Included Features: GD_XPM GD_JPEG GD_FONTCONFIG GD_FREETYPE 

>>>> GD_PNG GD_GIF GD_GIFANIM GD_OPENPOLYGON GD_UNCLOSEDPOLY GD_ANIMGIF 

>>>> GD_FTCIRCLE VERSION_33 

>>>> GD library used from: /usr/local 

>>>> Checking if your kit is complete... 

>>>> Looks good 

>>>> Note (probably harmless): No library found for -lgd 

>>>> Writing Makefile for GD 

>>>> [host-9-116:~/Desktop/server/GD-2.44] jnolan% make 

>>>> /usr/bin/perl GD/Image.pm.PLS GD/Image.pm 

>>>> Extracting Image.pm (with variable substitutions) 

>>>> cp GD/Polyline.pm blib/lib/GD/Polyline.pm 

>>>> cp qd.pl blib/lib/qd.pl 

>>>> cp GD/Image.pm blib/lib/GD/Image.pm 

>>>> cp GD.pm blib/lib/GD.pm 

>>>> AutoSplitting blib/lib/GD.pm (blib/lib/auto/GD) 

>>>> cp GD/Simple.pm blib/lib/GD/Simple.pm 

>>>> cp GD/Polygon.pm blib/lib/GD/Polygon.pm 

>>>> cp GD/Group.pm blib/lib/GD/Group.pm 

>>>> /usr/bin/perl /System/Library/Perl/5.8.9/ExtUtils/xsubpp -typemap 

>>>> /System/Library/Perl/5.8.9/ExtUtils/typemap -typemap typemap GD.xs > 

>>>> GD.xsc 

>>>> && mv GD.xsc GD.c 

>>>> gcc-4.2 -c -I/usr/local/include -Wformat=0 -Os -DVERSION=\"2.44\" 

>>>> -DXS_VERSION=\"2.44\" 

>>>> "-I/System/Library/Perl/5.8.9/darwin-thread-multi-2level/CORE" 

>>>> -DHAVE_JPEG 

>>>> -DHAVE_FT -DHAVE_XPM -DHAVE_GIF -DHAVE_PNG -DHAVE_ANIMGIF -DVERSION_33 

>>>> -DHAVE_UNCLOSEDPOLY -DHAVE_FONTCONFIG -DHAVE_FTCIRCLE GD.c 

>>>> GD.xs:7:16: error: gd.h: No such file or directory 

>>>> GD.xs:8:21: error: gdfontg.h: No such file or directory 

>>>> GD.xs:9:21: error: gdfontl.h: No such file or directory 

>>>> GD.xs:10:22: error: gdfontmb.h: No such file or directory 

>>>> GD.xs:11:21: error: gdfonts.h: No such file or directory 

>>>> GD.xs:12:21: error: gdfontt.h: No such file or directory 

>>>> GD.xs:340: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__? 

>>>> before 

>>>> ?GD__Image? 

>>>> GD.xs:341: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__? 

>>>> before 

>>>> ?GD__Font? 

>>>> GD.xs:383: error: expected specifier-qualifier-list before ?gdIOCtx? 

>>>> GD.xs:391: error: expected ?)? before ?ctx? 

>>>> GD.xs:398: error: expected ?)? before ?ctx? 

>>>> GD.xs:414: error: expected ?)? before ?ctx? 

>>>> GD.xs:422: error: expected ?)? before ?ctx? 

>>>> GD.xs:427: error: expected ?)? before ?ctx? 

>>>> GD.xs:431: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__? 

>>>> before 

>>>> ?*? token 

>>>> GD.xs:452: error: expected ?=?, ?,?, ?;?, ?asm? or ?__attribute__? 

>>>> before 

>>>> ?gd_cloneDim? 

>>>> GD.xs:476: error: expected ?)? before ?src? 

>>>> GD.xs:505: error: expected ?)? before ?image? 

>>>> GD.c: In function ?XS_GD__Image__new?: 

>>>> GD.c:633: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:633: error: (Each undeclared identifier is reported only once 

>>>> GD.c:633: error: for each function it appears in.) 

>>>> GD.c:633: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:588: error: ?gdImagePtr? undeclared (first use in this function) 

>>>> GD.xs:588: error: expected ?;? before ?theImage? 

>>>> GD.xs:592: error: ?theImage? undeclared (first use in this function) 

>>>> GD.xs:592: error: expected ?;? before ?gdImageCreateTrueColor? 

>>>> GD.xs:594: error: expected ?;? before ?gdImageCreate? 

>>>> GD.xs:596: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromPng?: 

>>>> GD.c:697: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:697: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:615: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:615: error: expected ?;? before ?gdImageCreateFromPng? 

>>>> GD.xs: In function ?XS_GD__Image_newFromPngData?: 

>>>> GD.xs:627: error: ?gdIOCtx? undeclared (first use in this function) 

>>>> GD.xs:627: error: ?ctx? undeclared (first use in this function) 

>>>> GD.c:741: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:741: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:639: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:639: error: expected ?;? before ?gdImageCreateFromPngCtx? 

>>>> GD.c: In function ?XS_GD__Image_newFromGdData?: 

>>>> GD.c:782: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:782: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:658: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:658: error: expected ?;? before ?gdImageCreateFromGdPtr? 

>>>> GD.c: In function ?XS_GD__Image_newFromGd2Data?: 

>>>> GD.c:818: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:818: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:672: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:672: error: expected ?;? before ?gdImageCreateFromGd2Ptr? 

>>>> GD.xs: In function ?XS_GD__Image_newFromJpegData?: 

>>>> GD.xs:683: error: ?gdIOCtx? undeclared (first use in this function) 

>>>> GD.xs:683: error: ?ctx? undeclared (first use in this function) 

>>>> GD.c:864: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:864: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:695: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:695: error: expected ?;? before ?gdImageCreateFromJpegCtx? 

>>>> GD.xs: In function ?XS_GD__Image_newFromWBMPData?: 

>>>> GD.xs:710: error: ?gdIOCtx? undeclared (first use in this function) 

>>>> GD.xs:710: error: ?ctx? undeclared (first use in this function) 

>>>> GD.c:912: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:912: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:722: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:722: error: expected ?;? before ?gdImageCreateFromWBMPCtx? 

>>>> GD.c: In function ?XS_GD__Image__newFromXbm?: 

>>>> GD.c:948: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:948: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:735: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromGd?: 

>>>> GD.c:979: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:979: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:745: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromGd2?: 

>>>> GD.c:1010: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1010: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:755: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromJpeg?: 

>>>> GD.c:1052: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1052: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:773: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs: In function ?XS_GD__Image__newFromWBMP?: 

>>>> GD.xs:787: error: ?gdImagePtr? undeclared (first use in this function) 

>>>> GD.xs:787: error: expected ?;? before ?img? 

>>>> GD.c:1090: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1090: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:790: error: ?img? undeclared (first use in this function) 

>>>> GD.xs:797: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs: In function ?XS_GD__Image_newFromXpm?: 

>>>> GD.xs:807: error: ?gdImagePtr? undeclared (first use in this function) 

>>>> GD.xs:807: error: expected ?;? before ?img? 

>>>> GD.c:1132: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1132: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:811: error: ?img? undeclared (first use in this function) 

>>>> GD.xs:811: error: expected ?;? before ?gdImageCreateFromXpm? 

>>>> GD.xs:818: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromGd2Part?: 

>>>> GD.c:1180: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1180: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:837: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image__newFromGif?: 

>>>> GD.c:1222: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1222: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:855: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs: In function ?XS_GD__Image_newFromGifData?: 

>>>> GD.xs:865: error: ?gdIOCtx? undeclared (first use in this function) 

>>>> GD.xs:865: error: ?ctx? undeclared (first use in this function) 

>>>> GD.c:1264: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1264: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:877: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.xs:877: error: expected ?;? before ?gdImageCreateFromGifCtx? 

>>>> GD.c: In function ?XS_GD__Image_DESTROY?: 

>>>> GD.c:1297: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1297: error: expected ?;? before ?image? 

>>>> GD.c:1301: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_STORABLE_freeze?: 

>>>> GD.c:1329: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1329: error: expected ?;? before ?image? 

>>>> GD.c:1335: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:903: error: ?GD2_FMT_COMPRESSED? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:903: warning: assignment makes pointer from integer without a cast 

>>>> GD.xs: In function ?XS_GD__Image_STORABLE_thaw?: 

>>>> GD.xs:917: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.xs:917: error: expected ?;? before ?image? 

>>>> GD.xs:922: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_png?: 

>>>> GD.c:1407: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1407: error: expected ?;? before ?image? 

>>>> GD.c:1414: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:939: warning: cast to pointer from integer of different size 

>>>> GD.xs:941: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_jpeg?: 

>>>> GD.c:1458: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1458: error: expected ?;? before ?image? 

>>>> GD.c:1467: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:963: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_gifanimbegin?: 

>>>> GD.c:1514: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1514: error: expected ?;? before ?image? 

>>>> GD.c:1523: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:990: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_gifanimadd?: 

>>>> GD.c:1573: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1573: error: expected ?;? before ?image? 

>>>> GD.c:1579: error: expected ?;? before ?previm? 

>>>> GD.c:1584: error: ?image? undeclared (first use in this function) 

>>>> GD.c:1622: error: ?previm? undeclared (first use in this function) 

>>>> GD.xs:1015: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_gifanimend?: 

>>>> GD.c:1665: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1665: error: expected ?;? before ?image? 

>>>> GD.c:1670: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1034: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_wbmp?: 

>>>> GD.c:1708: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1708: error: expected ?;? before ?image? 

>>>> GD.c:1717: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1055: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_gif?: 

>>>> GD.c:1760: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1760: error: expected ?;? before ?image? 

>>>> GD.c:1768: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1079: warning: cast to pointer from integer of different size 

>>>> GD.c: In function ?XS_GD__Image_gd?: 

>>>> GD.c:1809: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1809: error: expected ?;? before ?image? 

>>>> GD.c:1814: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1102: warning: assignment makes pointer from integer without a 

>>>> cast 

>>>> GD.c: In function ?XS_GD__Image_gd2?: 

>>>> GD.c:1848: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1848: error: expected ?;? before ?image? 

>>>> GD.c:1853: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1117: error: ?GD2_FMT_COMPRESSED? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:1117: warning: assignment makes pointer from integer without a 

>>>> cast 

>>>> GD.c: In function ?XS_GD__Image_transparent?: 

>>>> GD.c:1887: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1887: error: expected ?;? before ?image? 

>>>> GD.c:1893: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_getBounds?: 

>>>> GD.c:1929: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1929: error: expected ?;? before ?image? 

>>>> GD.c:1933: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_isTrueColor?: 

>>>> GD.c:1967: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:1967: error: expected ?;? before ?image? 

>>>> GD.c:1973: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_trueColorToPalette?: 

>>>> GD.c:2002: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2002: error: expected ?;? before ?image? 

>>>> GD.c:2008: error: ?image? undeclared (first use in this function) 

>>>> GD.c:2022: error: ?gdMaxColors? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_rgb?: 

>>>> GD.c:2050: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2050: error: expected ?;? before ?image? 

>>>> GD.c:2055: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_boundsSafe?: 

>>>> GD.c:2091: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2091: error: expected ?;? before ?image? 

>>>> GD.c:2099: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_getPixel?: 

>>>> GD.c:2130: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2130: error: expected ?;? before ?image? 

>>>> GD.c:2138: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setPixel?: 

>>>> GD.c:2167: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2167: error: expected ?;? before ?image? 

>>>> GD.c:2174: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyRotate90?: 

>>>> GD.c:2202: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2202: error: expected ?;? before ?src? 

>>>> GD.c:2203: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2207: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1240: error: expected ?;? before ?dst? 

>>>> GD.xs:1242: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1242: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1246: error: lvalue required as left operand of assignment 

>>>> GD.xs:1246: error: lvalue required as left operand of assignment 

>>>> GD.xs:1249: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyRotate180?: 

>>>> GD.c:2247: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2247: error: expected ?;? before ?src? 

>>>> GD.c:2248: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2252: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1261: error: expected ?;? before ?dst? 

>>>> GD.xs:1263: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1263: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1267: error: lvalue required as left operand of assignment 

>>>> GD.xs:1267: error: lvalue required as left operand of assignment 

>>>> GD.xs:1270: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyRotate270?: 

>>>> GD.c:2292: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2292: error: expected ?;? before ?src? 

>>>> GD.c:2293: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2297: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1282: error: expected ?;? before ?dst? 

>>>> GD.xs:1284: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1284: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1288: error: lvalue required as left operand of assignment 

>>>> GD.xs:1288: error: lvalue required as left operand of assignment 

>>>> GD.xs:1291: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyFlipHorizontal?: 

>>>> GD.c:2337: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2337: error: expected ?;? before ?src? 

>>>> GD.c:2338: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2342: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1303: error: expected ?;? before ?dst? 

>>>> GD.xs:1305: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1305: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1309: error: lvalue required as left operand of assignment 

>>>> GD.xs:1309: error: lvalue required as left operand of assignment 

>>>> GD.xs:1312: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyFlipVertical?: 

>>>> GD.c:2382: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2382: error: expected ?;? before ?src? 

>>>> GD.c:2383: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2387: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1324: error: expected ?;? before ?dst? 

>>>> GD.xs:1326: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1326: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1330: error: lvalue required as left operand of assignment 

>>>> GD.xs:1330: error: lvalue required as left operand of assignment 

>>>> GD.xs:1333: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyTranspose?: 

>>>> GD.c:2427: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2427: error: expected ?;? before ?src? 

>>>> GD.c:2428: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2432: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1345: error: expected ?;? before ?dst? 

>>>> GD.xs:1347: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1347: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1351: error: lvalue required as left operand of assignment 

>>>> GD.xs:1351: error: lvalue required as left operand of assignment 

>>>> GD.xs:1354: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyReverseTranspose?: 

>>>> GD.c:2472: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2472: error: expected ?;? before ?src? 

>>>> GD.c:2473: error: expected ?;? before ?RETVAL? 

>>>> GD.c:2477: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1366: error: expected ?;? before ?dst? 

>>>> GD.xs:1368: error: ?dst? undeclared (first use in this function) 

>>>> GD.xs:1368: error: expected ?;? before ?gd_cloneDim? 

>>>> GD.xs:1372: error: lvalue required as left operand of assignment 

>>>> GD.xs:1372: error: lvalue required as left operand of assignment 

>>>> GD.xs:1375: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_rotate180?: 

>>>> GD.c:2517: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2517: error: expected ?;? before ?src? 

>>>> GD.c:2521: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1392: error: lvalue required as left operand of assignment 

>>>> GD.xs:1392: error: lvalue required as left operand of assignment 

>>>> GD.xs:1393: error: lvalue required as left operand of assignment 

>>>> GD.xs:1393: error: lvalue required as left operand of assignment 

>>>> GD.c: In function ?XS_GD__Image_copyRotated?: 

>>>> GD.c:2558: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2558: error: expected ?;? before ?dst? 

>>>> GD.c:2559: error: expected ?;? before ?src? 

>>>> GD.c:2570: error: ?dst? undeclared (first use in this function) 

>>>> GD.c:2579: error: ?src? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_flipHorizontal?: 

>>>> GD.c:2611: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2611: error: expected ?;? before ?src? 

>>>> GD.c:2615: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1431: error: lvalue required as left operand of assignment 

>>>> GD.xs:1431: error: lvalue required as left operand of assignment 

>>>> GD.xs:1432: error: lvalue required as left operand of assignment 

>>>> GD.xs:1432: error: lvalue required as left operand of assignment 

>>>> GD.c: In function ?XS_GD__Image_flipVertical?: 

>>>> GD.c:2652: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2652: error: expected ?;? before ?src? 

>>>> GD.c:2656: error: ?src? undeclared (first use in this function) 

>>>> GD.xs:1449: error: lvalue required as left operand of assignment 

>>>> GD.xs:1449: error: lvalue required as left operand of assignment 

>>>> GD.xs:1450: error: lvalue required as left operand of assignment 

>>>> GD.xs:1450: error: lvalue required as left operand of assignment 

>>>> GD.c: In function ?XS_GD__Image_line?: 

>>>> GD.c:2693: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2693: error: expected ?;? before ?image? 

>>>> GD.c:2702: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_dashedLine?: 

>>>> GD.c:2730: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2730: error: expected ?;? before ?image? 

>>>> GD.c:2739: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_openPolygon?: 

>>>> GD.c:2767: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2767: error: expected ?;? before ?image? 

>>>> GD.c:2773: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1494: error: ?gdPointPtr? undeclared (first use in this function) 

>>>> GD.xs:1494: error: expected ?;? before ?polyptr? 

>>>> GD.xs:1510: error: ?polyptr? undeclared (first use in this function) 

>>>> GD.xs:1510: error: expected ?;? before ?Perl_safesysmalloc? 

>>>> GD.c: In function ?XS_GD__Image_unclosedPolygon?: 

>>>> GD.c:2846: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2846: error: expected ?;? before ?image? 

>>>> GD.c:2852: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1550: error: ?gdPointPtr? undeclared (first use in this function) 

>>>> GD.xs:1550: error: expected ?;? before ?polyptr? 

>>>> GD.xs:1566: error: ?polyptr? undeclared (first use in this function) 

>>>> GD.xs:1566: error: expected ?;? before ?Perl_safesysmalloc? 

>>>> GD.c: In function ?XS_GD__Image_filledPolygon?: 

>>>> GD.c:2928: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:2928: error: expected ?;? before ?image? 

>>>> GD.c:2934: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:1609: error: ?gdPointPtr? undeclared (first use in this function) 

>>>> GD.xs:1609: error: expected ?;? before ?polyptr? 

>>>> GD.xs:1625: error: ?polyptr? undeclared (first use in this function) 

>>>> GD.xs:1625: error: expected ?;? before ?Perl_safesysmalloc? 

>>>> GD.c: In function ?XS_GD__Image_rectangle?: 

>>>> GD.c:3007: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3007: error: expected ?;? before ?image? 

>>>> GD.c:3016: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_filledRectangle?: 

>>>> GD.c:3044: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3044: error: expected ?;? before ?image? 

>>>> GD.c:3053: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_filledEllipse?: 

>>>> GD.c:3081: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3081: error: expected ?;? before ?image? 

>>>> GD.c:3090: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_arc?: 

>>>> GD.c:3118: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3118: error: expected ?;? before ?image? 

>>>> GD.c:3129: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_filledArc?: 

>>>> GD.c:3157: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3157: error: expected ?;? before ?image? 

>>>> GD.c:3169: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_fillToBorder?: 

>>>> GD.c:3203: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3203: error: expected ?;? before ?image? 

>>>> GD.c:3211: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_fill?: 

>>>> GD.c:3239: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3239: error: expected ?;? before ?image? 

>>>> GD.c:3246: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setBrush?: 

>>>> GD.c:3274: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3274: error: expected ?;? before ?image? 

>>>> GD.c:3275: error: expected ?;? before ?brush? 

>>>> GD.c:3279: error: ?image? undeclared (first use in this function) 

>>>> GD.c:3288: error: ?brush? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setTile?: 

>>>> GD.c:3316: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3316: error: expected ?;? before ?image? 

>>>> GD.c:3317: error: expected ?;? before ?tile? 

>>>> GD.c:3321: error: ?image? undeclared (first use in this function) 

>>>> GD.c:3330: error: ?tile? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setThickness?: 

>>>> GD.c:3358: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3358: error: expected ?;? before ?image? 

>>>> GD.c:3363: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setStyle?: 

>>>> GD.c:3391: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3391: error: expected ?;? before ?image? 

>>>> GD.c:3395: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorAllocate?: 

>>>> GD.c:3435: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3435: error: expected ?;? before ?image? 

>>>> GD.c:3444: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorAllocateAlpha?: 

>>>> GD.c:3473: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3473: error: expected ?;? before ?image? 

>>>> GD.c:3483: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorClosest?: 

>>>> GD.c:3512: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3512: error: expected ?;? before ?image? 

>>>> GD.c:3521: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorClosestAlpha?: 

>>>> GD.c:3550: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3550: error: expected ?;? before ?image? 

>>>> GD.c:3560: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorClosestHWB?: 

>>>> GD.c:3589: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3589: error: expected ?;? before ?image? 

>>>> GD.c:3598: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorExact?: 

>>>> GD.c:3627: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3627: error: expected ?;? before ?image? 

>>>> GD.c:3636: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorExactAlpha?: 

>>>> GD.c:3665: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3665: error: expected ?;? before ?image? 

>>>> GD.c:3675: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorResolve?: 

>>>> GD.c:3704: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3704: error: expected ?;? before ?image? 

>>>> GD.c:3713: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorResolveAlpha?: 

>>>> GD.c:3742: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3742: error: expected ?;? before ?image? 

>>>> GD.c:3752: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorsTotal?: 

>>>> GD.c:3781: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3781: error: expected ?;? before ?image? 

>>>> GD.c:3787: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_interlaced?: 

>>>> GD.c:3818: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3818: error: expected ?;? before ?image? 

>>>> GD.c:3824: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_compare?: 

>>>> GD.c:3859: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3859: error: expected ?;? before ?image1? 

>>>> GD.c:3860: error: expected ?;? before ?image2? 

>>>> GD.c:3866: error: ?image1? undeclared (first use in this function) 

>>>> GD.c:3875: error: ?image2? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_colorDeallocate?: 

>>>> GD.c:3904: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3904: error: expected ?;? before ?image? 

>>>> GD.c:3909: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copy?: 

>>>> GD.c:3937: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3937: error: expected ?;? before ?destination? 

>>>> GD.c:3938: error: expected ?;? before ?source? 

>>>> GD.c:3948: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:3957: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyResized?: 

>>>> GD.c:3985: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:3985: error: expected ?;? before ?destination? 

>>>> GD.c:3986: error: expected ?;? before ?source? 

>>>> GD.c:3998: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:4007: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyResampled?: 

>>>> GD.c:4035: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4035: error: expected ?;? before ?destination? 

>>>> GD.c:4036: error: expected ?;? before ?source? 

>>>> GD.c:4048: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:4057: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyMerge?: 

>>>> GD.c:4085: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4085: error: expected ?;? before ?destination? 

>>>> GD.c:4086: error: expected ?;? before ?source? 

>>>> GD.c:4097: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:4106: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_copyMergeGray?: 

>>>> GD.c:4134: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4134: error: expected ?;? before ?destination? 

>>>> GD.c:4135: error: expected ?;? before ?source? 

>>>> GD.c:4146: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:4155: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_paletteCopy?: 

>>>> GD.c:4183: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4183: error: expected ?;? before ?destination? 

>>>> GD.c:4184: error: expected ?;? before ?source? 

>>>> GD.c:4188: error: ?destination? undeclared (first use in this function) 

>>>> GD.c:4197: error: ?source? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_char?: 

>>>> GD.c:4225: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4225: error: expected ?;? before ?image? 

>>>> GD.c:4226: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4226: error: expected ?;? before ?font? 

>>>> GD.c:4234: error: ?image? undeclared (first use in this function) 

>>>> GD.c:4243: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_charUp?: 

>>>> GD.c:4271: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4271: error: expected ?;? before ?image? 

>>>> GD.c:4272: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4272: error: expected ?;? before ?font? 

>>>> GD.c:4280: error: ?image? undeclared (first use in this function) 

>>>> GD.c:4289: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_string?: 

>>>> GD.c:4317: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4317: error: expected ?;? before ?image? 

>>>> GD.c:4318: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4318: error: expected ?;? before ?font? 

>>>> GD.c:4326: error: ?image? undeclared (first use in this function) 

>>>> GD.c:4335: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_stringUp?: 

>>>> GD.c:4363: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4363: error: expected ?;? before ?image? 

>>>> GD.c:4364: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4364: error: expected ?;? before ?font? 

>>>> GD.c:4372: error: ?image? undeclared (first use in this function) 

>>>> GD.c:4381: error: ?font? undeclared (first use in this function) 

>>>> GD.xs: In function ?XS_GD__Image_stringFT?: 

>>>> GD.xs:2153: error: ?gdImagePtr? undeclared (first use in this function) 

>>>> GD.xs:2153: error: expected ?;? before ?img? 

>>>> GD.xs:2163: error: ?gdFTStringExtra? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2163: error: expected ?;? before ?strex? 

>>>> GD.xs:2173: error: ?img? undeclared (first use in this function) 

>>>> GD.xs:2173: error: expected ?;? before ?tmp? 

>>>> GD.xs:2182: error: ?strex? undeclared (first use in this function) 

>>>> GD.xs:2186: error: ?gdFTEX_LINESPACE? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2190: error: ?gdFTEX_CHARMAP? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2192: error: ?gdFTEX_Unicode? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2194: error: ?gdFTEX_Shift_JIS? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2196: error: ?gdFTEX_Big5? undeclared (first use in this function) 

>>>> GD.xs:2202: error: ?gdFTEX_RESOLUTION? undeclared (first use in this 

>>>> function) 

>>>> GD.xs:2211: error: ?gdFTEX_DISABLE_KERNING? undeclared (first use in 

>>>> this 

>>>> function) 

>>>> GD.xs:2217: warning: assignment makes pointer from integer without a 

>>>> cast 

>>>> GD.xs:2221: warning: assignment makes pointer from integer without a 

>>>> cast 

>>>> GD.c: In function ?XS_GD__Image_stringFTCircle?: 

>>>> GD.c:4523: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4523: error: expected ?;? before ?image? 

>>>> GD.c:4543: error: ?image? undeclared (first use in this function) 

>>>> GD.xs:2262: warning: assignment makes pointer from integer without a 

>>>> cast 

>>>> GD.c: In function ?XS_GD__Image_useFontConfig?: 

>>>> GD.c:4596: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4596: error: expected ?;? before ?image? 

>>>> GD.c:4606: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_alphaBlending?: 

>>>> GD.c:4641: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4641: error: expected ?;? before ?image? 

>>>> GD.c:4646: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_saveAlpha?: 

>>>> GD.c:4674: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4674: error: expected ?;? before ?image? 

>>>> GD.c:4679: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_clip?: 

>>>> GD.c:4709: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4709: error: expected ?;? before ?image? 

>>>> GD.c:4717: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setAntiAliased?: 

>>>> GD.c:4757: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4757: error: expected ?;? before ?image? 

>>>> GD.c:4762: error: ?image? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Image_setAntiAliasedDontBlend?: 

>>>> GD.c:4790: error: ?GD__Image? undeclared (first use in this function) 

>>>> GD.c:4790: error: expected ?;? before ?image? 

>>>> GD.c:4796: error: ?image? undeclared (first use in this function) 

>>>> GD.xs: In function ?XS_GD__Font_load?: 

>>>> GD.xs:2383: error: ?gdFontPtr? undeclared (first use in this function) 

>>>> GD.xs:2383: error: expected ?;? before ?font? 

>>>> GD.c:4841: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4841: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2395: error: ?font? undeclared (first use in this function) 

>>>> GD.xs:2395: error: expected ?;? before ?Perl_safesysmalloc? 

>>>> GD.xs:2426: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_DESTROY?: 

>>>> GD.c:4910: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4910: error: expected ?;? before ?self? 

>>>> GD.c:4914: error: ?self? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_Small?: 

>>>> GD.c:4950: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4950: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2453: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_Large?: 

>>>> GD.c:4982: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:4982: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2464: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_Giant?: 

>>>> GD.c:5014: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5014: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2475: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_MediumBold?: 

>>>> GD.c:5046: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5046: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2486: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_Tiny?: 

>>>> GD.c:5078: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5078: error: expected ?;? before ?RETVAL? 

>>>> GD.xs:2497: error: ?RETVAL? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_nchars?: 

>>>> GD.c:5109: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5109: error: expected ?;? before ?font? 

>>>> GD.c:5115: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_offset?: 

>>>> GD.c:5144: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5144: error: expected ?;? before ?font? 

>>>> GD.c:5150: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_width?: 

>>>> GD.c:5179: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5179: error: expected ?;? before ?font? 

>>>> GD.c:5185: error: ?font? undeclared (first use in this function) 

>>>> GD.c: In function ?XS_GD__Font_height?: 

>>>> GD.c:5214: error: ?GD__Font? undeclared (first use in this function) 

>>>> GD.c:5214: error: expected ?;? before ?font? 

>>>> GD.c:5220: error: ?font? undeclared (first use in this function) 

>>>> make: *** [GD.o] Error 1 

>>>> 

>>>> -------END GD.pm attempt. 

>>>> -------Begin libgd attempt 

>>>> 

>>>> I then did make uninstall on libgd, downloaded 2.036RC1.29 and attempted 

>>>> to install and got the following errors output: 

>>>> [host-9-116:~/Desktop/server/gd-2.0.36RC1.29] jnolan% ./configure 

>>>> checking build system type... i386-apple-darwin10.3.0 

>>>> checking host system type... i386-apple-darwin10.3.0 

>>>> checking target system type... i386-apple-darwin10.3.0 

>>>> checking for a BSD-compatible install... /usr/bin/install -c 

>>>> checking whether build environment is sane... yes 

>>>> checking for a thread-safe mkdir -p... config/install-sh -c -d 

>>>> checking for gawk... no 

>>>> checking for mawk... no 

>>>> checking for nawk... no 

>>>> checking for awk... awk 

>>>> checking whether make sets $(MAKE)... yes 

>>>> checking if we are building a Cygwin target... no 

>>>> checking for gcc... gcc 

>>>> checking for C compiler default output file name... a.out 

>>>> checking whether the C compiler works... yes 

>>>> checking whether we are cross compiling... no 

>>>> checking for suffix of executables... 

>>>> checking for suffix of object files... o 

>>>> checking whether we are using the GNU C compiler... yes 

>>>> checking whether gcc accepts -g... yes 

>>>> checking for gcc option to accept ISO C89... none needed 

>>>> checking for style of include used by make... GNU 

>>>> checking dependency style of gcc... gcc3 

>>>> checking for gcc... (cached) gcc 

>>>> checking whether we are using the GNU C compiler... (cached) yes 

>>>> checking whether gcc accepts -g... (cached) yes 

>>>> checking for gcc option to accept ISO C89... (cached) none needed 

>>>> checking dependency style of gcc... (cached) gcc3 

>>>> checking for a BSD-compatible install... /usr/bin/install -c 

>>>> checking for a sed that does not truncate output... /usr/bin/sed 

>>>> checking for grep that handles long lines and -e... /usr/bin/grep 

>>>> checking for egrep... /usr/bin/grep -E 

>>>> checking for ld used by gcc... 

>>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld 

>>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) 

>>>> is 

>>>> GNU ld... no 

>>>> checking for /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld option to 

>>>> reload object files... -r 

>>>> checking for BSD-compatible nm... /usr/bin/nm 

>>>> checking whether ln -s works... yes 

>>>> checking how to recognize dependent libraries... pass_all 

>>>> checking how to run the C preprocessor... gcc -E 

>>>> checking for ANSI C header files... yes 

>>>> checking for sys/types.h... yes 

>>>> checking for sys/stat.h... yes 

>>>> checking for stdlib.h... yes 

>>>> checking for string.h... yes 

>>>> checking for memory.h... yes 

>>>> checking for strings.h... yes 

>>>> checking for inttypes.h... yes 

>>>> checking for stdint.h... yes 

>>>> checking for unistd.h... yes 

>>>> checking dlfcn.h usability... yes 

>>>> checking dlfcn.h presence... yes 

>>>> checking for dlfcn.h... yes 

>>>> checking for g++... g++ 

>>>> checking whether we are using the GNU C++ compiler... yes 

>>>> checking whether g++ accepts -g... yes 

>>>> checking dependency style of g++... gcc3 

>>>> checking how to run the C++ preprocessor... g++ -E 

>>>> checking for g77... no 

>>>> checking for xlf... no 

>>>> checking for f77... no 

>>>> checking for frt... no 

>>>> checking for pgf77... no 

>>>> checking for cf77... no 

>>>> checking for fort77... no 

>>>> checking for fl32... no 

>>>> checking for af77... no 

>>>> checking for xlf90... no 

>>>> checking for f90... no 

>>>> checking for pgf90... no 

>>>> checking for pghpf... no 

>>>> checking for epcf90... no 

>>>> checking for gfortran... no 

>>>> checking for g95... no 

>>>> checking for xlf95... no 

>>>> checking for f95... no 

>>>> checking for fort... no 

>>>> checking for ifort... no 

>>>> checking for ifc... no 

>>>> checking for efc... no 

>>>> checking for pgf95... no 

>>>> checking for lf95... no 

>>>> checking for ftn... no 

>>>> checking whether we are using the GNU Fortran 77 compiler... no 

>>>> checking whether accepts -g... no 

>>>> checking the maximum length of command line arguments... 196608 

>>>> checking command to parse /usr/bin/nm output from gcc object... rm: 

>>>> conftest.dSYM: is a directory 

>>>> rm: conftest.dSYM: is a directory 

>>>> rm: conftest.dSYM: is a directory 

>>>> rm: conftest.dSYM: is a directory 

>>>> ok 

>>>> checking for objdir... .libs 

>>>> checking for ar... ar 

>>>> checking for ranlib... ranlib 

>>>> checking for strip... strip 

>>>> rm: conftest.dSYM: is a directory 

>>>> rm: conftest.dSYM: is a directory 

>>>> checking if gcc supports -fno-rtti -fno-exceptions... rm: conftest.dSYM: 

>>>> is a directory 

>>>> no 

>>>> checking for gcc option to produce PIC... -fno-common 

>>>> checking if gcc PIC flag -fno-common works... rm: conftest.dSYM: is a 

>>>> directory 

>>>> yes 

>>>> checking if gcc static flag -static works... rm: conftest.dSYM: is a 

>>>> directory 

>>>> no 

>>>> checking if gcc supports -c -o file.o... rm: conftest.dSYM: is a 

>>>> directory 

>>>> yes 

>>>> checking whether the gcc linker 

>>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared 

>>>> libraries... 

>>>> yes 

>>>> checking dynamic linker characteristics... darwin10.3.0 dyld 

>>>> checking how to hardcode library paths into programs... immediate 

>>>> checking whether stripping libraries is possible... yes 

>>>> checking if libtool supports shared libraries... yes 

>>>> checking whether to build shared libraries... yes 

>>>> checking whether to build static libraries... yes 

>>>> configure: creating libtool 

>>>> appending configuration tag "CXX" to libtool 

>>>> rm: conftest.dSYM: is a directory 

>>>> rm: conftest.dSYM: is a directory 

>>>> checking for ld used by g++... 

>>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld 

>>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) 

>>>> is 

>>>> GNU ld... no 

>>>> checking whether the g++ linker 

>>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared 

>>>> libraries... 

>>>> yes 

>>>> checking for g++ option to produce PIC... -fno-common 

>>>> checking if g++ PIC flag -fno-common works... rm: conftest.dSYM: is a 

>>>> directory 

>>>> yes 

>>>> checking if g++ static flag -static works... rm: conftest.dSYM: is a 

>>>> directory 

>>>> no 

>>>> checking if g++ supports -c -o file.o... rm: conftest.dSYM: is a 

>>>> directory 

>>>> yes 

>>>> checking whether the g++ linker 

>>>> (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) supports shared 

>>>> libraries... 

>>>> yes 

>>>> checking dynamic linker characteristics... darwin10.3.0 dyld 

>>>> checking how to hardcode library paths into programs... immediate 

>>>> appending configuration tag "F77" to libtool 

>>>> checking whether ln -s works... yes 

>>>> checking whether make sets $(MAKE)... (cached) yes 

>>>> checking for X... no 

>>>> checking for ANSI C header files... (cached) yes 

>>>> checking errno.h usability... yes 

>>>> checking errno.h presence... yes 

>>>> checking for errno.h... yes 

>>>> checking limits.h usability... yes 

>>>> checking limits.h presence... yes 

>>>> checking for limits.h... yes 

>>>> checking stddef.h usability... yes 

>>>> checking stddef.h presence... yes 

>>>> checking for stddef.h... yes 

>>>> checking for stdlib.h... (cached) yes 

>>>> checking for string.h... (cached) yes 

>>>> checking for unistd.h... (cached) yes 

>>>> checking for ld used by GCC... 

>>>> /usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld 

>>>> checking if the linker (/usr/libexec/gcc/i686-apple-darwin10/4.2.1/ld) 

>>>> is 

>>>> GNU ld... no 

>>>> checking for shared library run path origin... done 

>>>> checking for iconv... yes 

>>>> checking how to link with libiconv... -liconv 

>>>> checking for iconv declaration... 

>>>> extern size_t iconv (iconv_t cd, char * *inbuf, size_t 

>>>> *inbytesleft, char * *outbuf, size_t *outbytesleft); 

>>>> checking iconv.h usability... yes 

>>>> checking iconv.h presence... yes 

>>>> checking for iconv.h... yes 

>>>> checking whether iconv.h defines iconv_t... yes 

>>>> rm: conftest.dSYM: is a directory 

>>>> checking for sin... yes 

>>>> checking for deflate in -lz... yes 

>>>> checking for libpng12-config... /usr/X11/bin/libpng12-config 

>>>> checking for libpng-config... /usr/local/bin/libpng-config 

>>>> checking png.h usability... yes 

>>>> checking png.h presence... yes 

>>>> checking for png.h... yes 

>>>> checking for png_create_read_struct in -lpng12... yes 

>>>> checking for freetype-config... /usr/local/bin/freetype-config 

>>>> checking for FT_Init_FreeType in -lfreetype... yes 

>>>> checking ft2build.h usability... yes 

>>>> checking ft2build.h presence... yes 

>>>> checking for ft2build.h... yes 

>>>> checking for FcInit in -lfontconfig... yes 

>>>> checking for jpeg_set_defaults in -ljpeg... yes 

>>>> checking for XpmReadFileToXpmImage in -lXpm... yes 

>>>> checking for the pthreads library -lpthreads... no 

>>>> checking whether pthreads work without any flags... yes 

>>>> checking for joinable pthread attribute... PTHREAD_CREATE_JOINABLE 

>>>> checking if more special flags are required for pthreads... 

>>>> -D_THREAD_SAFE 

>>>> ** Configuration summary for gd 2.0.36: 

>>>> Support for PNG library: yes 

>>>> Support for JPEG library: yes 

>>>> Support for Freetype 2.x library: yes 

>>>> Support for Fontconfig library: yes 

>>>> Support for Xpm library: yes 

>>>> Support for pthreads: yes 

>>>> configure: creating ./config.status 

>>>> config.status: creating Makefile 

>>>> config.status: creating config/Makefile 

>>>> config.status: creating config/gdlib-config 

>>>> config.status: creating test/Makefile 

>>>> config.status: creating config.h 

>>>> config.status: executing depfiles commands 

>>>> [host-9-116:~/Desktop/server/gd-2.0.36RC1.29] jnolan% make 

>>>> make all-recursive 

>>>> Making all in config 

>>>> make[2]: Nothing to be done for `all'. 

>>>> Making all in test 

>>>> make[2]: Nothing to be done for `all'. 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD -MP -MF .deps/gd.Tpo 

>>>> -c 

>>>> -o gd.lo gd.c 

>>>> mkdir .libs 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd.Tpo -c gd.c -fno-common -DPIC -o .libs/gd.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd.Tpo -c gd.c -o gd.o >/dev/null 2>&1 

>>>> mv -f .deps/gd.Tpo .deps/gd.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo -MD -MP -MF 

>>>> .deps/gdfx.Tpo 

>>>> -c -o gdfx.lo gdfx.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo -MD 

>>>> -MP 

>>>> -MF .deps/gdfx.Tpo -c gdfx.c -fno-common -DPIC -o .libs/gdfx.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gdfx.lo -MD 

>>>> -MP 

>>>> -MF .deps/gdfx.Tpo -c gdfx.c -o gdfx.o >/dev/null 2>&1 

>>>> mv -f .deps/gdfx.Tpo .deps/gdfx.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_security.lo -MD -MP -MF 

>>>> .deps/gd_security.Tpo -c -o gd_security.lo gd_security.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT 

>>>> gd_security.lo 

>>>> -MD -MP -MF .deps/gd_security.Tpo -c gd_security.c -fno-common -DPIC -o 

>>>> .libs/gd_security.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT 

>>>> gd_security.lo 

>>>> -MD -MP -MF .deps/gd_security.Tpo -c gd_security.c -o gd_security.o 

>>>> >/dev/null 2>&1 

>>>> mv -f .deps/gd_security.Tpo .deps/gd_security.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo -MD -MP -MF 

>>>> .deps/gd_gd.Tpo -c -o gd_gd.lo gd_gd.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd_gd.Tpo -c gd_gd.c -fno-common -DPIC -o .libs/gd_gd.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd_gd.Tpo -c gd_gd.c -o gd_gd.o >/dev/null 2>&1 

>>>> mv -f .deps/gd_gd.Tpo .deps/gd_gd.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo -MD -MP -MF 

>>>> .deps/gd_gd2.Tpo -c -o gd_gd2.lo gd_gd2.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo 

>>>> -MD 

>>>> -MP -MF .deps/gd_gd2.Tpo -c gd_gd2.c -fno-common -DPIC -o 

>>>> .libs/gd_gd2.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_gd2.lo 

>>>> -MD 

>>>> -MP -MF .deps/gd_gd2.Tpo -c gd_gd2.c -o gd_gd2.o >/dev/null 2>&1 

>>>> mv -f .deps/gd_gd2.Tpo .deps/gd_gd2.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo -MD -MP -MF 

>>>> .deps/gd_io.Tpo -c -o gd_io.lo gd_io.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd_io.Tpo -c gd_io.c -fno-common -DPIC -o .libs/gd_io.o 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_io.lo -MD 

>>>> -MP 

>>>> -MF .deps/gd_io.Tpo -c gd_io.c -o gd_io.o >/dev/null 2>&1 

>>>> mv -f .deps/gd_io.Tpo .deps/gd_io.Plo 

>>>> /bin/sh ./libtool --tag=CC --mode=compile gcc -DHAVE_CONFIG_H -I. 

>>>> -I/usr/local/include/freetype2 -I/usr/local/include 

>>>> -I/usr/X11/include/libpng12 -g -O2 -MT gd_io_dp.lo -MD -MP -MF 

>>>> .deps/gd_io_dp.Tpo -c -o gd_io_dp.lo gd_io_dp.c 

>>>> gcc -DHAVE_CONFIG_H -I. -I/usr/local/include/freetype2 

>>>> -I/usr/local/include -I/usr/X11/include/libpng12 -g -O2 -MT gd_io_dp.lo 

>>>> -MD 

>>>> -MP -MF .deps/gd_io_dp.

-------------- next part --------------

An HTML attachment was scrubbed...

------------------------------

------------------------------------------------------------------------------

Download Intel&#174; Parallel Studio Eval

Try the new software tools for yourself. Speed compiling, find bugs

proactively, and fine-tune applications for parallel performance.

See why Intel Parallel Studio got high marks during beta.

http://p.sf.net/sfu/intel-sw-dev

------------------------------

_______________________________________________

Gmod-gbrowse mailing list

Gmod-gbrowse at lists.sourceforge.net

https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse

 

End of Gmod-gbrowse Digest, Vol 47, Issue 25

********************************************


------------------------------------------------------------------------------
Download Intel&#174; Parallel Studio Eval
Try the new software tools for yourself. Speed compiling, find bugs
proactively, and fine-tune applications for parallel performance.
See why Intel Parallel Studio got high marks during beta.
http://p.sf.net/sfu/intel-sw-dev
_______________________________________________
Gmod-gbrowse mailing list
Gmod-gbrowse at lists.sourceforge.net
https://lists.sourceforge.net/lists/listinfo/gmod-gbrowse




-- 
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa at oicr.on.ca>



From cjfields at illinois.edu  Wed Apr  7 18:06:34 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 07 Apr 2010 17:06:34 -0500
Subject: [Bioperl-l] parsing blast reports
In-Reply-To: <1270676871.18964.125.camel@pyrimidine.igb.uiuc.edu>
References: <1270657429.18061.6.camel@limm-pc1254>
	<C83F8AC5-4065-49D3-A8C6-9561D860357A@sbc.su.se>
	<1270663116.12446.65.camel@pyrimidine.igb.uiuc.edu>
	<40181AA4-104B-4CB6-8C07-65E626674C0B@sbc.su.se>
	<z2j4ba171b81004071240na111a19dj876412e8c4ef1884@mail.gmail.com>
	<1270676871.18964.125.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <1270677994.21192.0.camel@pyrimidine.igb.uiuc.edu>

And I've done just that (added a -string option to Bio::Root::IO, along
with tests).  Now in main trunk, r16948.

chris

On Wed, 2010-04-07 at 16:47 -0500, Chris Fields wrote:
> We could do that for convenience, just another option.
> 
> chris
> 
> On Wed, 2010-04-07 at 20:40 +0100, Gregory Jordan wrote:
> > This particular trick isn't *too* ugly, but why don't we just add a
> > "-string" parameter to the Bio::Root::IO module? Then, Bioperl users
> > wouldn't have to independently discover the string filehandle trick every
> > time they find themselves wanting to use a string instead of a file or
> > handle. Personally, I've discovered, forgotten, and re-discovered this
> > particular one more than once already.
> > 
> > The _initialize_io method in Bio::Root::IO already deals with two mutually
> > exclusive input parameters ("file" and "fh"); is there a good reason why not
> > to add a third and just include the string filehandle bit within that
> > method?
> > 
> > greg
> > 
> > On 7 April 2010 19:06, Dave Messina <David.Messina at sbc.su.se> wrote:
> > 
> > > > Forgot about that one, much simpler.
> > >
> > > Me too, until I was doing this same thing a couple days ago... :)
> > >
> > >
> > >
> > > D
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 



From biopython at maubp.freeserve.co.uk  Wed Apr  7 18:13:52 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 7 Apr 2010 23:13:52 +0100
Subject: [Bioperl-l] Project: R and Perl GSoC,
	was: BioPerl 2.0 (and 	beyond)
Message-ID: <i2g320fb6e01004071513ic436df4dxea0bf34ab603d7f5@mail.gmail.com>

On Wed, Apr 7, 2010 at 2:18 AM, lin yu <joycelin12 at gmail.com> wrote:
> Hi
>
> I am from a part-time student from NUS. May i suggest the following project:
> Accessing R phylogenetic tools from BioPerl Actually this project was
> initially proposed by the Phyloinformatics Summer of Code 2010, however the
> programming language is in Python and I have no prior experience in that
> language. Therefore, I would like to propose the use of BioPerl in access R
> phlyogenetic tools or the combination of R and BioPerl in other similar
> applications like microarray analysis etc. Would it be possible? I would
> like to know the answer as soon as possible as I can edit my proposal in the
> case. Thank you.
> --
> Best regards
> Joyce Lin

Hi Joyce,

You said you don't have any Python experience, but your proposed
project would require you to know BOTH Perl and R (and R isn't that
easy to learn in my opinion).

The Python project you refer to would build on rpy2, a library for calling
R from Python. The aim was to target Biologically interesting things
supported in R, and make them usable from Python.
http://rpy.sourceforge.net/
http://biopython.org/wiki/Google_Summer_of_Code

For your project to be realistic, you would need to start with a way of
calling R from Perl (an interesting computer science project), and from
a quick Google there is the RSPerl project- but it hasn't been updated
for several years and I doubt it would work perfectly on recent versions
of R: http://www.omegahat.org/RSPerl/

Perhaps someone else on the list has some other suggestions? You
would also need someone to be a Google Summer of Code (GSoC)
mentor...

Peter (@Biopython)

From jason at bioperl.org  Wed Apr  7 19:06:23 2010
From: jason at bioperl.org (Jason Stajich)
Date: Wed, 7 Apr 2010 16:06:23 -0700
Subject: [Bioperl-l] PAML
In-Reply-To: <B74C3015BE5D4D8C8DCF84536F0D8381@STUDYPC>
References: <B74C3015BE5D4D8C8DCF84536F0D8381@STUDYPC>
Message-ID: <w2l8273f6c21004071606v37426242sa249c5dd2adb0c96@mail.gmail.com>

Please always mail the list, I can't always answer questions.  It is
also much more helpful if you were to send a result file.

I think you want:

if( my $result = $paml_parser->next_result() ) {
  for my $ns_result ( $result->get_NSSite_results ) {
    print "model num is ", $ns_result-> model_num, "\n";
    print "lnL: ", $ns_result->likelihood, "\n";
    print "kappa: ", $ns_result->kappa, "\n";
  }
}

 If this works can you add something to the wiki HOWTO for PAML of the
basic code you are using and how you are doing the loglikehood test
comparison - you can get the number of free params for the chisq from
another field in the files as well - I wrote a script that did all
this a while ago but seem to have lost it. Be good to get that sort of
working code back into the wiki and/or repo for people to use and play
with.
-jason

--
Jason Stajich
jason at bioperl.org
jason.stajich at gmail.com
http://bioperl.org/wiki/User:Jason
http://twitter.com/hyphaltip



On Wed, Apr 7, 2010 at 3:45 AM, Dave Burt <david.burt1955 at o2.co.uk> wrote:
> Hi Jason,
>
>
>
> I am using Bioperl and various PAML modules - all is working except I have
> one question.
>
>
>
> How do I retrieve the likelihood (lnL) and kappa values from an PAML
> analysis?
>
>
>
> For example, I would like to compare model 0 vs. model 1, then repeat this
> for 1000's of genes.
>
>
>
> Here's the ctl file from a model 1 analysis
>
>
>
> Thanks Dave
>
>
>
>
>
> seqfile = c:/cygwin/tmp/6Apr3EZ7Wa/9g9rUwnO2d
>
> outfile = mlc
>
> treefile = c:/cygwin/tmp/6Apr3EZ7Wa/WcFjpKcmzU
>
> aaDist = 0
>
> verbose = 1
>
> noisy = 3
>
> RateAncestor = 1
>
> kappa = 2
>
> model = 1
>
> ndata = 1
>
> aaRatefile = wag.dat
>
> Small_Diff = .5e-6
>
> CodonFreq = 2
>
> runmode = 0
>
> alpha = 0
>
> omega = 0.4
>
> fix_kappa = 0
>
> Mgene = 0
>
> method = 0
>
> fix_omega = 0
>
> getSE = 0
>
> NSsites = 0
>
> seqtype = 1
>
> cleandata = 1
>
> icode = 0
>
> fix_alpha = 1
>
> clock = 0
>
> ncatG = 8
>
> Malpha = 0
>
> fix_blength = 0
>
>
>
>

From rmb32 at cornell.edu  Wed Apr  7 19:47:59 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Wed, 07 Apr 2010 16:47:59 -0700
Subject: [Bioperl-l] Project: R and Perl GSoC,
 was: BioPerl 2.0 (and  beyond)
In-Reply-To: <i2g320fb6e01004071513ic436df4dxea0bf34ab603d7f5@mail.gmail.com>
References: <i2g320fb6e01004071513ic436df4dxea0bf34ab603d7f5@mail.gmail.com>
Message-ID: <4BBD19AF.1040601@cornell.edu>

Note that one of the Perl Foundation project ideas is a a better way of 
calling R from Perl.

R

Peter wrote:
> On Wed, Apr 7, 2010 at 2:18 AM, lin yu <joycelin12 at gmail.com> wrote:
>> Hi
>>
>> I am from a part-time student from NUS. May i suggest the following project:
>> Accessing R phylogenetic tools from BioPerl Actually this project was
>> initially proposed by the Phyloinformatics Summer of Code 2010, however the
>> programming language is in Python and I have no prior experience in that
>> language. Therefore, I would like to propose the use of BioPerl in access R
>> phlyogenetic tools or the combination of R and BioPerl in other similar
>> applications like microarray analysis etc. Would it be possible? I would
>> like to know the answer as soon as possible as I can edit my proposal in the
>> case. Thank you.
>> --
>> Best regards
>> Joyce Lin
> 
> Hi Joyce,
> 
> You said you don't have any Python experience, but your proposed
> project would require you to know BOTH Perl and R (and R isn't that
> easy to learn in my opinion).
> 
> The Python project you refer to would build on rpy2, a library for calling
> R from Python. The aim was to target Biologically interesting things
> supported in R, and make them usable from Python.
> http://rpy.sourceforge.net/
> http://biopython.org/wiki/Google_Summer_of_Code
> 
> For your project to be realistic, you would need to start with a way of
> calling R from Perl (an interesting computer science project), and from
> a quick Google there is the RSPerl project- but it hasn't been updated
> for several years and I doubt it would work perfectly on recent versions
> of R: http://www.omegahat.org/RSPerl/
> 
> Perhaps someone else on the list has some other suggestions? You
> would also need someone to be a Google Summer of Code (GSoC)
> mentor...
> 
> Peter (@Biopython)
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From rmb32 at cornell.edu  Wed Apr  7 20:23:14 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Wed, 07 Apr 2010 17:23:14 -0700
Subject: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why
	varchar_pattern_ops?
Message-ID: <4BBD21F2.60203@cornell.edu>

What's the thinking behind the BDBSFS::Pg (ha) index on the "name" table 
at Pg.pm line 282:

     CREATE INDEX name_name_varchar_patt_ops_idx ON name USING BTREE
     (lower(name) varchar_pattern_ops);

Why the varchar_pattern_ops operator class?

I'm testing an installation (backing gbrowse, of course) on Pg 8.3, and 
performance was really stinking on the SFS query:

     SELECT f.id,f.object,f.typeid,f.seqid,f.start,f.end,f.strand
     FROM feature as f, name as n
     WHERE (n.id=f.id AND lower(n.name) = lower($1) AND n.display_name>0)

so I explained it, giving

                                       QUERY PLAN 

--------------------------------------------------------------------------------------
  Nested Loop  (cost=0.00..130159.60 rows=11059 width=556) 

    ->  Seq Scan on name n  (cost=0.00..53489.41 rows=11059 width=4) 

          Filter: ((display_name > 0) AND (lower((name)::text) = 
'foo'::text))
    ->  Index Scan using feature_pkey on feature f  (cost=0.00..6.92 
rows=1 width=556)
          Index Cond: (f.id = n.id)


Seq scan, not good.  It's not using the name_name_varchar_patt_ops_idx. 
  So I added an index on just lower(name) without the 
varchar_pattern_ops business (create index lowername on name ( 
lower(name) )) and performance started getting fine again, with explain:


                                       QUERY PLAN
------------------------------------------------------------------------------------
  Nested Loop  (cost=640.81..175775.44 rows=20521 width=501)
    ->  Bitmap Heap Scan on name n  (cost=640.81..31557.42 rows=20521 
width=4)
          Recheck Cond: (lower((name)::text) = 'foo'::text)
          Filter: (display_name > 0)
          ->  Bitmap Index Scan on lowername  (cost=0.00..635.68 
rows=20597 width=0)
                Index Cond: (lower((name)::text) = 'foo'::text)
    ->  Index Scan using feature_pkey on feature f  (cost=0.00..7.02 
rows=1 width=501
          Index Cond: (f.id = n.id)
(8 rows)


This has much better performance in practice, since it's not 
sequentially scanning the 4.1M row "name" table.

This suggests to me that the varchar_pattern_ops class should be 
removed, but could one of the original BDBSFS::Pg authors (like Lincoln 
or Scott) weigh in on this?

Rob






From cjfields at illinois.edu  Wed Apr  7 21:00:13 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 7 Apr 2010 20:00:13 -0500
Subject: [Bioperl-l] Project: R and Perl GSoC,
	was: BioPerl 2.0 (and  beyond)
In-Reply-To: <4BBD19AF.1040601@cornell.edu>
References: <i2g320fb6e01004071513ic436df4dxea0bf34ab603d7f5@mail.gmail.com>
	<4BBD19AF.1040601@cornell.edu>
Message-ID: <84325A04-B3B7-4DFE-8D9B-2AAFF0A748EC@illinois.edu>

I think this fits a general Perl/Python/etc project more; R isn't only BioC.

chris

On Apr 7, 2010, at 6:47 PM, Robert Buels wrote:

> Note that one of the Perl Foundation project ideas is a a better way of calling R from Perl.
> 
> R
> 
> Peter wrote:
>> On Wed, Apr 7, 2010 at 2:18 AM, lin yu <joycelin12 at gmail.com> wrote:
>>> Hi
>>> 
>>> I am from a part-time student from NUS. May i suggest the following project:
>>> Accessing R phylogenetic tools from BioPerl Actually this project was
>>> initially proposed by the Phyloinformatics Summer of Code 2010, however the
>>> programming language is in Python and I have no prior experience in that
>>> language. Therefore, I would like to propose the use of BioPerl in access R
>>> phlyogenetic tools or the combination of R and BioPerl in other similar
>>> applications like microarray analysis etc. Would it be possible? I would
>>> like to know the answer as soon as possible as I can edit my proposal in the
>>> case. Thank you.
>>> --
>>> Best regards
>>> Joyce Lin
>> Hi Joyce,
>> You said you don't have any Python experience, but your proposed
>> project would require you to know BOTH Perl and R (and R isn't that
>> easy to learn in my opinion).
>> The Python project you refer to would build on rpy2, a library for calling
>> R from Python. The aim was to target Biologically interesting things
>> supported in R, and make them usable from Python.
>> http://rpy.sourceforge.net/
>> http://biopython.org/wiki/Google_Summer_of_Code
>> For your project to be realistic, you would need to start with a way of
>> calling R from Perl (an interesting computer science project), and from
>> a quick Google there is the RSPerl project- but it hasn't been updated
>> for several years and I doubt it would work perfectly on recent versions
>> of R: http://www.omegahat.org/RSPerl/
>> Perhaps someone else on the list has some other suggestions? You
>> would also need someone to be a Google Summer of Code (GSoC)
>> mentor...
>> Peter (@Biopython)
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From scott at scottcain.net  Wed Apr  7 22:44:48 2010
From: scott at scottcain.net (Scott Cain)
Date: Wed, 7 Apr 2010 22:44:48 -0400
Subject: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why
	varchar_pattern_ops?
In-Reply-To: <4BBD21F2.60203@cornell.edu>
References: <4BBD21F2.60203@cornell.edu>
Message-ID: <i2i4536f7701004071944o2767734fo8e5f20589fbf4120@mail.gmail.com>

Hi Rob,

I was a little concerned that this might happen.  This change was
suggested by Randall on the GBrowse mailing list a few weeks ago, and
after some testing on my machine, it seemed to work well.  The problem
was that wild card searches on the name column were seqscanning, and
the suggested index fixed the problem.  I wonder if the query planner
in postgres would be smart enough to use the appropriate index if we
created both one with and one without varchar_pattern_ops.

The reason for using varchar_pattern_ops specifically was to allow for
searching in a non-C locale.  Another option would be to make the
creation of the index conditional when the database is created.  It
could use the standard C locale setting and if a flag is set, create
the index to allow non-C locale searches (and presumably, the default
C locale would be the right thing for most users).

Scott


On Wed, Apr 7, 2010 at 8:23 PM, Robert Buels <rmb32 at cornell.edu> wrote:
> What's the thinking behind the BDBSFS::Pg (ha) index on the "name" table at
> Pg.pm line 282:
>
> ? ?CREATE INDEX name_name_varchar_patt_ops_idx ON name USING BTREE
> ? ?(lower(name) varchar_pattern_ops);
>
> Why the varchar_pattern_ops operator class?
>
> I'm testing an installation (backing gbrowse, of course) on Pg 8.3, and
> performance was really stinking on the SFS query:
>
> ? ?SELECT f.id,f.object,f.typeid,f.seqid,f.start,f.end,f.strand
> ? ?FROM feature as f, name as n
> ? ?WHERE (n.id=f.id AND lower(n.name) = lower($1) AND n.display_name>0)
>
> so I explained it, giving
>
> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?QUERY PLAN
> --------------------------------------------------------------------------------------
> ?Nested Loop ?(cost=0.00..130159.60 rows=11059 width=556)
> ? -> ?Seq Scan on name n ?(cost=0.00..53489.41 rows=11059 width=4)
> ? ? ? ? Filter: ((display_name > 0) AND (lower((name)::text) = 'foo'::text))
> ? -> ?Index Scan using feature_pkey on feature f ?(cost=0.00..6.92 rows=1
> width=556)
> ? ? ? ? Index Cond: (f.id = n.id)
>
>
> Seq scan, not good. ?It's not using the name_name_varchar_patt_ops_idx. ?So
> I added an index on just lower(name) without the varchar_pattern_ops
> business (create index lowername on name ( lower(name) )) and performance
> started getting fine again, with explain:
>
>
> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?QUERY PLAN
> ------------------------------------------------------------------------------------
> ?Nested Loop ?(cost=640.81..175775.44 rows=20521 width=501)
> ? -> ?Bitmap Heap Scan on name n ?(cost=640.81..31557.42 rows=20521 width=4)
> ? ? ? ? Recheck Cond: (lower((name)::text) = 'foo'::text)
> ? ? ? ? Filter: (display_name > 0)
> ? ? ? ? -> ?Bitmap Index Scan on lowername ?(cost=0.00..635.68 rows=20597
> width=0)
> ? ? ? ? ? ? ? Index Cond: (lower((name)::text) = 'foo'::text)
> ? -> ?Index Scan using feature_pkey on feature f ?(cost=0.00..7.02 rows=1
> width=501
> ? ? ? ? Index Cond: (f.id = n.id)
> (8 rows)
>
>
> This has much better performance in practice, since it's not sequentially
> scanning the 4.1M row "name" table.
>
> This suggests to me that the varchar_pattern_ops class should be removed,
> but could one of the original BDBSFS::Pg authors (like Lincoln or Scott)
> weigh in on this?
>
> Rob
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research


From randalls at bioinfo.wsu.edu  Wed Apr  7 23:30:37 2010
From: randalls at bioinfo.wsu.edu (randalls at bioinfo.wsu.edu)
Date: Wed, 7 Apr 2010 19:30:37 -0800 (PST)
Subject: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why
 varchar_pattern_ops?
In-Reply-To: <1909509824.13841270697376707.JavaMail.root@mail>
Message-ID: <1470233258.13861270697437526.JavaMail.root@mail>

Wow, I really stirred up the bees nest........

The varchar_pattern_ops is needed only if your locale is not C or POSIX. Mine is en_US.UTF-8 as demonstrated by SHOW LC_COLLATE;

This is as I understand set when initdb is ran and is set for the life of the datbase cluster (i.e. all those files and folders in $PGDATA).   

I am wondering if the Pg.pm module could detect the locale and set the appropriate indexes when the database is created.  Perhaps that would be the smarter way to do it?  

Rob, What is your Locale set to?  I am guessing it is C or Posix or something related.  Do you specify a locale when you run initdb or do you let initdb select it for you?

Thanks,

Randall Svancara
Systems Administrator/DBA/Developer
Main Bioinformatics Laboratory



----- Original Message -----
From: "Scott Cain" <scott at scottcain.net>
To: "Robert Buels" <rmb32 at cornell.edu>
Cc: "BioPerl List" <bioperl-l at lists.open-bio.org>, randalls at bioinfo.wsu.edu
Sent: Wednesday, April 7, 2010 7:44:48 PM
Subject: Re: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why 	varchar_pattern_ops?

Hi Rob,

I was a little concerned that this might happen.  This change was
suggested by Randall on the GBrowse mailing list a few weeks ago, and
after some testing on my machine, it seemed to work well.  The problem
was that wild card searches on the name column were seqscanning, and
the suggested index fixed the problem.  I wonder if the query planner
in postgres would be smart enough to use the appropriate index if we
created both one with and one without varchar_pattern_ops.

The reason for using varchar_pattern_ops specifically was to allow for
searching in a non-C locale.  Another option would be to make the
creation of the index conditional when the database is created.  It
could use the standard C locale setting and if a flag is set, create
the index to allow non-C locale searches (and presumably, the default
C locale would be the right thing for most users).

Scott


On Wed, Apr 7, 2010 at 8:23 PM, Robert Buels <rmb32 at cornell.edu> wrote:
> What's the thinking behind the BDBSFS::Pg (ha) index on the "name" table at
> Pg.pm line 282:
>
> ? ?CREATE INDEX name_name_varchar_patt_ops_idx ON name USING BTREE
> ? ?(lower(name) varchar_pattern_ops);
>
> Why the varchar_pattern_ops operator class?
>
> I'm testing an installation (backing gbrowse, of course) on Pg 8.3, and
> performance was really stinking on the SFS query:
>
> ? ?SELECT f.id,f.object,f.typeid,f.seqid,f.start,f.end,f.strand
> ? ?FROM feature as f, name as n
> ? ?WHERE (n.id=f.id AND lower(n.name) = lower($1) AND n.display_name>0)
>
> so I explained it, giving
>
> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?QUERY PLAN
> --------------------------------------------------------------------------------------
> ?Nested Loop ?(cost=0.00..130159.60 rows=11059 width=556)
> ? -> ?Seq Scan on name n ?(cost=0.00..53489.41 rows=11059 width=4)
> ? ? ? ? Filter: ((display_name > 0) AND (lower((name)::text) = 'foo'::text))
> ? -> ?Index Scan using feature_pkey on feature f ?(cost=0.00..6.92 rows=1
> width=556)
> ? ? ? ? Index Cond: (f.id = n.id)
>
>
> Seq scan, not good. ?It's not using the name_name_varchar_patt_ops_idx. ?So
> I added an index on just lower(name) without the varchar_pattern_ops
> business (create index lowername on name ( lower(name) )) and performance
> started getting fine again, with explain:
>
>
> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?QUERY PLAN
> ------------------------------------------------------------------------------------
> ?Nested Loop ?(cost=640.81..175775.44 rows=20521 width=501)
> ? -> ?Bitmap Heap Scan on name n ?(cost=640.81..31557.42 rows=20521 width=4)
> ? ? ? ? Recheck Cond: (lower((name)::text) = 'foo'::text)
> ? ? ? ? Filter: (display_name > 0)
> ? ? ? ? -> ?Bitmap Index Scan on lowername ?(cost=0.00..635.68 rows=20597
> width=0)
> ? ? ? ? ? ? ? Index Cond: (lower((name)::text) = 'foo'::text)
> ? -> ?Index Scan using feature_pkey on feature f ?(cost=0.00..7.02 rows=1
> width=501
> ? ? ? ? Index Cond: (f.id = n.id)
> (8 rows)
>
>
> This has much better performance in practice, since it's not sequentially
> scanning the 4.1M row "name" table.
>
> This suggests to me that the varchar_pattern_ops class should be removed,
> but could one of the original BDBSFS::Pg authors (like Lincoln or Scott)
> weigh in on this?
>
> Rob
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research


From cjfields at illinois.edu  Thu Apr  8 10:43:42 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 8 Apr 2010 09:43:42 -0500
Subject: [Bioperl-l] Google summer of code
In-Reply-To: <4BB50B83.70006@cornell.edu>
References: <95DC9D02-8DF7-4AFB-A29C-5F0401D58197@iscb.org>
	<4BB50B83.70006@cornell.edu>
Message-ID: <6C20F377-8ED8-4138-ADAE-343183D1FEE1@illinois.edu>

Benard,

Just a reminder, if you intend on submitting a proposal for GSoC, the deadline is tomorrow (April 9).  We can go over specifics in the meantime.

chris

On Apr 1, 2010, at 4:09 PM, Robert Buels wrote:

> Hi Benard,
> 
> Glad to hear you're interested.
> 
> Be sure to read through the OBF and GSoC wiki pages about the application process, and let us know if you have any questions.
> 
> We're also more than happy to help you edit your proposal on this list.
> 
> Hope this helps!
> 
> Rob
> 
> Benard Kulohoma wrote:
>> Dear Sir, Madam,
>> Hello. I would like to express my interest in joining this group in the google summer of code.
>> I am especially interested in:  BioPerl 2.0 (and beyond)
>> Many thanks,
>> Benard
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From robert.bradbury at gmail.com  Thu Apr  8 12:24:58 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Thu, 8 Apr 2010 12:24:58 -0400
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
In-Reply-To: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>
References: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>
Message-ID: <o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>

On 4/6/10, lin yu <joycelin12 at gmail.com> wrote:
> Therefore, I would like to propose the use of BioPerl in access R
> phlyogenetic tools or the combination of R and BioPerl in other similar
> applications like microarray analysis etc. Would it be possible? I would
> like to know the answer as soon as possible as I can edit my proposal in the
> case.

Joyce, it isn't clear what you are really asking for here.  I did some
digging and it appears as if "R" is a statistical language derived
from S:
http://www.r-project.org/
It isn't clear whether there is currently a toolset of phylogenetics
applications that use R (if so could you provide a pointer or some
examples)?

In theory one can interface perl programs to anything since it has
complete system call capabilities.  Presumably the advantage from a
BioPerl standpoint is to have BioPerl deal with the databases, genes,
genomes, etc. (something R presumably does not do) and have R deal
with the statistics side of any analysis.  But one needs a more
complete examination of what statistical aspects of phylogenetics
BioPerl does not currently handle (and could be better handled by
taking advantage of features which R might have).

[In my opinion currently there is already way too much overlap in
tools packages with BioPerl, BioPython and BioRuby -- and there is no
matrix regarding the capabilities or lack thereof with each of these
so one could easily tell which of the three could or should best be
interfaced to R.]

It looks as if the phyloinformatics project is here:
https://www.nescent.org/wg/phyloinformatics/index.php?title=Phyloinformatics_Summer_of_Code_2010
but it isn't clear whether there is any coordination between the
BioPerl side of things and the Phyloinformatics side of things.

From biopython at maubp.freeserve.co.uk  Thu Apr  8 12:29:15 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 8 Apr 2010 17:29:15 +0100
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
In-Reply-To: <o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>
References: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>
	<o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>
Message-ID: <o2t320fb6e01004080929j94c4a57ar6c2a0b44545aa044@mail.gmail.com>

On Thu, Apr 8, 2010 at 5:24 PM, Robert Bradbury
<robert.bradbury at gmail.com> wrote:
> On 4/6/10, lin yu <joycelin12 at gmail.com> wrote:
>> Therefore, I would like to propose the use of BioPerl in access R
>> phlyogenetic tools or the combination of R and BioPerl in other similar
>> applications like microarray analysis etc. Would it be possible? I would
>> like to know the answer as soon as possible as I can edit my proposal in the
>> case.
>
> Joyce, it isn't clear what you are really asking for here. ?I did some
> digging and it appears as if "R" is a statistical language derived
> from S:
> http://www.r-project.org/

Yes. Joyce was talking about the GSoC proposal "Biopython and
PyCogent interoperability", but switching from Python and R to
Perl and R. See this thread (which as more helpful subject):
http://lists.open-bio.org/pipermail/bioperl-l/2010-April/032729.html

Peter


From cjfields at illinois.edu  Thu Apr  8 12:34:09 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 8 Apr 2010 11:34:09 -0500
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
In-Reply-To: <o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>
References: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>
	<o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>
Message-ID: <D3A3F801-3980-4632-96F2-88F1121D0CFC@illinois.edu>


On Apr 8, 2010, at 11:24 AM, Robert Bradbury wrote:

> On 4/6/10, lin yu <joycelin12 at gmail.com> wrote:
>> Therefore, I would like to propose the use of BioPerl in access R
>> phlyogenetic tools or the combination of R and BioPerl in other similar
>> applications like microarray analysis etc. Would it be possible? I would
>> like to know the answer as soon as possible as I can edit my proposal in the
>> case.
> 
> Joyce, it isn't clear what you are really asking for here.  I did some
> digging and it appears as if "R" is a statistical language derived
> from S:
> http://www.r-project.org/
> It isn't clear whether there is currently a toolset of phylogenetics
> applications that use R (if so could you provide a pointer or some
> examples)?

Answering for her, but there are many.  Here's one just via a Google search using 'R phylogenetics':

http://www.r-phylo.org/wiki/Main_Page

> In theory one can interface perl programs to anything since it has
> complete system call capabilities.  Presumably the advantage from a
> BioPerl standpoint is to have BioPerl deal with the databases, genes,
> genomes, etc. (something R presumably does not do) and have R deal
> with the statistics side of any analysis.  But one needs a more
> complete examination of what statistical aspects of phylogenetics
> BioPerl does not currently handle (and could be better handled by
> taking advantage of features which R might have).
> 
> [In my opinion currently there is already way too much overlap in
> tools packages with BioPerl, BioPython and BioRuby -- and there is no
> matrix regarding the capabilities or lack thereof with each of these
> so one could easily tell which of the three could or should best be
> interfaced to R.]

Python has a very nice R interface I believe.

> It looks as if the phyloinformatics project is here:
> https://www.nescent.org/wg/phyloinformatics/index.php?title=Phyloinformatics_Summer_of_Code_2010
> but it isn't clear whether there is any coordination between the
> BioPerl side of things and the Phyloinformatics side of things.

There is overlap between the two organizations to a certain extent.  I could see having a direct set of bindings to R would be very nice from the BioPerl standpoint, but the project is really more a general Perl project in this case (R isn't just about microarrays or biostats).  The lone Perl-based interface, RSPerl, is no longer maintained that I know of (I never got it to work).

chris



From joycelin12 at gmail.com  Thu Apr  8 12:53:20 2010
From: joycelin12 at gmail.com (lin yu)
Date: Thu, 8 Apr 2010 09:53:20 -0700
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
In-Reply-To: <D3A3F801-3980-4632-96F2-88F1121D0CFC@illinois.edu>
References: <u2y7ecbf9ed1004061818ic9347714qb4bad213cea6a06c@mail.gmail.com>
	<o2xdeaa866a1004080924pf9c3fa92t21ea8fe594b78c58@mail.gmail.com>
	<D3A3F801-3980-4632-96F2-88F1121D0CFC@illinois.edu>
Message-ID: <w2y7ecbf9ed1004080953ld03576c6h5a02766a7d8242ea@mail.gmail.com>

Hi all

Thanks for the comments. I would try the project in R and python instead.
Thank you.



On Thu, Apr 8, 2010 at 9:34 AM, Chris Fields <cjfields at illinois.edu> wrote:

>
> On Apr 8, 2010, at 11:24 AM, Robert Bradbury wrote:
>
> > On 4/6/10, lin yu <joycelin12 at gmail.com> wrote:
> >> Therefore, I would like to propose the use of BioPerl in access R
> >> phlyogenetic tools or the combination of R and BioPerl in other similar
> >> applications like microarray analysis etc. Would it be possible? I would
> >> like to know the answer as soon as possible as I can edit my proposal in
> the
> >> case.
> >
> > Joyce, it isn't clear what you are really asking for here.  I did some
> > digging and it appears as if "R" is a statistical language derived
> > from S:
> > http://www.r-project.org/
> > It isn't clear whether there is currently a toolset of phylogenetics
> > applications that use R (if so could you provide a pointer or some
> > examples)?
>
> Answering for her, but there are many.  Here's one just via a Google search
> using 'R phylogenetics':
>
> http://www.r-phylo.org/wiki/Main_Page
>
> > In theory one can interface perl programs to anything since it has
> > complete system call capabilities.  Presumably the advantage from a
> > BioPerl standpoint is to have BioPerl deal with the databases, genes,
> > genomes, etc. (something R presumably does not do) and have R deal
> > with the statistics side of any analysis.  But one needs a more
> > complete examination of what statistical aspects of phylogenetics
> > BioPerl does not currently handle (and could be better handled by
> > taking advantage of features which R might have).
> >
> > [In my opinion currently there is already way too much overlap in
> > tools packages with BioPerl, BioPython and BioRuby -- and there is no
> > matrix regarding the capabilities or lack thereof with each of these
> > so one could easily tell which of the three could or should best be
> > interfaced to R.]
>
> Python has a very nice R interface I believe.
>
> > It looks as if the phyloinformatics project is here:
> >
> https://www.nescent.org/wg/phyloinformatics/index.php?title=Phyloinformatics_Summer_of_Code_2010
> > but it isn't clear whether there is any coordination between the
> > BioPerl side of things and the Phyloinformatics side of things.
>
> There is overlap between the two organizations to a certain extent.  I
> could see having a direct set of bindings to R would be very nice from the
> BioPerl standpoint, but the project is really more a general Perl project in
> this case (R isn't just about microarrays or biostats).  The lone Perl-based
> interface, RSPerl, is no longer maintained that I know of (I never got it to
> work).
>
> chris
>
>


-- 
Best regards
Joyce Lin

From m.wayne.davis at gmail.com  Thu Apr  8 13:07:17 2010
From: m.wayne.davis at gmail.com (Wayne Davis)
Date: Thu, 8 Apr 2010 11:07:17 -0600
Subject: [Bioperl-l] Bio::SeqIO::genbank
Message-ID: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>

I'm not a reader or the bioperl list, but this might be a format to
address a question that I'm dealing with:

I have a parser (non-Perl) that is having some trouble with "genbank"
formatted files.
The troublesome files are from from another source that uses bioperl
to write their files with Bio::SeqIO::genbank


Trouble is that the molecule type (in the LOCUS line) they are writing
is free text, as allowed by the Bioperl  Bio::SeqIO::genbank module:

	    $temp_line = sprintf ("%-12s%-15s%13s %s%4s%-8s%-8s %3s %-s",
				  'LOCUS', $seq->id(),$len,
				  (lc($alpha) eq 'protein') ? ('aa','', '') :
				  ('bp', '',$mol),$circular,
				  $div,$date);


however the genbank file definition at
ftp://ftp.ncbi.nih.gov/genbank/gbrel.txt

section 3.4.4 specifies the format for the LOCUS line:
in the table of column positions they specify a limited vocabulary of
fixed width:
"48-53      NA, DNA, RNA, tRNA (transfer RNA), rRNA (ribosomal RNA),
          mRNA (messenger RNA), uRNA (small nuclear RNA), snRNA,
          snoRNA. Left justified."


which to me strongly suggests that the genbank file format requires a
fixed vocabulary for molecule type.

Seems that in Bio::SeqIO::genbank at
	if( !$seq->can('molecule') || ! defined ($mol = $seq->molecule()) ) {
	    $mol =  $alpha || 'DNA';
	}

if $mol is not in the fixed list of genbank molecule types it should
be set to the default value of 'DNA', or some other smarter way of
forcing the molecule type into the fixed vocabulary would be a help.

Thanks for any replies.



-- 
Wayne Davis

Department of Biology
University of Utah
257 South 1400 East
Salt Lake City, UT 84112-0840
(801) 585-3692

From rmb32 at cornell.edu  Thu Apr  8 15:05:05 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Thu, 08 Apr 2010 12:05:05 -0700
Subject: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why
 varchar_pattern_ops?
In-Reply-To: <i2i4536f7701004071944o2767734fo8e5f20589fbf4120@mail.gmail.com>
References: <4BBD21F2.60203@cornell.edu>
	<i2i4536f7701004071944o2767734fo8e5f20589fbf4120@mail.gmail.com>
Message-ID: <4BBE28E1.2060001@cornell.edu>

Hmm, well, the vanilla index seems necessary for my pg 8.3.9/ubuntu 
hardy/utf8 locales/UTF8 encoding installation.  If both a 
varchar_pattern_ops and a vanilla index are present, will installations 
that need the varchar_pattern_ops one use it?  Randall, do you have an 
installation you can test that on?

Rob


Scott Cain wrote:
> Hi Rob,
> 
> I was a little concerned that this might happen.  This change was
> suggested by Randall on the GBrowse mailing list a few weeks ago, and
> after some testing on my machine, it seemed to work well.  The problem
> was that wild card searches on the name column were seqscanning, and
> the suggested index fixed the problem.  I wonder if the query planner
> in postgres would be smart enough to use the appropriate index if we
> created both one with and one without varchar_pattern_ops.
> 
> The reason for using varchar_pattern_ops specifically was to allow for
> searching in a non-C locale.  Another option would be to make the
> creation of the index conditional when the database is created.  It
> could use the standard C locale setting and if a flag is set, create
> the index to allow non-C locale searches (and presumably, the default
> C locale would be the right thing for most users).
> 
> Scott
> 
> 
> On Wed, Apr 7, 2010 at 8:23 PM, Robert Buels <rmb32 at cornell.edu> wrote:
>> What's the thinking behind the BDBSFS::Pg (ha) index on the "name" table at
>> Pg.pm line 282:
>>
>>    CREATE INDEX name_name_varchar_patt_ops_idx ON name USING BTREE
>>    (lower(name) varchar_pattern_ops);
>>
>> Why the varchar_pattern_ops operator class?
>>
>> I'm testing an installation (backing gbrowse, of course) on Pg 8.3, and
>> performance was really stinking on the SFS query:
>>
>>    SELECT f.id,f.object,f.typeid,f.seqid,f.start,f.end,f.strand
>>    FROM feature as f, name as n
>>    WHERE (n.id=f.id AND lower(n.name) = lower($1) AND n.display_name>0)
>>
>> so I explained it, giving
>>
>>                                      QUERY PLAN
>> --------------------------------------------------------------------------------------
>>  Nested Loop  (cost=0.00..130159.60 rows=11059 width=556)
>>   ->  Seq Scan on name n  (cost=0.00..53489.41 rows=11059 width=4)
>>         Filter: ((display_name > 0) AND (lower((name)::text) = 'foo'::text))
>>   ->  Index Scan using feature_pkey on feature f  (cost=0.00..6.92 rows=1
>> width=556)
>>         Index Cond: (f.id = n.id)
>>
>>
>> Seq scan, not good.  It's not using the name_name_varchar_patt_ops_idx.  So
>> I added an index on just lower(name) without the varchar_pattern_ops
>> business (create index lowername on name ( lower(name) )) and performance
>> started getting fine again, with explain:
>>
>>
>>                                      QUERY PLAN
>> ------------------------------------------------------------------------------------
>>  Nested Loop  (cost=640.81..175775.44 rows=20521 width=501)
>>   ->  Bitmap Heap Scan on name n  (cost=640.81..31557.42 rows=20521 width=4)
>>         Recheck Cond: (lower((name)::text) = 'foo'::text)
>>         Filter: (display_name > 0)
>>         ->  Bitmap Index Scan on lowername  (cost=0.00..635.68 rows=20597
>> width=0)
>>               Index Cond: (lower((name)::text) = 'foo'::text)
>>   ->  Index Scan using feature_pkey on feature f  (cost=0.00..7.02 rows=1
>> width=501
>>         Index Cond: (f.id = n.id)
>> (8 rows)
>>
>>
>> This has much better performance in practice, since it's not sequentially
>> scanning the 4.1M row "name" table.
>>
>> This suggests to me that the varchar_pattern_ops class should be removed,
>> but could one of the original BDBSFS::Pg authors (like Lincoln or Scott)
>> weigh in on this?
>>
>> Rob
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> 
> 
> 


From David.Messina at sbc.su.se  Thu Apr  8 15:39:46 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 8 Apr 2010 21:39:46 +0200
Subject: [Bioperl-l] Bio::SeqIO::genbank
In-Reply-To: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>
References: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>
Message-ID: <ABBB5884-F464-4867-BC32-A24CC3A540EA@sbc.su.se>

Hi Wayne,

> if $mol is not in the fixed list of genbank molecule types it should
> be set to the default value of 'DNA', or some other smarter way of
> forcing the molecule type into the fixed vocabulary would be a help.

Sounds good to me. Did you modify your local copy of Bio::SeqIO::genbank and try it out?

I will say, though, that Genbank is a tricky format, both to read and to write. Even if BioPerl would write Genbank records that are fully compliant with the spec, I'm pretty sure they would not be round-trippable*. That is, if you read a Genbank record into BioPerl and then wrote it back out, the output wouldn't exactly match the input.

I think that NCBI is trying to nudge people toward their XML format. I know it won't help this particular situation, but it might be an option to consider for the future.

Speaking of which, what is the current status of the BioPerl Genbank XML parser? Jay, did you ever release that?


Dave



* not that they were designed to be: http://www.bioperl.org/wiki/HOWTO:SeqIO#Caveats

From scott at scottcain.net  Thu Apr  8 15:40:47 2010
From: scott at scottcain.net (Scott Cain)
Date: Thu, 8 Apr 2010 15:40:47 -0400
Subject: [Bioperl-l] Bio::DB::SeqFeature::Store::Pg index on "name": why
	varchar_pattern_ops?
In-Reply-To: <4BBE28E1.2060001@cornell.edu>
References: <4BBD21F2.60203@cornell.edu>
	<i2i4536f7701004071944o2767734fo8e5f20589fbf4120@mail.gmail.com>
	<4BBE28E1.2060001@cornell.edu>
Message-ID: <t2r4536f7701004081240t385b73b1ze917283d8f4bd228@mail.gmail.com>

>From what I've read, if you have both vanilla and varch_pattern_ops,
the query planner will decide (presumably correctly) which index to
use.

Scott


On Thu, Apr 8, 2010 at 3:05 PM, Robert Buels <rmb32 at cornell.edu> wrote:
> Hmm, well, the vanilla index seems necessary for my pg 8.3.9/ubuntu
> hardy/utf8 locales/UTF8 encoding installation. ?If both a
> varchar_pattern_ops and a vanilla index are present, will installations that
> need the varchar_pattern_ops one use it? ?Randall, do you have an
> installation you can test that on?
>
> Rob
>
>
> Scott Cain wrote:
>>
>> Hi Rob,
>>
>> I was a little concerned that this might happen. ?This change was
>> suggested by Randall on the GBrowse mailing list a few weeks ago, and
>> after some testing on my machine, it seemed to work well. ?The problem
>> was that wild card searches on the name column were seqscanning, and
>> the suggested index fixed the problem. ?I wonder if the query planner
>> in postgres would be smart enough to use the appropriate index if we
>> created both one with and one without varchar_pattern_ops.
>>
>> The reason for using varchar_pattern_ops specifically was to allow for
>> searching in a non-C locale. ?Another option would be to make the
>> creation of the index conditional when the database is created. ?It
>> could use the standard C locale setting and if a flag is set, create
>> the index to allow non-C locale searches (and presumably, the default
>> C locale would be the right thing for most users).
>>
>> Scott
>>
>>
>> On Wed, Apr 7, 2010 at 8:23 PM, Robert Buels <rmb32 at cornell.edu> wrote:
>>>
>>> What's the thinking behind the BDBSFS::Pg (ha) index on the "name" table
>>> at
>>> Pg.pm line 282:
>>>
>>> ? CREATE INDEX name_name_varchar_patt_ops_idx ON name USING BTREE
>>> ? (lower(name) varchar_pattern_ops);
>>>
>>> Why the varchar_pattern_ops operator class?
>>>
>>> I'm testing an installation (backing gbrowse, of course) on Pg 8.3, and
>>> performance was really stinking on the SFS query:
>>>
>>> ? SELECT f.id,f.object,f.typeid,f.seqid,f.start,f.end,f.strand
>>> ? FROM feature as f, name as n
>>> ? WHERE (n.id=f.id AND lower(n.name) = lower($1) AND n.display_name>0)
>>>
>>> so I explained it, giving
>>>
>>> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? QUERY PLAN
>>>
>>> --------------------------------------------------------------------------------------
>>> ?Nested Loop ?(cost=0.00..130159.60 rows=11059 width=556)
>>> ?-> ?Seq Scan on name n ?(cost=0.00..53489.41 rows=11059 width=4)
>>> ? ? ? ?Filter: ((display_name > 0) AND (lower((name)::text) =
>>> 'foo'::text))
>>> ?-> ?Index Scan using feature_pkey on feature f ?(cost=0.00..6.92 rows=1
>>> width=556)
>>> ? ? ? ?Index Cond: (f.id = n.id)
>>>
>>>
>>> Seq scan, not good. ?It's not using the name_name_varchar_patt_ops_idx.
>>> ?So
>>> I added an index on just lower(name) without the varchar_pattern_ops
>>> business (create index lowername on name ( lower(name) )) and performance
>>> started getting fine again, with explain:
>>>
>>>
>>> ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? QUERY PLAN
>>>
>>> ------------------------------------------------------------------------------------
>>> ?Nested Loop ?(cost=640.81..175775.44 rows=20521 width=501)
>>> ?-> ?Bitmap Heap Scan on name n ?(cost=640.81..31557.42 rows=20521
>>> width=4)
>>> ? ? ? ?Recheck Cond: (lower((name)::text) = 'foo'::text)
>>> ? ? ? ?Filter: (display_name > 0)
>>> ? ? ? ?-> ?Bitmap Index Scan on lowername ?(cost=0.00..635.68 rows=20597
>>> width=0)
>>> ? ? ? ? ? ? ?Index Cond: (lower((name)::text) = 'foo'::text)
>>> ?-> ?Index Scan using feature_pkey on feature f ?(cost=0.00..7.02 rows=1
>>> width=501
>>> ? ? ? ?Index Cond: (f.id = n.id)
>>> (8 rows)
>>>
>>>
>>> This has much better performance in practice, since it's not sequentially
>>> scanning the 4.1M row "name" table.
>>>
>>> This suggests to me that the varchar_pattern_ops class should be removed,
>>> but could one of the original BDBSFS::Pg authors (like Lincoln or Scott)
>>> weigh in on this?
>>>
>>> Rob
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research


From cjfields at illinois.edu  Thu Apr  8 16:09:09 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 08 Apr 2010 15:09:09 -0500
Subject: [Bioperl-l] Bio::SeqIO::genbank
In-Reply-To: <ABBB5884-F464-4867-BC32-A24CC3A540EA@sbc.su.se>
References: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>
	<ABBB5884-F464-4867-BC32-A24CC3A540EA@sbc.su.se>
Message-ID: <1270757349.10382.2.camel@pyrimidine.igb.uiuc.edu>

On Thu, 2010-04-08 at 21:39 +0200, Dave Messina wrote: 
> Hi Wayne,
> 
> > if $mol is not in the fixed list of genbank molecule types it should
> > be set to the default value of 'DNA', or some other smarter way of
> > forcing the molecule type into the fixed vocabulary would be a help.
> 
> Sounds good to me. Did you modify your local copy of Bio::SeqIO::genbank and try it out?
> 
> I will say, though, that Genbank is a tricky format, both to read and to write. Even if BioPerl would write Genbank records that are fully compliant with the spec, I'm pretty sure they would not be round-trippable*. That is, if you read a Genbank record into BioPerl and then wrote it back out, the output wouldn't exactly match the input.

This is true.  Jason and I talked about this recently and arrived pretty
much at the same conclusion.  We're mainly interested in parsing data
into a usable framework for manipulation.  Recreating data isn't our top
priority.

> I think that NCBI is trying to nudge people toward their XML format. I know it won't help this particular situation, but it might be an option to consider for the future.

The only problem I had with the XML spit out from eutils has been it was
an on-the-fly conversion of the ASN.1.  Not sure what the status of it
is now.

What's going on with the INSDC XML format?  That was supposed to be an
international standard and appeared more lightweight (if such a thing
can be said about XML).

> Speaking of which, what is the current status of the BioPerl Genbank XML parser? Jay, did you ever release that?
> 
> 
> Dave
> 
> 
> 
> * not that they were designed to be: http://www.bioperl.org/wiki/HOWTO:SeqIO#Caveats

I think it was in a branch, can't recall.

chris




From maj at fortinbras.us  Thu Apr  8 16:15:55 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 08 Apr 2010 20:15:55 +0000
Subject: [Bioperl-l] Bio::SeqIO::genbank
Message-ID: <W57622606581471270757755@webmail33>

FWIW -In my SoapE investigations I found NCBI-hosted XML schema for insdc, but didn't ever run across a format descriptor that gets return data in that format-- MAJ

>-----Original Message-----
>From: Chris Fields [mailto:cjfields at illinois.edu]
>Sent: Thursday, April 8, 2010 04:09 PM
>To: 'Dave Messina'
>Cc: 'bioperl-l', 'Wayne Davis'
>Subject: Re: [Bioperl-l] Bio::SeqIO::genbank
>
>On Thu, 2010-04-08 at 21:39 +0200, Dave Messina wrote: 
>> Hi Wayne,
>> 
>> > if $mol is not in the fixed list of genbank molecule types it should
>> > be set to the default value of 'DNA', or some other smarter way of
>> > forcing the molecule type into the fixed vocabulary would be a help.
>> 
>> Sounds good to me. Did you modify your local copy of Bio::SeqIO::genbank and try it out?
>> 
>> I will say, though, that Genbank is a tricky format, both to read and to write. Even if BioPerl would write Genbank records that are fully compliant with the spec, I'm pretty sure they would not be round-trippable*. That is, if you read a Genbank record into BioPerl and then wrote it back out, the output wouldn't exactly match the input.
>
>This is true.  Jason and I talked about this recently and arrived pretty
>much at the same conclusion.  We're mainly interested in parsing data
>into a usable framework for manipulation.  Recreating data isn't our top
>priority.
>
>> I think that NCBI is trying to nudge people toward their XML format. I know it won't help this particular situation, but it might be an option to consider for the future.
>
>The only problem I had with the XML spit out from eutils has been it was
>an on-the-fly conversion of the ASN.1.  Not sure what the status of it
>is now.
>
>What's going on with the INSDC XML format?  That was supposed to be an
>international standard and appeared more lightweight (if such a thing
>can be said about XML).
>
>> Speaking of which, what is the current status of the BioPerl Genbank XML parser? Jay, did you ever release that?
>> 
>> 
>> Dave
>> 
>> 
>> 
>> * not that they were designed to be: http://www.bioperl.org/wiki/HOWTO:SeqIO#Caveats
>
>I think it was in a branch, can't recall.
>
>chris
>
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at lists.open-bio.org
>http://lists.open-bio.org/mailman/listinfo/bioperl-l
>




From David.Messina at sbc.su.se  Thu Apr  8 16:36:27 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 8 Apr 2010 22:36:27 +0200
Subject: [Bioperl-l] Bio::SeqIO::genbank
In-Reply-To: <q2mccf7a8eb1004081300wcf756014qd0d1b63c8b36cd84@mail.gmail.com>
References: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>
	<ABBB5884-F464-4867-BC32-A24CC3A540EA@sbc.su.se>
	<q2mccf7a8eb1004081300wcf756014qd0d1b63c8b36cd84@mail.gmail.com>
Message-ID: <320603F7-71B5-4587-97BC-AB6E3B935884@sbc.su.se>

Hi,

Please keep the list on the Cc so everyone can follow along.


> I'm not a Bioperl member, or even conversant in Perl, so I was hoping
> someone out there might be interested in picking up the ball here. I
> could find the relevant section of the code pretty quickly, but I'm
> not sure you want me mucking around with it.

Ah, I got you. When you quoted the code before I thought you might have dived right in. :) No problem ? could you submit this as a request to our bug tracker?

http://bugzilla.open-bio.org/



> Round-trippable isn't a problem for me- I agree that you can impose
> some other structure on the data internally, as the caveats mention- I
> just need output that I can parse without specifically looking for
> non-standard forms.



Dave



From David.Messina at sbc.su.se  Thu Apr  8 16:57:52 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Thu, 8 Apr 2010 22:57:52 +0200
Subject: [Bioperl-l] Bio::SeqIO::genbank
In-Reply-To: <1270757349.10382.2.camel@pyrimidine.igb.uiuc.edu>
References: <l2lccf7a8eb1004081007p9abce81dk65da1bad8070552@mail.gmail.com>
	<ABBB5884-F464-4867-BC32-A24CC3A540EA@sbc.su.se>
	<1270757349.10382.2.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <3B950444-E5D6-41EC-AB8E-418407009D2F@sbc.su.se>

> The only problem I had with the XML spit out from eutils has been it was
> an on-the-fly conversion of the ASN.1.  Not sure what the status of it
> is now.

Oh, that's right. I remember you saying that at some point.


> What's going on with the INSDC XML format?  That was supposed to be an
> international standard and appeared more lightweight (if such a thing
> can be said about XML).

This page references 2006 as the present and near future, so that's not encouraging.
http://insdc.org/xmlstatus.html


I'll take the opportunity to shamelessly plug the lightweight (really!) XML sequence format developed in my lab, SeqXML, which we made when we got fed up with overloaded FASTA headers. There's a BioPerl SeqIO module for it.

Details and example code at: http://seqxml.org


Dave



From diegochavesm at gmail.com  Thu Apr  8 16:05:02 2010
From: diegochavesm at gmail.com (Diego Chaves Moreno)
Date: Thu, 08 Apr 2010 15:05:02 -0500
Subject: [Bioperl-l] parsering signal-p output
Message-ID: <E0D56849-9523-41EF-8A2F-2AFE5211B91D@gmail.com>

Hi everyone,

im a new user of bioperl modules. I tried to make a parser to signal-p output using Bio::Tols::Signalp (code forward). The parser is working and i need use the information in $seq_id variable (in red) but  when i tried to  print this variable the value is empty, the same is with $name_seq variable (blue).

Thanks, 

Diego Chaves Moreno
Los Andes University
Bogota-Colombia

code
========================

#!/usr/bin/perl
use strict;
use Bio::Tools::Signalp;

my $file = $ARGV[0];
 my $parser = Bio::Tools::Signalp->new(-file =>$file );
        while( my $sp_feat = $parser->next_result()) {
                my $start = $sp_feat->start();
                my $end = $sp_feat->end();
                my $len = $sp_feat->length();
                my $strand = $sp_feat->strand();
                my $score = $sp_feat->score();
                my $frame = $sp_feat->frame();
                my $featname = $sp_feat->display_name();
                my $seq_id = $sp_feat->seq_id();
                my $whole_seq = $sp_feat->entire_seq();
                my $name_seq = $sp_feat->seq_id();

                        while(my $location = $sp_feat->location()){
                                my $location_type = $location->location_type();
                                my $start_L = $location->start();
                                my $end_L = $location->end();
                                my $minstart = $location->min_start();
                                my $maxstart = $location->max_start();
                                my $start_pos_type = $location->start_pos_type();
                                my $minend = $location->min_end();
                                my $maxend = $location->max_end();
                                my $seqidL = $location->seq_id();


From kellert at ohsu.edu  Thu Apr  8 18:30:13 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Thu, 8 Apr 2010 15:30:13 -0700
Subject: [Bioperl-l] SeqIO::abi use
Message-ID: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>

Greetings,
Can the Bio::SeqIO::abi module be used to access the raw fluorescence data? Are there any examples available? I'm wondering how to calculate ratios of mixed bases prior to the smoothing and scaling done by the base caller.

thank you
Tom
kellert at ohsu.edu<mailto:kellert at ohsu.edu>
503-494-2442









From David.Messina at sbc.su.se  Thu Apr  8 19:10:42 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Fri, 9 Apr 2010 01:10:42 +0200
Subject: [Bioperl-l] parsering signal-p output
In-Reply-To: <E0D56849-9523-41EF-8A2F-2AFE5211B91D@gmail.com>
References: <E0D56849-9523-41EF-8A2F-2AFE5211B91D@gmail.com>
Message-ID: <A68D37CC-9582-4DC6-9E2D-F7ADF446BBF6@sbc.su.se>

Hi Diego,

>  but  when i tried to  print this variable the value is empty, the same is with $name_seq variable (blue).

Is the code you gave us incomplete? I ask because there isn't a print statement, and without seeing where you're trying to print it's difficult to figure out what might be going wrong.

Assuming that the placement of the print statement isn't the problem, though, we would need a sample input file to be able to reproduce your problem.

For that, it might be best to submit your code and the input file at bugzilla.open-bio.org.


Dave



From lpritc at scri.ac.uk  Fri Apr  9 09:06:33 2010
From: lpritc at scri.ac.uk (Leighton Pritchard)
Date: Fri, 09 Apr 2010 14:06:33 +0100
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
 origin-spanning features, and GFF3
Message-ID: <C7E4E4E9.33A71%lpritc@scri.ac.uk>

Hi,

(cc'd to Lincoln due to GFF3 relevance)

I've recently been trying to use BioPerl, CHADO and GBROWSE to represent
bacterial genome sequences.  In doing this, I've been testing with GenBank
genome/feature files, converting these to GFF3 with bp_genbank2gff3.pl to
get a CHADO-friendly gene model.  There appears to be an issue when
converting GenBank files that contain features which span the genomic
origin.

For example, the GenBank file NC_002127.gbk describes a plasmid from E.coli
O157H7.  This contains the following feature which spans the reference
sequence origin:

     gene            join(92527..92721,1..2502)
                     /gene="tagA"
                     /locus_tag="pO157p01"
                     /db_xref="GeneID:1789672"
     CDS             join(92527..92721,1..2502)
                     /gene="tagA"
                     /locus_tag="pO157p01"
                     /codon_start=1
                     /transl_table=11
                     /product="ToxR-regulated lipoprotein"
                     /protein_id="NP_052607.1"
                     /db_xref="GI:10955349"
                     /db_xref="GeneID:1789672"

When using the bp_genbank2gff3.pl script (either from bioperl-live or
release 1.6.1) to convert NC_002128.gbk to GFF3 with the command-line

$ bp_genbank2gff3.pl ./Escherichia_coli_O157H7/NC_002128.gbk -out stdout >
test.gff3

This produces the following, non-sequence ontology-compatible GFF:




-- 
Dr Leighton Pritchard MRSC
D131, Plant Pathology Programme, SCRI
Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405


______________________________________________________
SCRI, Invergowrie, Dundee, DD2 5DA.  
The Scottish Crop Research Institute is a charitable company limited by guarantee. 
Registered in Scotland No: SC 29367.
Recognised by the Inland Revenue as a Scottish Charity No: SC 006662.


DISCLAIMER:

This email is from the Scottish Crop Research Institute, but the views expressed by the sender are not necessarily the views of SCRI and its subsidiaries.  This email and any files transmitted with it are confidential to the intended recipient at the e-mail address to which it has been addressed.  It may not be disclosed or used by any other than that
addressee.
If you are not the intended recipient you are requested to preserve this confidentiality and you must not use, disclose, copy, print or rely on this e-mail in any way. Please notify postmaster at scri.ac.uk quoting the name of the sender and delete the email from your system.

Although SCRI has taken reasonable precautions to ensure no viruses are present in this email, neither the Institute nor the sender accepts any responsibility for any viruses, and it is your responsibility to scan the email and the attachments (if any).
______________________________________________________

From cjfields at illinois.edu  Fri Apr  9 09:29:36 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 9 Apr 2010 08:29:36 -0500
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
	origin-spanning features, and GFF3
In-Reply-To: <C7E4E4E9.33A71%lpritc@scri.ac.uk>
References: <C7E4E4E9.33A71%lpritc@scri.ac.uk>
Message-ID: <46BE6769-289F-41CA-B1D7-F3F67A286653@illinois.edu>

Leighton,

Didn't see the GFF3 in question.

chris

On Apr 9, 2010, at 8:06 AM, Leighton Pritchard wrote:

> Hi,
> 
> (cc'd to Lincoln due to GFF3 relevance)
> 
> I've recently been trying to use BioPerl, CHADO and GBROWSE to represent
> bacterial genome sequences.  In doing this, I've been testing with GenBank
> genome/feature files, converting these to GFF3 with bp_genbank2gff3.pl to
> get a CHADO-friendly gene model.  There appears to be an issue when
> converting GenBank files that contain features which span the genomic
> origin.
> 
> For example, the GenBank file NC_002127.gbk describes a plasmid from E.coli
> O157H7.  This contains the following feature which spans the reference
> sequence origin:
> 
>     gene            join(92527..92721,1..2502)
>                     /gene="tagA"
>                     /locus_tag="pO157p01"
>                     /db_xref="GeneID:1789672"
>     CDS             join(92527..92721,1..2502)
>                     /gene="tagA"
>                     /locus_tag="pO157p01"
>                     /codon_start=1
>                     /transl_table=11
>                     /product="ToxR-regulated lipoprotein"
>                     /protein_id="NP_052607.1"
>                     /db_xref="GI:10955349"
>                     /db_xref="GeneID:1789672"
> 
> When using the bp_genbank2gff3.pl script (either from bioperl-live or
> release 1.6.1) to convert NC_002128.gbk to GFF3 with the command-line
> 
> $ bp_genbank2gff3.pl ./Escherichia_coli_O157H7/NC_002128.gbk -out stdout >
> test.gff3
> 
> This produces the following, non-sequence ontology-compatible GFF:


??????


> -- 
> Dr Leighton Pritchard MRSC
> D131, Plant Pathology Programme, SCRI
> Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
> e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
> gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405





From lpritc at scri.ac.uk  Fri Apr  9 09:30:25 2010
From: lpritc at scri.ac.uk (Leighton Pritchard)
Date: Fri, 09 Apr 2010 14:30:25 +0100
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
 origin-spanning features, and GFF3
In-Reply-To: <46BE6769-289F-41CA-B1D7-F3F67A286653@illinois.edu>
Message-ID: <C7E4EA81.33A7B%lpritc@scri.ac.uk>

Sorry - clicked 'send' while moving windows round when composing... Full
email coming soon...

Apologies,

L.

On 09/04/2010 Friday, April 9, 14:29, "Chris Fields" <cjfields at illinois.edu>
wrote:

> Leighton,
> 
> Didn't see the GFF3 in question.
> 
> chris
> 
> On Apr 9, 2010, at 8:06 AM, Leighton Pritchard wrote:
> 
>> Hi,
>> 
>> (cc'd to Lincoln due to GFF3 relevance)
>> 
>> I've recently been trying to use BioPerl, CHADO and GBROWSE to represent
>> bacterial genome sequences.  In doing this, I've been testing with GenBank
>> genome/feature files, converting these to GFF3 with bp_genbank2gff3.pl to
>> get a CHADO-friendly gene model.  There appears to be an issue when
>> converting GenBank files that contain features which span the genomic
>> origin.
>> 
>> For example, the GenBank file NC_002127.gbk describes a plasmid from E.coli
>> O157H7.  This contains the following feature which spans the reference
>> sequence origin:
>> 
>>     gene            join(92527..92721,1..2502)
>>                     /gene="tagA"
>>                     /locus_tag="pO157p01"
>>                     /db_xref="GeneID:1789672"
>>     CDS             join(92527..92721,1..2502)
>>                     /gene="tagA"
>>                     /locus_tag="pO157p01"
>>                     /codon_start=1
>>                     /transl_table=11
>>                     /product="ToxR-regulated lipoprotein"
>>                     /protein_id="NP_052607.1"
>>                     /db_xref="GI:10955349"
>>                     /db_xref="GeneID:1789672"
>> 
>> When using the bp_genbank2gff3.pl script (either from bioperl-live or
>> release 1.6.1) to convert NC_002128.gbk to GFF3 with the command-line
>> 
>> $ bp_genbank2gff3.pl ./Escherichia_coli_O157H7/NC_002128.gbk -out stdout >
>> test.gff3
>> 
>> This produces the following, non-sequence ontology-compatible GFF:
> 
> 
> ??????
> 
> 
>> -- 
>> Dr Leighton Pritchard MRSC
>> D131, Plant Pathology Programme, SCRI
>> Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
>> e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
>> gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405
> 
> 
> 
> 
> 
> ______________________________________________________________________
> This email has been scanned by the MessageLabs Email Security System.
> For more information please visit http://www.messagelabs.com/email
> ______________________________________________________________________

-- 
Dr Leighton Pritchard MRSC
D131, Plant Pathology Programme, SCRI
Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405


______________________________________________________
SCRI, Invergowrie, Dundee, DD2 5DA.  
The Scottish Crop Research Institute is a charitable company limited by guarantee. 
Registered in Scotland No: SC 29367.
Recognised by the Inland Revenue as a Scottish Charity No: SC 006662.


DISCLAIMER:

This email is from the Scottish Crop Research Institute, but the views expressed by the sender are not necessarily the views of SCRI and its subsidiaries.  This email and any files transmitted with it are confidential to the intended recipient at the e-mail address to which it has been addressed.  It may not be disclosed or used by any other than that
addressee.
If you are not the intended recipient you are requested to preserve this confidentiality and you must not use, disclose, copy, print or rely on this e-mail in any way. Please notify postmaster at scri.ac.uk quoting the name of the sender and delete the email from your system.

Although SCRI has taken reasonable precautions to ensure no viruses are present in this email, neither the Institute nor the sender accepts any responsibility for any viruses, and it is your responsibility to scan the email and the attachments (if any).
______________________________________________________

From lpritc at scri.ac.uk  Fri Apr  9 09:34:57 2010
From: lpritc at scri.ac.uk (Leighton Pritchard)
Date: Fri, 09 Apr 2010 14:34:57 +0100
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
 origin-spanning features, and GFF3
Message-ID: <C7E4EB91.33A7E%lpritc@scri.ac.uk>

Hi,

(cc'd to Lincoln due to GFF3 relevance - apologies to all for the earlier
partial post, I accidentally clicked on 'send' when moving windows about)

I've recently been trying to use BioPerl, CHADO and GBROWSE to represent
bacterial genome sequences.  In doing this, I've been testing with GenBank
genome/feature files, converting these to GFF3 with bp_genbank2gff3.pl to
get a CHADO-friendly gene model.  There appears to be an issue when
converting GenBank files that contain features which span the genomic
origin.

For example, the GenBank file NC_002127.gbk describes a plasmid from E.coli
O157H7.  This contains the following feature which spans the reference
sequence origin:

     gene            join(92527..92721,1..2502)
                     /gene="tagA"
                     /locus_tag="pO157p01"
                     /db_xref="GeneID:1789672"
     CDS             join(92527..92721,1..2502)
                     /gene="tagA"
                     /locus_tag="pO157p01"
                     /codon_start=1
                     /transl_table=11
                     /product="ToxR-regulated lipoprotein"
                     /protein_id="NP_052607.1"
                     /db_xref="GI:10955349"
                     /db_xref="GeneID:1789672"

When using the bp_genbank2gff3.pl script (either from bioperl-live or
release 1.6.1) to convert NC_002128.gbk to GFF3 with the command-line

$ bp_genbank2gff3.pl ./Escherichia_coli_O157H7/NC_002128.gbk -out stdout >
test.gff3

This produces non-sequence ontology-compatible GFF, where CDS are not
explicitly related to their parent gene features, and exons/mRNA are not
inferred:
"""
[...]
NC_002128       GenBank CDS     2589    3464    .       +       .
ID=pO157p02;Dbxref=GI:10955267,GeneID:1789731;Note=type II secretion pathway
related 
protein;codon_start=1;gene=etpC;locus_tag=pO157p02;product=EtpC;protein_id=N
P_052608.1;transl_table=11;translation=length.291
NC_002128       GenBank gene    2589    3464    .       +       .
ID=pO157p02;Dbxref=GeneID:1789731;gene=etpC;locus_tag=pO157p02
NC_002128       GenBank CDS     3675    5432    .       +       .
ID=pO157p03;Dbxref=GI:10955268,GeneID:1789733;Note=type II secretion pathway
related 
protein;codon_start=1;gene=etpD;locus_tag=pO157p03;product=EtpD;protein_id=N
P_052609.1;transl_table=11;translation=length.585
NC_002128       GenBank gene    3675    5432    .       +       .
ID=pO157p03;Dbxref=GeneID:1789733;gene=etpD;locus_tag=pO157p03
NC_002128       GenBank CDS     5432    6937    .       +       .
ID=pO157p04;Dbxref=GI:10955269,GeneID:1789725;Note=type II secretion pathway
related 
protein;codon_start=1;gene=etpE;locus_tag=pO157p04;product=EtpE;protein_id=N
P_052610.1;transl_table=11;translation=length.501
NC_002128       GenBank gene    5432    6937    .       +       .
ID=pO157p04;Dbxref=GeneID:1789725;gene=etpE;locus_tag=pO157p04
[...]
"""

Removing the wrapped feature from the .gbk file and running the script again
(same command-line) produces 'correct' output, with an SO-compatible model:

"""
[...]
NC_002128       GenBank gene    2589    3464    .       +       .
ID=pO157p02;Dbxref=GeneID:1789731;gene=etpC;locus_tag=pO157p02
NC_002128       GenBank mRNA    2589    3464    .       +       .
ID=pO157p02.t01;Parent=pO157p02
NC_002128       GenBank polypeptide     2589    3464    .       +       .
ID=pO157p02.p01;Dbxref=GI:10955267,GeneID:1789731;Derives_from=pO157p02.t01;
Note=type I
I secretion pathway related
protein;codon_start=1;gene=etpC;locus_tag=pO157p02;product=EtpC;protein_id=N
P_052608.1;transl_table=11;translation=length.291
NC_002128       GenBank exon    2589    3464    .       +       .
Parent=pO157p02.t01
NC_002128       GenBank gene    3675    5432    .       +       .
ID=pO157p03;Dbxref=GeneID:1789733;gene=etpD;locus_tag=pO157p03
NC_002128       GenBank mRNA    3675    5432    .       +       .
ID=pO157p03.t01;Parent=pO157p03
NC_002128       GenBank polypeptide     3675    5432    .       +       .
ID=pO157p03.p01;Dbxref=GI:10955268,GeneID:1789733;Derives_from=pO157p03.t01;
Note=type I
I secretion pathway related
protein;codon_start=1;gene=etpD;locus_tag=pO157p03;product=EtpD;protein_id=N
P_052609.1;transl_table=11;translation=length.585
NC_002128       GenBank exon    3675    5432    .       +       .
Parent=pO157p03.t01
NC_002128       GenBank gene    5432    6937    .       +       .
ID=pO157p04;Dbxref=GeneID:1789725;gene=etpE;locus_tag=pO157p04
NC_002128       GenBank mRNA    5432    6937    .       +       .
ID=pO157p04.t01;Parent=pO157p04
[...]
"""

Somewhere, the bp_genbank2gff3.pl script is baulking at the wrapped feature,
and this appears to be disrupting its ability to construct gene models.

Now, since circular sequences are declared in the GenBank file (and there
are over 1000 bacterial, mostly circular, genomes), and wrapped features
must be expected, I had a look to see how these are handled in
BioPerl/GFF3/etc. And came across the following:

A proposal from 2008 for modifying CHADO/GBROWSE/GFF3 to handle
origin-crossing features:
http://old.nabble.com/Circular-genomes-in-Chado-BioPerl-td19378544.html

The current(?) GFF3 spec (1.15), which doesn't describe how to handle this:
http://www.sequenceontology.org/gff3.shtml

A proposed extension to GFF3 (1.01), which adds a topology attribute to the
reference sequence to indicate circularity:
http://www.pathogenportal.org/gff3-usage-conventions.html

Which is reminiscent of Nathan's proposal, here:
http://gmod.org/wiki/GBrowse_FAQ#How_do_I_show_circular_genomes.3F

But it doesn't look like anything made it into the GFF3 spec, or the BioPerl
script as a result.  So I was wondering what, if anything, I'm still missing
here, if anything has in fact changed since the 2008 proposal, and what
direction people thought this might take in BioPerl/GFF3 (links to a thread
are fine if it's under discussion already).  FWIW I like the
topology=circular|linear attribute from IOWG and the modular arithmetic
approach in the linked thread.

Cheers,

L.

-- 
Dr Leighton Pritchard MRSC
D131, Plant Pathology Programme, SCRI
Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405


______________________________________________________
SCRI, Invergowrie, Dundee, DD2 5DA.  
The Scottish Crop Research Institute is a charitable company limited by guarantee. 
Registered in Scotland No: SC 29367.
Recognised by the Inland Revenue as a Scottish Charity No: SC 006662.


DISCLAIMER:

This email is from the Scottish Crop Research Institute, but the views expressed by the sender are not necessarily the views of SCRI and its subsidiaries.  This email and any files transmitted with it are confidential to the intended recipient at the e-mail address to which it has been addressed.  It may not be disclosed or used by any other than that
addressee.
If you are not the intended recipient you are requested to preserve this confidentiality and you must not use, disclose, copy, print or rely on this e-mail in any way. Please notify postmaster at scri.ac.uk quoting the name of the sender and delete the email from your system.

Although SCRI has taken reasonable precautions to ensure no viruses are present in this email, neither the Institute nor the sender accepts any responsibility for any viruses, and it is your responsibility to scan the email and the attachments (if any).
______________________________________________________

From roy.chaudhuri at gmail.com  Fri Apr  9 10:02:35 2010
From: roy.chaudhuri at gmail.com (Roy Chaudhuri)
Date: Fri, 09 Apr 2010 15:02:35 +0100
Subject: [Bioperl-l] SeqIO::abi use
In-Reply-To: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
References: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
Message-ID: <4BBF337B.5060104@gmail.com>

Hi Tom,

It looks from the docs/source like you can, with something like this:

use Bio::SeqIO;
my $seq=Bio::SeqIO->new(-file=>$ARGV[0], -format=>'abi', 
-get_trace_data=>1)->next_seq;
my @atrace=$seq->get_trace_graph(-trace=>'a'); # or c,g,t

Sorry, but I don't have Staden installed so I can't test if this works.
You might also look at the non-BioPerl ABI module on CPAN - again, I 
haven't tested this, but it looks like it could be useful for your purposes:
http://search.cpan.org/~MALAY/ABI/ABI.pm

Roy.


On 08/04/2010 23:30, Tom Keller wrote:
> Greetings, Can the Bio::SeqIO::abi module be used to access the raw
> fluorescence data? Are there any examples available? I'm wondering
> how to calculate ratios of mixed bases prior to the smoothing and
> scaling done by the base caller.
>
> thank you Tom kellert at ohsu.edu<mailto:kellert at ohsu.edu> 503-494-2442
>
>
>
>
>
>
>
>
> _______________________________________________ Bioperl-l mailing
> list Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From pmiguel at purdue.edu  Fri Apr  9 11:11:37 2010
From: pmiguel at purdue.edu (Phillip San Miguel)
Date: Fri, 09 Apr 2010 11:11:37 -0400
Subject: [Bioperl-l] SeqIO::abi use
In-Reply-To: <4BBF337B.5060104@gmail.com>
References: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
	<4BBF337B.5060104@gmail.com>
Message-ID: <4BBF43A9.7010800@purdue.edu>

Hi Tom and Roy,
    Not sure what the intention is here, but there are caveats you might 
want to consider:
    The problem with looking at the raw trace data is that it has not 
yet been base called, no peaks have been found, nor have the dye-shifts 
been compensated for, nor has any background been subtracted. So finding 
the peaks in the raw data that correspond to the mixed base peak of 
interest is not trivial. Then once you have, you would need to subtract 
background (which can be different for each of the data channels.) Then 
integrate the peaks.
    Then what do you have? The % of the base at that position is A,C,G 
or T?
    I would not be so sure. The dyes may give different quantum yields, 
the CCD may be more sensitive to some wavelengths than others, the 
sequencing polymerase may prefer to add a certain base in your given 
sequence context more than another. Really you would need to do standard 
runs (mixing sequences in each of the base channels to be analyzed of 
each base) in known ratios and create a standard curve to be sure.

Phillip
    
Roy Chaudhuri wrote:
> Hi Tom,
>
> It looks from the docs/source like you can, with something like this:
>
> use Bio::SeqIO;
> my $seq=Bio::SeqIO->new(-file=>$ARGV[0], -format=>'abi', 
> -get_trace_data=>1)->next_seq;
> my @atrace=$seq->get_trace_graph(-trace=>'a'); # or c,g,t
>
> Sorry, but I don't have Staden installed so I can't test if this works.
> You might also look at the non-BioPerl ABI module on CPAN - again, I 
> haven't tested this, but it looks like it could be useful for your 
> purposes:
> http://search.cpan.org/~MALAY/ABI/ABI.pm
>
> Roy.
>
>
> On 08/04/2010 23:30, Tom Keller wrote:
>> Greetings, Can the Bio::SeqIO::abi module be used to access the raw
>> fluorescence data? Are there any examples available? I'm wondering
>> how to calculate ratios of mixed bases prior to the smoothing and
>> scaling done by the base caller.
>>
>> thank you Tom kellert at ohsu.edu<mailto:kellert at ohsu.edu> 503-494-2442
>>
>>
>>
>>
>>
>>
>>
>>
>> _______________________________________________ Bioperl-l mailing
>> list Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From MEC at stowers.org  Fri Apr  9 14:36:30 2010
From: MEC at stowers.org (Cook, Malcolm)
Date: Fri, 9 Apr 2010 13:36:30 -0500
Subject: [Bioperl-l] SeqIO::abi use
In-Reply-To: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
References: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC1301E3D6DD@EXCHMB-02.stowers-institute.org>

I don't think so, but c.f. http://search.cpan.org/~vita/Bio-Trace-ABIF-1.05/lib/Bio/Trace/ABIF.pm#raw_data_for_channel%28%29 


Malcolm Cook
Stowers Institute for Medical Research -  Bioinformatics
Kansas City, Missouri  USA
 

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Tom Keller
Sent: Thursday, April 08, 2010 5:30 PM
To: BioPerl-List
Subject: [Bioperl-l] SeqIO::abi use

Greetings,
Can the Bio::SeqIO::abi module be used to access the raw fluorescence data? Are there any examples available? I'm wondering how to calculate ratios of mixed bases prior to the smoothing and scaling done by the base caller.

thank you
Tom
kellert at ohsu.edu<mailto:kellert at ohsu.edu>
503-494-2442








_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From cjfields at illinois.edu  Fri Apr  9 16:06:47 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 09 Apr 2010 15:06:47 -0500
Subject: [Bioperl-l] Bio::SeqIO::genbank
In-Reply-To: <W57622606581471270757755@webmail33>
References: <W57622606581471270757755@webmail33>
Message-ID: <1270843607.17197.0.camel@pyrimidine.igb.uiuc.edu>

Is it the same as regular ol' eutils?

http://eutils.ncbi.nlm.nih.gov/corehtml/query/static/efetchseq_help.html

Note the rettype = gbc|gpc, but retmode = text, not xml.  This worked
for me:

my @ids = @ARGV;

my $eutil = Bio::DB::EUtilities->new(-eutil => 'efetch',
                                     -db    => 'nuccore',
                                     -id    => \@ids,
                                     -rettype => 'gbc',
                                     -retmode => 'text');

say $eutil->get_Response->content;

chris 

On Thu, 2010-04-08 at 20:15 +0000, Mark A. Jensen wrote: 
> FWIW -In my SoapE investigations I found NCBI-hosted XML schema for insdc, but didn't ever run across a format descriptor that gets return data in that format-- MAJ
> 
> >-----Original Message-----
> >From: Chris Fields [mailto:cjfields at illinois.edu]
> >Sent: Thursday, April 8, 2010 04:09 PM
> >To: 'Dave Messina'
> >Cc: 'bioperl-l', 'Wayne Davis'
> >Subject: Re: [Bioperl-l] Bio::SeqIO::genbank
> >
> >On Thu, 2010-04-08 at 21:39 +0200, Dave Messina wrote: 
> >> Hi Wayne,
> >> 
> >> > if $mol is not in the fixed list of genbank molecule types it should
> >> > be set to the default value of 'DNA', or some other smarter way of
> >> > forcing the molecule type into the fixed vocabulary would be a help.
> >> 
> >> Sounds good to me. Did you modify your local copy of Bio::SeqIO::genbank and try it out?
> >> 
> >> I will say, though, that Genbank is a tricky format, both to read and to write. Even if BioPerl would write Genbank records that are fully compliant with the spec, I'm pretty sure they would not be round-trippable*. That is, if you read a Genbank record into BioPerl and then wrote it back out, the output wouldn't exactly match the input.
> >
> >This is true.  Jason and I talked about this recently and arrived pretty
> >much at the same conclusion.  We're mainly interested in parsing data
> >into a usable framework for manipulation.  Recreating data isn't our top
> >priority.
> >
> >> I think that NCBI is trying to nudge people toward their XML format. I know it won't help this particular situation, but it might be an option to consider for the future.
> >
> >The only problem I had with the XML spit out from eutils has been it was
> >an on-the-fly conversion of the ASN.1.  Not sure what the status of it
> >is now.
> >
> >What's going on with the INSDC XML format?  That was supposed to be an
> >international standard and appeared more lightweight (if such a thing
> >can be said about XML).
> >
> >> Speaking of which, what is the current status of the BioPerl Genbank XML parser? Jay, did you ever release that?
> >> 
> >> 
> >> Dave
> >> 
> >> 
> >> 
> >> * not that they were designed to be: http://www.bioperl.org/wiki/HOWTO:SeqIO#Caveats
> >
> >I think it was in a branch, can't recall.
> >
> >chris
> >
> >
> >
> >_______________________________________________
> >Bioperl-l mailing list
> >Bioperl-l at lists.open-bio.org
> >http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From lsbrath at gmail.com  Fri Apr  9 17:29:25 2010
From: lsbrath at gmail.com (Mgavi Brathwaite)
Date: Fri, 9 Apr 2010 17:29:25 -0400
Subject: [Bioperl-l] Problems getting bioperl to run on SnowLeopard
Message-ID: <o2o69367b8f1004091429nf0bbf387p2d39868ac29f5b0d@mail.gmail.com>

Hello,

I am having trouble running bioperl-1.6.1 in SnowLeopard. I have moved the
BIoPerl-1.6.1 folder to  /System/Library/Perl/5.10.0/.  I logged in as su
and added  export PERL5LIB =  /System/Library/Perl/5.10.0/BioPerl-1.6.1/Bio/
to my .profile  file. When I run my script I get the following error
message:


Can't locate Bio/SeqIO.pm in @INC (@INC contains: /sw/lib/perl5
/sw/lib/perl5/darwin /Library/Perl/Updates/5.10.0
/System/Library/Perl/5.10.0/darwin-thread-multi-2level
/System/Library/Perl/5.10.0 /Library/Perl/5.10.0/darwin-thread-multi-2level
/Library/Perl/5.10.0 /Network/Library/Perl/5.10.0/darwin-thread-multi-2level
/Network/Library/Perl/5.10.0 /Network/Library/Perl
/System/Library/Perl/Extras/5.10.0/darwin-thread-multi-2level
/System/Library/Perl/Extras/5.10.0 .) at project_example.pl line 4.
BEGIN failed--compilation aborted at project_example.pl line 4.

Can anyone help me get up and running?

Mgavi

From hartzell at alerce.com  Fri Apr  9 16:59:26 2010
From: hartzell at alerce.com (George Hartzell)
Date: Fri, 9 Apr 2010 13:59:26 -0700
Subject: [Bioperl-l] Genentech is hiring [more].
Message-ID: <19391.38190.206053.840891@gargle.gargle.HOWL>



We're hiring.  You want to do Bioinformatics and Computational Biology
at a great company in South San Francisco, CA.  Sounds like a good
match!  There are both full-time and temporary openings.

I'm looking for someone who's sharp and who enjoys computers, biology,
and technology; someone who gets excited about picking up new tools
but who also has a sense of responsibility and restraint.  You've
worked with a variety of computer languages over your career and look
forward to learning more in the future; you can build up a system from
a blank hard disk and an OS cd if necessary but are just as happy if
someone else takes care of it; you like your projects to build and
install themselves because let's face it, who wants to do that stuff
by hand.  It sounds like we're made for each other.

I'm looking for someone who's familiar with several modern tool sets
and has used them to deliver applications that really solve a problem
and that aren't a bear to extend and maintain.  Modern Perl
complemented with C is my first choice these days, supplemented with R
and (when necessary) anything from the rest of the programming
language bestiary.  There's a fair amount of Java flying around here
too so some familiarity with it and the JVM world would be great.
Relational databases are part of the picture: Oracle for the big
stuff; SQLite, PostgreSQL, and MySQL in supporting roles.  I generally
interact with them via ORM's, lately it's been Rose::DB::Object on the
Perl side though I've been convinced to take another look at
DBIx::Class.  Most of my web apps use CGI::Application, as fastcgi's,
mod_perl, or simple CGI scripts, but (as with ORM's) I may take
another look at Catalyst.  If most of those words ring a bell, we
should talk.

Does it sound like you'd be happy working here?  Well, you're still
reading....  Great!

Strong candidates will have an understanding of basic bioinformatics
concepts and the ability to pick up new biology and computer science
concepts as necessary.  You could probably leverage a strong
non-biological science background complemented with the right software
engineering experience and make an argument that you're a good fit.

At the junior end of the spectrum I'd expect a bachelor's degree + 3
years of experience, at the upper end would a masters + 5 years (or a
PhD interested in moving towards the production side of the house).

When you get to an interview, you might get questions like:

- What's the difference between Smith-Waterman, blast, sim4, gmap,
  and/or bowtie alignment algorithms or tools? Which would you use
  when, and why?

- Why is Moose better than Class::Accessor? (yes, it's Perl centered,
  but it could spin out into any language [e.g. why is Java better
  than Perl?]).  What's a MOP? Who cares?

- How do you roll out a release of your software?  What's automated,
  and how?  What's not, and why?

- CVS, subversion, git, mercurial. You've already picked one, of
  course.  Which one? Why? Why not?

- XML or JSON or YAML.  Pick one for moving data back and forth in an
  Ajax based interface.  Why? Would it also work well in other
  contexts?

- How would you store information about positional features on a
  genome so that you could get fast random access? How would your
  solution tie into a larger data context?

Genentech's a great place to work: solid salaries, great benefits,
great Bay Area location.  We're open source friendly and with the
arrival of Robert Gentleman (our new Director, of Bioconductor/R fame)
are becoming even more so.

Send a cover letter and CV to me at georgewh at gene.com.  Bonus points
if it's easy to unpack and read (pdf would be great...).  Demerits if
you use an obscure archive format to deliver Wordstar files.  Double
demerits if you don't follow directions and reply to this account....

From kellert at ohsu.edu  Fri Apr  9 17:43:46 2010
From: kellert at ohsu.edu (Tom Keller)
Date: Fri, 9 Apr 2010 14:43:46 -0700
Subject: [Bioperl-l] problem with bioperl-ext
Message-ID: <EC6775B7-EDDB-40AF-A94B-AAFE7C02251F@ohsu.edu>

Been struggling to get the bioperl-ext modules to install. I've got the staden libraries:
$ ll /usr/local/lib/ | grep read
-rwxr-xr-x   1 root  wheel   265K Apr  9 11:19 libstaden-read.1.1.0.dylib
lrwxr-xr-x   1 root  wheel    26B Apr  9 11:19 libstaden-read.1.dylib -> libstaden-read.1.1.0.dylib
-rw-r--r--   1 root  wheel   810K Apr  9 11:19 libstaden-read.a
lrwxr-xr-x   1 root  wheel    26B Apr  9 11:19 libstaden-read.dylib -> libstaden-read.1.1.0.dylib
-rwxr-xr-x   1 root  wheel   886B Apr  9 11:19 libstaden-read.la

Here are the test results:
$ sudo make test
PERL_DL_NONLAZY=1 /opt/local/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
t/basic.t .. ok
All tests successful.
Files=1, Tests=1,  0 wallclock secs ( 0.01 usr +  0.01 sys =  0.02 CPU)
Result: PASS
PERL_DL_NONLAZY=1 /opt/local/bin/perl "-I../blib/lib" "-I../blib/arch" test.pl<http://test.pl>
1..2
ok 1

2..2
Testing bp_sw with a protein alignment...

ProteinSW Matrix calculation: [      0] Cells  0%
one         1        WLGQRNLVSSTGGNLLNVWLKDW
                     W+G RN+V     NLLNVW +DW
two         1        WMGNRNVV-----NLLNVWFRDW


ok 2
PERL_DL_NONLAZY=1 /opt/local/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, '../blib/lib', '../blib/arch')" test.pl<http://test.pl>
test.pl<http://test.pl> .. Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read'

Can't load '/Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle, 2): Symbol not found: _fread_reading
  Referenced from: /Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle
  Expected in: flat namespace
 in /Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle at /System/Library/Perl/5.10.0/darwin-thread-multi-2level/DynaLoader.pm line 207, <DATA> line 1.
 at /Library/Perl/5.10.0/Inline.pm line 527


 at test.pl<http://test.pl> line 0
INIT failed--call queue aborted, <DATA> line 1.
test.pl<http://test.pl> .. Dubious, test returned 2 (wstat 512, 0x200)
Failed 94/94 subtests

Test Summary Report
-------------------
test.pl<http://test.pl> (Wstat: 512 Tests: 0 Failed: 0)
  Non-zero exit status: 2
  Parse errors: Bad plan.  You planned 94 tests but ran 0.
Files=1, Tests=0,  0 wallclock secs ( 0.01 usr  0.01 sys +  0.09 cusr  0.02 csys =  0.13 CPU)
Result: FAIL
Failed 1/1 test programs. 0/0 subtests failed.
make[1]: *** [test_dynamic] Error 2
make: *** [subdirs-test] Error 2


I'm running OS X 10.6.3, the rest of Bioperl is 1.6.
Suggestions greatly appreciated.

Tom
kellert at ohsu.edu<mailto:kellert at ohsu.edu>
503-494-2442









From David.Messina at sbc.su.se  Fri Apr  9 18:18:50 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sat, 10 Apr 2010 00:18:50 +0200
Subject: [Bioperl-l] Problems getting bioperl to run on SnowLeopard
In-Reply-To: <o2o69367b8f1004091429nf0bbf387p2d39868ac29f5b0d@mail.gmail.com>
References: <o2o69367b8f1004091429nf0bbf387p2d39868ac29f5b0d@mail.gmail.com>
Message-ID: <30A656DC-AF59-40B2-96E2-0BD4F4589FAF@sbc.su.se>

Hi Mgavi,

This should work:

export PERL5LIB=/System/Library/Perl/5.10.0/BioPerl-1.6.1/

That is, leave off the Bio/ directory (it's part of what Perl looks for when you try to 'use Bio::SeqIO;'.

There's probably at least one other problem, though, since your @INC ? the path that Perl searches when looking for libraries ? doesn't include the one you tried to add with your export PERL5LIB statement. You may need to execute 'source .profile' on the command line.

All that being said, installing external Perl libraries in the /System/Library/ area is probably not a good idea, since the system expects to have complete control over that. It might be better in /usr/local/lib/perl or even your own ~/Library/Perl.

All else fails, read the installation instructions:

http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix


Dave




From lpritc at scri.ac.uk  Sat Apr 10 12:23:09 2010
From: lpritc at scri.ac.uk (Leighton Pritchard)
Date: Sat, 10 Apr 2010 17:23:09 +0100
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
 origin-spanning features, and GFF3
In-Reply-To: <4BBF88B7.1000202@gmail.com>
Message-ID: <C7E6647D.33B84%lpritc@scri.ac.uk>

Hi Nathan, 

Thanks for checking this out.  The problem's actually with NC_002128.gbk -
there's a typo in my email to the list; NC_002127.gbk is good on my system
(I was swapping between 2128 and 2127 to try to see what could be going
wrong; sending a draft by accident probably didn't help either ;) ).  Sorry
about that.

I'm cc-ing this back to the list so that the error is noted in the archive
(and to announce to the world that I can't type straight ;))

On 09/04/2010 Friday, April 9, 21:06, "Nathan Liles" <nml5566 at gmail.com>
wrote:

> The converter has been patched to handle merged circular genomes, but
> there was an unexpected problem, so I had to comment it out. I may
> enable it as an optional feature in the future.

That sounds like a useful feature to have, when it's fixed.  We've quite a
few bacterial genomes to deal with, so it will get some use.

Cheers,

L.


-- 
Dr Leighton Pritchard MRSC
D131, Plant Pathology Programme, SCRI
Errol Road, Invergowrie, Perth and Kinross, Scotland, DD2 5DA
e:lpritc at scri.ac.uk       w:http://www.scri.ac.uk/staff/leightonpritchard
gpg/pgp: 0xFEFC205C       tel:+44(0)1382 562731 x2405


______________________________________________________
SCRI, Invergowrie, Dundee, DD2 5DA.  
The Scottish Crop Research Institute is a charitable company limited by guarantee. 
Registered in Scotland No: SC 29367.
Recognised by the Inland Revenue as a Scottish Charity No: SC 006662.


DISCLAIMER:

This email is from the Scottish Crop Research Institute, but the views expressed by the sender are not necessarily the views of SCRI and its subsidiaries.  This email and any files transmitted with it are confidential to the intended recipient at the e-mail address to which it has been addressed.  It may not be disclosed or used by any other than that
addressee.
If you are not the intended recipient you are requested to preserve this confidentiality and you must not use, disclose, copy, print or rely on this e-mail in any way. Please notify postmaster at scri.ac.uk quoting the name of the sender and delete the email from your system.

Although SCRI has taken reasonable precautions to ensure no viruses are present in this email, neither the Institute nor the sender accepts any responsibility for any viruses, and it is your responsibility to scan the email and the attachments (if any).
______________________________________________________

From cjfields at illinois.edu  Sat Apr 10 19:03:41 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Sat, 10 Apr 2010 18:03:41 -0500
Subject: [Bioperl-l] bp_genbank2gff3.pl - circular genomes,
	origin-spanning features, and GFF3
In-Reply-To: <C7E6647D.33B84%lpritc@scri.ac.uk>
References: <C7E6647D.33B84%lpritc@scri.ac.uk>
Message-ID: <A95AADD8-8E44-48F8-A4F6-041793D5BEB5@illinois.edu>


On Apr 10, 2010, at 11:23 AM, Leighton Pritchard wrote:

> Hi Nathan, 
> 
> Thanks for checking this out.  The problem's actually with NC_002128.gbk -
> there's a typo in my email to the list; NC_002127.gbk is good on my system
> (I was swapping between 2128 and 2127 to try to see what could be going
> wrong; sending a draft by accident probably didn't help either ;) ).  Sorry
> about that.
> 
> I'm cc-ing this back to the list so that the error is noted in the archive
> (and to announce to the world that I can't type straight ;))
> 
> On 09/04/2010 Friday, April 9, 21:06, "Nathan Liles" <nml5566 at gmail.com>
> wrote:
> 
>> The converter has been patched to handle merged circular genomes, but
>> there was an unexpected problem, so I had to comment it out. I may
>> enable it as an optional feature in the future.
> 
> That sounds like a useful feature to have, when it's fixed.  We've quite a
> few bacterial genomes to deal with, so it will get some use.
> 
> Cheers,
> 
> L.

Leighton, Nathan,

I'm planning doing a fairly large-scale project this summer involving Bio::DB::SF::Store, the SQLite, adaptor, and bacterial genomes that will require things to work correctly (i.e. features that cross the origin to be joined in the right order, etc etc).  So, if there is anything borked I'll definitely be pushing for a fix.

chris



From j_martin at lbl.gov  Sat Apr 10 20:50:07 2010
From: j_martin at lbl.gov (Joel Martin)
Date: Sat, 10 Apr 2010 17:50:07 -0700
Subject: [Bioperl-l] problem with bioperl-ext
In-Reply-To: <EC6775B7-EDDB-40AF-A94B-AAFE7C02251F@ohsu.edu>
References: <EC6775B7-EDDB-40AF-A94B-AAFE7C02251F@ohsu.edu>
Message-ID: <4BC11CBF.3090901@lbl.gov>

You should be using the latest from svn, 1.4 is very old and 1.5.1 on 
the bioperl site still has troubles.
but svn co svn://code.open-bio.org/bioperl/bioperl-ext/trunk bioperl-ext
is timing out for me, perhaps it's down?  I have a version that 
eliminates a few compiler warnings.
if you want it.  It's due to be replaced with BioLib, but I'm not aware 
that it's happened yet.

Joel

bioperl list is giving me trouble, maybe it works from this address.
 
Tom Keller wrote:
> Been struggling to get the bioperl-ext modules to install. I've got the staden libraries:
> $ ll /usr/local/lib/ | grep read
> -rwxr-xr-x   1 root  wheel   265K Apr  9 11:19 libstaden-read.1.1.0.dylib
> lrwxr-xr-x   1 root  wheel    26B Apr  9 11:19 libstaden-read.1.dylib -> libstaden-read.1.1.0.dylib
> -rw-r--r--   1 root  wheel   810K Apr  9 11:19 libstaden-read.a
> lrwxr-xr-x   1 root  wheel    26B Apr  9 11:19 libstaden-read.dylib -> libstaden-read.1.1.0.dylib
> -rwxr-xr-x   1 root  wheel   886B Apr  9 11:19 libstaden-read.la
>
> Here are the test results:
> $ sudo make test
> PERL_DL_NONLAZY=1 /opt/local/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, 'blib/lib', 'blib/arch')" t/*.t
> t/basic.t .. ok
> All tests successful.
> Files=1, Tests=1,  0 wallclock secs ( 0.01 usr +  0.01 sys =  0.02 CPU)
> Result: PASS
> PERL_DL_NONLAZY=1 /opt/local/bin/perl "-I../blib/lib" "-I../blib/arch" test.pl<http://test.pl>
> 1..2
> ok 1
>
> 2..2
> Testing bp_sw with a protein alignment...
>
> ProteinSW Matrix calculation: [      0] Cells  0%
> one         1        WLGQRNLVSSTGGNLLNVWLKDW
>                      W+G RN+V     NLLNVW +DW
> two         1        WMGNRNVV-----NLLNVWFRDW
>
>
> ok 2
> PERL_DL_NONLAZY=1 /opt/local/bin/perl "-MExtUtils::Command::MM" "-e" "test_harness(0, '../blib/lib', '../blib/arch')" test.pl<http://test.pl>
> test.pl<http://test.pl> .. Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read'
>
> Can't load '/Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle, 2): Symbol not found: _fread_reading
>   Referenced from: /Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle
>   Expected in: flat namespace
>  in /Users/kellert/Downloads/bioperl-ext-1.4/Bio/SeqIO/staden/../blib/arch/auto/Bio/SeqIO/staden/read/read.bundle at /System/Library/Perl/5.10.0/darwin-thread-multi-2level/DynaLoader.pm line 207, <DATA> line 1.
>  at /Library/Perl/5.10.0/Inline.pm line 527
>
>
>  at test.pl<http://test.pl> line 0
> INIT failed--call queue aborted, <DATA> line 1.
> test.pl<http://test.pl> .. Dubious, test returned 2 (wstat 512, 0x200)
> Failed 94/94 subtests
>
> Test Summary Report
> -------------------
> test.pl<http://test.pl> (Wstat: 512 Tests: 0 Failed: 0)
>   Non-zero exit status: 2
>   Parse errors: Bad plan.  You planned 94 tests but ran 0.
> Files=1, Tests=0,  0 wallclock secs ( 0.01 usr  0.01 sys +  0.09 cusr  0.02 csys =  0.13 CPU)
> Result: FAIL
> Failed 1/1 test programs. 0/0 subtests failed.
> make[1]: *** [test_dynamic] Error 2
> make: *** [subdirs-test] Error 2
>
>
> I'm running OS X 10.6.3, the rest of Bioperl is 1.6.
> Suggestions greatly appreciated.
>
> Tom
> kellert at ohsu.edu<mailto:kellert at ohsu.edu>
> 503-494-2442
>
>
>
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   


From cjfields at illinois.edu  Mon Apr 12 10:08:35 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 12 Apr 2010 09:08:35 -0500
Subject: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
	(multiple) fastq files failure
In-Reply-To: <4BBC87C2.7080905@kaust.edu.sa>
References: <B8CBB696098467498D3111F1863E93C80FE11670@NA1000EXM01.na.ds.monsanto.com>	<4BBA69DF.6060508@bioperl.org>	<h2g320fb6e01004051615x2fa55958jd20dad0281450c54@mail.gmail.com>	<F1B9E1F1-FE22-4632-89CA-B165426DBF63@illinois.edu>	<B8CBB696098467498D3111F1863E93C80FEA3691@NA1000EXM01.na.ds.monsanto.com>	<2829AFCF-3F90-451A-AC27-5196041FCA73@illinois.edu>
	<4BBB9962.4060000@bioperl.org> <4BBC2485.2050808@kaust.edu.sa>
	<4BBC2770.30602@bioperl.org>
	<1C35356D-97E7-49B3-9C6D-41C6CCAB6A56@gmail.com>
	<4BBC87C2.7080905@kaust.edu.sa>
Message-ID: <AD4D854C-723F-4D5E-9E37-44E914C395A9@illinois.edu>

(getting back on this thread, to make sure the response is logged)

The ID has to be added to the database iteratively (there is even a way to customize that with a callback).  We could count there.

I still think Jason has a point re: the short read aligners; we should investigate how they index those.  Might not be feasible to replicate that completely within bioperl (why reinvent the wheel?), but we could set up a Bio::DB::* modules to access them if we know how they are indexed.

chris

On Apr 7, 2010, at 8:25 AM, Till Bayer wrote:

> Hey Chris,
> 
> > This does sound like a very good solution, would just need a max value to trigger the warning.
> 
> A problem may be that the module does not know the number of fastq entries before it gets done indexing. Or does the index go into memory first and is dumped into the DB afterwards?
> If not maybe the warning could be triggered by the fastq file size? That's hardly accurate, but better than nothing...
> 
> Cheers,
> 
> Till
> 
> On 4/7/2010 3:36 PM, Christopher Fields wrote:
>> Jason, Till,
>> 
>> Did you notice who the author was?  That would be our own Mark Jensen!  ;>
>> 
>> http://search.cpan.org/~majensen/SQLite_File-0.02/
>> 
>> This does sound like a very good solution, would just need a max value to trigger the warning.  I'll still need to look over the FASTQ index module to ensure it's indexing correctly (I think it does in most cases), but this should be much easier to implement.
>> 
>> chris
>> 
>> On Apr 7, 2010, at 1:34 AM, Jason Stajich wrote:
>> 
>>> Thanks Till!  That might solve the problem quite well and would be worth a benchmarking attempt to see what happens.
>>> 
>>> -jason
>>> Till Bayer wrote, On 4/6/10 11:21 PM:
>>>> Hey,
>>>> 
>>>> there is also SQLite_File, which has DB_File emulation and can be used with AnyDBM_File to just store the offsets. It adds another layer, but you could avoid another module or a required dependency, I guess.
>>>> Maybe there could be a warning like 'you are indexing large fastq file, this would work better if DBD::SQLite was installed'.
>>>> 
>>>> Cheers,
>>>> 
>>>> Till
>>>> 
>>>> 
>>>> On 4/6/2010 11:28 PM, Jason Stajich wrote:
>>>>> I think it is a SQLite is a good solution but I still found things a bit
>>>>> slow when I was storing all the data in the db, but if we are instead
>>>>> just indexing byte offsets in the file (which is what the current
>>>>> indexing is doing) maybe it will perform well enough.
>>>>> 
>>>>> One question on implementing this is do we want to have plug-in
>>>>> implementations to the Bio::Index:: classes (and Bio::DB::Fasta as well
>>>>> I would think) that can abstract the indexing method or just a new
>>>>> implementation as Bio::Index::FastqSQLite... Or we can just replace
>>>>> BDB/DB_File with SQLite and now have a new required dependency?
>>>>> 
>>>>> I'd want to also look at the solutions employed in some of the short
>>>>> read aligners if they do index the fastq files in any other way.
>>>>> 
>>>>> -jason
>>>>> Chris Fields wrote, On 4/6/10 12:47 PM:
>>>>>> No problem, it points to issue in the current implementation that need
>>>>>> addressing.
>>>>>> 
>>>>>> Jason, you thinking we just need to replace BDB with SQLite, or you
>>>>>> thinking something else?
>>>>>> 
>>>>>> chris
>>>>>> 
>>>>>> On Apr 6, 2010, at 2:38 PM, KOVALIC, DAVID K [AG/1000] wrote:
>>>>>> 
>>>>>>> Guys,
>>>>>>> 
>>>>>>> Thanks for information; it is good to know what the problem is.
>>>>>>> 
>>>>>>> I am afraid I am not much of a programmer so I am not liable to be much
>>>>>>> help with any work switching out the back-end. I can however volunteer
>>>>>>> for testing purposes if this helps at all.
>>>>>>> 
>>>>>>> I think this is just a case of NGS data volumes having overtaken a
>>>>>>> previously adequate implementations.
>>>>>>> 
>>>>>>> David
>>>>>>> 
>>>>>>> 
>>>>>>> -----Original Message-----
>>>>>>> From: Chris Fields [mailto:cjfields at illinois.edu]
>>>>>>> Sent: Monday, April 05, 2010 6:57 PM
>>>>>>> To: Peter
>>>>>>> Cc: Jason Stajich; KOVALIC, DAVID K [AG/1000]; bioperl-l at bioperl.org
>>>>>>> Subject: Re: [Bioperl-l] Bio::Index::Fastq - Interface for indexing
>>>>>>> (multiple) fastq files failure
>>>>>>> 
>>>>>>> On Apr 5, 2010, at 6:15 PM, Peter wrote:
>>>>>>> 
>>>>>>>> On Mon, Apr 5, 2010 at 11:53 PM, Jason Stajich<jason at bioperl.org>
>>>>>>> wrote:
>>>>>>>>> Hi David - I am not sure this is going to be the right tool for the
>>>>>>> job.
>>>>>>>>> I'm concerned that none of the Bio::Index:: will really work for
>>>>>>>>> Illumina/NGS size data because once you get beyond about 4M hash
>>>>>>>>> keys things slow down quite dramatically and/or don't finish.
>>>>>>>>> 
>>>>>>>>> I think we have to consider SQLite implementations or some more
>>>>>>>>> explicit way to handle larger keysize for hashes in the DB_File or
>>>>>>>>> BerkeleyDB approach. A similar slow problem can be seen if you
>>>>>>>>> just index a fastq converted fasta file from a single Illumina lane.
>>>>>>>> Another example, and this was in Python rather than Perl, but
>>>>>>>> SQLite got a thumbs up over an in house hash based approach:
>>>>>>> http://lists.idyll.org/pipermail/biology-in-python/2010-March/000511.htm
>>>>>>> l
>>>>>>>> I think a new SQLite based Bio* OBF successor to the existing
>>>>>>>> BDB based OBDA standard for indexing files could be very interesting.
>>>>>>>> 
>>>>>>>> Peter
>>>>>>> Would be nice to get some ideas performance-wise with some data sets.
>>>>>>> SQLite is a very easy option (I'm using it routinely as well).
>>>>>>> 
>>>>>>> chris
>>>>>>> 
>>>>>>> ---------------------------------------------------------------------------------------------------------
>>>>>>> 
>>>>>>> This e-mail message may contain privileged and/or confidential
>>>>>>> information, and is intended to be received only by persons entitled
>>>>>>> to receive such information. If you have received this e-mail in
>>>>>>> error, please notify the sender immediately. Please delete it and all
>>>>>>> attachments from any servers, hard drives or any other media. Other
>>>>>>> use of this e-mail by you is strictly prohibited.
>>>>>>> 
>>>>>>> 
>>>>>>> All e-mails and attachments sent and received are subject to
>>>>>>> monitoring, reading and archival by Monsanto, including its
>>>>>>> subsidiaries. The recipient of this e-mail is solely responsible for
>>>>>>> checking for the presence of "Viruses" or other "Malware". Monsanto,
>>>>>>> along with its subsidiaries, accepts no liability for any damage
>>>>>>> caused by any such code transmitted by or accompanying this e-mail or
>>>>>>> any attachment.
>>>>>>> ---------------------------------------------------------------------------------------------------------
>>>>>> 
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> 
> -- 
> Till Bayer
> 4700 King Abdullah University for Science and Technology
> Building 2, Room 4231-W16
> Thuwal 23955-6900
> Saudi Arabia
> Phone: +96628082373
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From ss5 at renormalist.net  Tue Apr 13 09:07:43 2010
From: ss5 at renormalist.net (Steffen Schwigon)
Date: Tue, 13 Apr 2010 15:07:43 +0200
Subject: [Bioperl-l] Bio-Perl workload for benchmarking Perl
In-Reply-To: <41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com> (Christopher
	Fields's message of "Tue\, 6 Apr 2010 09\:54\:38 -0500")
References: <87aatht1r0.fsf@renormalist.net>
	<41931654-0CF4-4A0C-B2B8-FE6F0D000C60@gmail.com>
Message-ID: <874ojf4i1s.fsf@renormalist.net>

Hi all!

I want to refresh my asking for some BioPerl code that I can use in a
Perl benchmark suite.

I think BioPerl is an interesting application of Perl and should be
covered by a benchmark suite that tries to execute *real world*
workloads.

If someone could prepare code snippets and data files that utilize
BioPerl and preferrably run for several minutes or even hours I would
happpily integrate them.

The short term goal is to create a comprehensive benchmark suite at
all, because Perl lacks one.

The benefit to BioPerl people is the ability to tweak or compare
between machines, optimizations and Perl version, measure performance
regressions, etc.; on the upcoming GSoC BioPerl projects it might even
be a reference to compare after refactoring.

I for myself are not able to write meaningful BioPerl code 
and therefore ask around in communities that might provide 
use-cases. BioPerl is one. IMHO.

Thanks.

Kind regards,
Steffen
-- 
Steffen Schwigon <ss5 at renormalist.net>
Dresden Perl Mongers <http://dresden-pm.org/>

From biopython at maubp.freeserve.co.uk  Tue Apr 13 10:30:22 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 13 Apr 2010 15:30:22 +0100
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>

On Mon, Feb 22, 2010 at 10:09 PM, Chris Fields <cjfields at illinois.edu> wrote:
> All,
>
> As a backup for the anonymous svn access on code.open-bio.org, I have
> set up a few READ-ONLY mirrors on GitHub for the main trunk code of
> several BioPerl distributions, generated using git-svn:
>
> http://github.com/bioperl
>
> These are sync'ed every 15 minutes.
>
> Note the emphasis on 'read-only'; we don't anticipate migrating code
> over to github completely, at least at the moment. ?Based on that and
> several issues with git/svn two-way syncing (outlined in the git-svn man
> pages and elsewhere), we will not support pull requests directly in
> github.
>
> enjoy!
>
> chris

Hi all,

At the start of April GitHub announced support for accessing a
github.com hosted git repository via SVN (and this is apparently
not an April Fools joke):

http://github.com/blog/626-announcing-svn-support

This means in addition to using the github read only mirror via git, e.g.

git clone git://github.com/bioperl/bioperl-live.git

You can also use the github read only mirror via svn, e.g.

svn checkout http://svn.github.com/bioperl/bioperl-live.git

I've just used this to grab the latest code - it seems to work fine.
This should be handy if code.open-bio.org (the OBF anonymous
CVS and SVN server) is down.

Regards,

Peter


From cjfields at illinois.edu  Tue Apr 13 11:10:33 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 13 Apr 2010 10:10:33 -0500
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>
	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
Message-ID: <EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>



On Apr 13, 2010, at 9:30 AM, Peter wrote:

> On Mon, Feb 22, 2010 at 10:09 PM, Chris Fields <cjfields at illinois.edu> wrote:
>> All,
>> 
>> As a backup for the anonymous svn access on code.open-bio.org, I have
>> set up a few READ-ONLY mirrors on GitHub for the main trunk code of
>> several BioPerl distributions, generated using git-svn:
>> 
>> http://github.com/bioperl
>> 
>> These are sync'ed every 15 minutes.
>> 
>> Note the emphasis on 'read-only'; we don't anticipate migrating code
>> over to github completely, at least at the moment.  Based on that and
>> several issues with git/svn two-way syncing (outlined in the git-svn man
>> pages and elsewhere), we will not support pull requests directly in
>> github.
>> 
>> enjoy!
>> 
>> chris
> 
> Hi all,
> 
> At the start of April GitHub announced support for accessing a
> github.com hosted git repository via SVN (and this is apparently
> not an April Fools joke):
> 
> http://github.com/blog/626-announcing-svn-support
> 
> This means in addition to using the github read only mirror via git, e.g.
> 
> git clone git://github.com/bioperl/bioperl-live.git
> 
> You can also use the github read only mirror via svn, e.g.
> 
> svn checkout http://svn.github.com/bioperl/bioperl-live.git
> 
> I've just used this to grab the latest code - it seems to work fine.
> This should be handy if code.open-bio.org (the OBF anonymous
> CVS and SVN server) is down.
> 
> Regards,
> 
> Peter

Yes, saw that.  I'm thinking more and more we should start migrating our work to github...

chris




From dimitark at bii.a-star.edu.sg  Tue Apr 13 23:02:20 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Wed, 14 Apr 2010 11:02:20 +0800
Subject: [Bioperl-l] strange behavior of
	Bio::Tools::Run::Alignment::StandAloneFasta
Message-ID: <4BC5303C.7010504@bii.a-star.edu.sg>

Hello guys,
i found some strange behavior of the the module 
"Bio::Tools::Run::Alignment::StandAloneFasta". I am trying to run 
"ssearch36" or "fasta36" locally and parse the report. I want to get the 
hits name, e-values, and sequences out of the report and print them to 
another file which i can process further.

Below is the code where - $fh_dbs=file with a list of fasta libraries; 
$line=my current fasta library; $seq=my query.

my @arg=(
     'E' => '0.01',
     'd' => '0', #problem here
     'H' => '',
     'w' => '100',
     'O' => "$output",
     'program' => 'ssearch36',
     );

my $line;
while($line=<$fh_dbs>){
     chomp($line);
     print "DB:$line:\n";


     my $factory=Bio::Tools::Run::Alignment::StandAloneFasta->new(@arg);
     $factory->library($line);
     my @fastreport=$factory->run($seq);

     foreach  (@fastreport) {
     print "Parsed fasta report:\n";
     my $result = $_->next_result;

         while( my $hit = $result->next_hit()) {
             print "\thit name: ", $hit->name();
             while( my $hsp = $hit->next_hsp()) {
                 my $e_val=$hsp->evalue;
                 my $qseq=$hsp->query_string;
                 my $hseq=$hsp->hit_string;
                 print "E:$e_val:\n",
                 print "Q-SEQ:$qseq:\n";
                 print "HIT-SEQ:$hseq:\n";


             }
         }
     }
}

Now the weird thing is that if i mark the line 'd' => '0' then i can get 
the HIT and QUERY sequences but not the E-value and if its unmarked as i 
want it then i can get the E-value but not the sequences.
Its strange and i dont know how to solve that problem.
If someone has any idea how i can go around that i would be very thankful.


Thanks
Dimitar

PS: Another problem i found is the "q" option. Even if i pass it through 
the @arg, its not working. I still see the output on my terminal.

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From cjfields at illinois.edu  Tue Apr 13 23:34:38 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 13 Apr 2010 22:34:38 -0500
Subject: [Bioperl-l] strange behavior of
	Bio::Tools::Run::Alignment::StandAloneFasta
In-Reply-To: <4BC5303C.7010504@bii.a-star.edu.sg>
References: <4BC5303C.7010504@bii.a-star.edu.sg>
Message-ID: <410EE006-BA2F-4BDF-AB3A-3CE85E3E89ED@illinois.edu>

You should file this as a bug.  My guess is something here is checking for boolean context instead of defined(), so is failing when set to 0.  

The other issue, setting of 'q', might be unimplemented.

chris

On Apr 13, 2010, at 10:02 PM, Dimitar Kenanov wrote:

> Hello guys,
> i found some strange behavior of the the module "Bio::Tools::Run::Alignment::StandAloneFasta". I am trying to run "ssearch36" or "fasta36" locally and parse the report. I want to get the hits name, e-values, and sequences out of the report and print them to another file which i can process further.
> 
> Below is the code where - $fh_dbs=file with a list of fasta libraries; $line=my current fasta library; $seq=my query.
> 
> my @arg=(
>    'E' => '0.01',
>    'd' => '0', #problem here
>    'H' => '',
>    'w' => '100',
>    'O' => "$output",
>    'program' => 'ssearch36',
>    );
> 
> my $line;
> while($line=<$fh_dbs>){
>    chomp($line);
>    print "DB:$line:\n";
> 
> 
>    my $factory=Bio::Tools::Run::Alignment::StandAloneFasta->new(@arg);
>    $factory->library($line);
>    my @fastreport=$factory->run($seq);
> 
>    foreach  (@fastreport) {
>    print "Parsed fasta report:\n";
>    my $result = $_->next_result;
> 
>        while( my $hit = $result->next_hit()) {
>            print "\thit name: ", $hit->name();
>            while( my $hsp = $hit->next_hsp()) {
>                my $e_val=$hsp->evalue;
>                my $qseq=$hsp->query_string;
>                my $hseq=$hsp->hit_string;
>                print "E:$e_val:\n",
>                print "Q-SEQ:$qseq:\n";
>                print "HIT-SEQ:$hseq:\n";
> 
> 
>            }
>        }
>    }
> }
> 
> Now the weird thing is that if i mark the line 'd' => '0' then i can get the HIT and QUERY sequences but not the E-value and if its unmarked as i want it then i can get the E-value but not the sequences.
> Its strange and i dont know how to solve that problem.
> If someone has any idea how i can go around that i would be very thankful.
> 
> 
> Thanks
> Dimitar
> 
> PS: Another problem i found is the "q" option. Even if i pass it through the @arg, its not working. I still see the output on my terminal.
> 
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jason at bioperl.org  Wed Apr 14 02:16:53 2010
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 13 Apr 2010 23:16:53 -0700
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
	<EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
Message-ID: <4BC55DD5.1030302@bioperl.org>

I think we should migrate as well. The primary can also be at github if 
you like - the lack of code.open-bio system is a real problem that 
doesn't seem to be getting fixed....
We could also make the primary github if need be?

-jason

Chris Fields wrote, On 4/13/10 8:10 AM:
> On Apr 13, 2010, at 9:30 AM, Peter wrote:
>
>    
>> On Mon, Feb 22, 2010 at 10:09 PM, Chris Fields<cjfields at illinois.edu>  wrote:
>>      
>>> All,
>>>
>>> As a backup for the anonymous svn access on code.open-bio.org, I have
>>> set up a few READ-ONLY mirrors on GitHub for the main trunk code of
>>> several BioPerl distributions, generated using git-svn:
>>>
>>> http://github.com/bioperl
>>>
>>> These are sync'ed every 15 minutes.
>>>
>>> Note the emphasis on 'read-only'; we don't anticipate migrating code
>>> over to github completely, at least at the moment.  Based on that and
>>> several issues with git/svn two-way syncing (outlined in the git-svn man
>>> pages and elsewhere), we will not support pull requests directly in
>>> github.
>>>
>>> enjoy!
>>>
>>> chris
>>>        
>> Hi all,
>>
>> At the start of April GitHub announced support for accessing a
>> github.com hosted git repository via SVN (and this is apparently
>> not an April Fools joke):
>>
>> http://github.com/blog/626-announcing-svn-support
>>
>> This means in addition to using the github read only mirror via git, e.g.
>>
>> git clone git://github.com/bioperl/bioperl-live.git
>>
>> You can also use the github read only mirror via svn, e.g.
>>
>> svn checkout http://svn.github.com/bioperl/bioperl-live.git
>>
>> I've just used this to grab the latest code - it seems to work fine.
>> This should be handy if code.open-bio.org (the OBF anonymous
>> CVS and SVN server) is down.
>>
>> Regards,
>>
>> Peter
>>      
>
> Yes, saw that.  I'm thinking more and more we should start migrating our work to github...
>
> chris
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>    

From biopython at maubp.freeserve.co.uk  Wed Apr 14 04:46:23 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Wed, 14 Apr 2010 09:46:23 +0100
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <4BC55DD5.1030302@bioperl.org>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>
	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
	<EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
	<4BC55DD5.1030302@bioperl.org>
Message-ID: <p2q320fb6e01004140146l39782d83z58958404b9bb5da1@mail.gmail.com>

On Wed, Apr 14, 2010 at 7:16 AM, Jason Stajich <jason at bioperl.org> wrote:
> I think we should migrate as well. The primary can also be at github if you
> like - the lack of code.open-bio system is a real problem that doesn't seem
> to be getting fixed....
> We could also make the primary github if need be?
>
> -jason

We (Biopython) and BioRuby certainly seem happy with github.

You've probably thought of the following issues, but just in case I've
written some thoughts from our migration.

If you want to go down this route, I would strongly urge you delete the
current github repositories and instead do a proper import from SVN
to git with the FULL history. I'd do this ASAP to disrupt as few users as
possible.

For BioPerl you have the four sub-repositories (bioperl-live etc) which
adds a later of complexity we didn't have to worry about.

I'd then suggest you continue with SVN on dev.open-bio.org as the
primary in the short to medium term, but declare github.com/bioperl
as the official mirror for anonymous read only access (via git or SVN).

You can then encourage the BioPerl devs to setup their own forks on
github, and experiment there with branching and merging - but for now
keep github.com/bioperl as read only, updated only via the SVN import
from dev.open-bio.org

We had a couple of months like that (all commits via CVS, pushed to
github), and I personally found it a very useful training period.

(Not wishing to dictate - these are just my suggestions for the outside
having been though something similar)

Regards,

Peter

From dimitark at bii.a-star.edu.sg  Wed Apr 14 06:51:12 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Wed, 14 Apr 2010 18:51:12 +0800
Subject: [Bioperl-l] question about Bio::Tools::Run::StandAloneBlast
Message-ID: <4BC59E20.1030200@bii.a-star.edu.sg>

Hi guys,
another question, this time about "Bio::Tools::Run::StandAloneBlast" . 
Now i want to run 'tblastn', so i follow the guide on CAPN but it doesnt 
matter what i do the module complains:

--------------------- WARNING ---------------------
MSG: cannot find path to blastall

This is frustrating :) Here is my code:

##########
my $report_tbn="report_TBN_out.txt";
my $dbase="/path/to/Preformatted-DB/human_genomic";
my @params_tbn = (-program => 'tblastn',
                                      -database => "$dbase",
                                      -outfile => "$tmpout");

my $factory_tbn = Bio::Tools::Run::StandAloneBlast->new(@params_tbn);
$factory_tbn->e("0.01");
$factory_tbn->program_dir("/opt/blast/bin");_#here i tried to help it :)_
$factory_tbn->executable('tblastn');

my $seq_stream = Bio::SeqIO->new(-file=>"$report_ss", -format => 'Fasta');
my $seq2;
while($seq2=$seq_stream->next_seq()){
     my $blast_report = $factory_tbn->blastall($seq);
}
##############

May be the problem is that i am using BLAST+ package where theres no 
'blastall' at all and 'tblastn' and all programs are standalone.
If someone can guide me where(which module) i have to tweak a bit in 
order to drive that programs i would be grateful :)
Thank you for any help or directions

Cheers
Dimitar

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From cjfields at illinois.edu  Wed Apr 14 09:03:12 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 08:03:12 -0500
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <p2q320fb6e01004140146l39782d83z58958404b9bb5da1@mail.gmail.com>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>
	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
	<EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
	<4BC55DD5.1030302@bioperl.org>
	<p2q320fb6e01004140146l39782d83z58958404b9bb5da1@mail.gmail.com>
Message-ID: <4C90AAB5-0560-417F-8AF3-A28498CA6C25@illinois.edu>


On Apr 14, 2010, at 3:46 AM, Peter wrote:

> On Wed, Apr 14, 2010 at 7:16 AM, Jason Stajich <jason at bioperl.org> wrote:
>> I think we should migrate as well. The primary can also be at github if you
>> like - the lack of code.open-bio system is a real problem that doesn't seem
>> to be getting fixed....
>> We could also make the primary github if need be?
>> 
>> -jason
> 
> We (Biopython) and BioRuby certainly seem happy with github.
> 
> You've probably thought of the following issues, but just in case I've
> written some thoughts from our migration.
> 
> If you want to go down this route, I would strongly urge you delete the
> current github repositories and instead do a proper import from SVN
> to git with the FULL history. I'd do this ASAP to disrupt as few users as
> possible.

We'll have to announce this on the list first, in order to make sure there is a proper migration path.  We did this with the CVS->SNV migration a few years back without any real pain.  My guess is this wil be much easier, particularly if they have SVN support (though I would like to really test that out first).

> For BioPerl you have the four sub-repositories (bioperl-live etc) which
> adds a later of complexity we didn't have to worry about.

The current setup just looks at main trunk for those repos and pulls every 15 minutes.  

> I'd then suggest you continue with SVN on dev.open-bio.org as the
> primary in the short to medium term, but declare github.com/bioperl
> as the official mirror for anonymous read only access (via git or SVN).
> 
> You can then encourage the BioPerl devs to setup their own forks on
> github, and experiment there with branching and merging - but for now
> keep github.com/bioperl as read only, updated only via the SVN import
> from dev.open-bio.org
> 
> We had a couple of months like that (all commits via CVS, pushed to
> github), and I personally found it a very useful training period.
> 
> (Not wishing to dictate - these are just my suggestions for the outside
> having been though something similar)
> 
> Regards,
> 
> Peter

My thought is we'll test the complete migration to git locally on dev first (mirroring to github as ro, which can be forked/etc).  Not sure what we would need to do that; my local setup uses gitosis, but we could probably set up a /home/git-repositories/bioperl.git.  

This is another critical point:  the easiest path to migration is to move the entire svn repo over.  However, all bioperl is contained as one large repo.  Should we take this opportunity to try making them truly separate?  Or leave them as is?

Theoretically we shouldn't have to worry about which repo is the 'primary' as git is supposed to be truly non-distributed, but in reality most dists tend to make one location the dominant one for releases, so we can designate the github or dev the primary one that at that juncture.  

chris



From David.Messina at sbc.su.se  Wed Apr 14 09:03:47 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Wed, 14 Apr 2010 15:03:47 +0200
Subject: [Bioperl-l] question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <4BC59E20.1030200@bii.a-star.edu.sg>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
Message-ID: <5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>

Hi Dimitar,

> May be the problem is that i am using BLAST+ package where theres no 'blastall' at all and 'tblastn' and all programs are standalone.

That's exactly the problem.

This is what you're looking for:
http://www.bioperl.org/wiki/HOWTO:BlastPlus


Dave



From maj at fortinbras.us  Wed Apr 14 09:15:56 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Wed, 14 Apr 2010 09:15:56 -0400
Subject: [Bioperl-l] question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <4BC59E20.1030200@bii.a-star.edu.sg>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
Message-ID: <F412D6B31D4B42B68B60EE28392FAC26@NewLife>

Hi Dimitar--
You need Bio::Tools::Run::StandAloneBlastPlus! This is in the 
most recent trunk code (not in the 1.6.1 distribution). I would 
download this from the Google mirror:
$ svn co  http://bioperl.googlecode.com/svn/bioperl-live/trunk
and
$ svn co  http://bioperl.googlecode.com/svn/bioperl-run/trunk
Both updates are necessary.
cheers 
MAJ
----- Original Message ----- 
From: "Dimitar Kenanov" <dimitark at bii.a-star.edu.sg>
To: <bioperl-l at bioperl.org>
Sent: Wednesday, April 14, 2010 6:51 AM
Subject: [Bioperl-l] question about Bio::Tools::Run::StandAloneBlast


> Hi guys,
> another question, this time about "Bio::Tools::Run::StandAloneBlast" . 
> Now i want to run 'tblastn', so i follow the guide on CAPN but it doesnt 
> matter what i do the module complains:
> 
> --------------------- WARNING ---------------------
> MSG: cannot find path to blastall
> 
> This is frustrating :) Here is my code:
> 
> ##########
> my $report_tbn="report_TBN_out.txt";
> my $dbase="/path/to/Preformatted-DB/human_genomic";
> my @params_tbn = (-program => 'tblastn',
>                                      -database => "$dbase",
>                                      -outfile => "$tmpout");
> 
> my $factory_tbn = Bio::Tools::Run::StandAloneBlast->new(@params_tbn);
> $factory_tbn->e("0.01");
> $factory_tbn->program_dir("/opt/blast/bin");_#here i tried to help it :)_
> $factory_tbn->executable('tblastn');
> 
> my $seq_stream = Bio::SeqIO->new(-file=>"$report_ss", -format => 'Fasta');
> my $seq2;
> while($seq2=$seq_stream->next_seq()){
>     my $blast_report = $factory_tbn->blastall($seq);
> }
> ##############
> 
> May be the problem is that i am using BLAST+ package where theres no 
> 'blastall' at all and 'tblastn' and all programs are standalone.
> If someone can guide me where(which module) i have to tweak a bit in 
> order to drive that programs i would be grateful :)
> Thank you for any help or directions
> 
> Cheers
> Dimitar
> 
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
>

From cjfields at illinois.edu  Wed Apr 14 09:16:43 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 08:16:43 -0500
Subject: [Bioperl-l] question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
Message-ID: <6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>

I'm assuming that we will slowly be deprecating use of those modules as users migrate over to BLAST+.  I'm not sure, but I don't think NCBI will support legacy BLAST that much longer.

chris

On Apr 14, 2010, at 8:03 AM, Dave Messina wrote:

> Hi Dimitar,
> 
>> May be the problem is that i am using BLAST+ package where theres no 'blastall' at all and 'tblastn' and all programs are standalone.
> 
> That's exactly the problem.
> 
> This is what you're looking for:
> http://www.bioperl.org/wiki/HOWTO:BlastPlus
> 
> 
> Dave
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From robert.bradbury at gmail.com  Wed Apr 14 11:43:08 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Wed, 14 Apr 2010 11:43:08 -0400
Subject: [Bioperl-l] Fwd:  question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
Message-ID: <h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>

On Wed, Apr 14, 2010 at 9:16 AM, Chris Fields <cjfields at illinois.edu> wrote:

> I'm assuming that we will slowly be deprecating use of those modules as
> users migrate over to BLAST+.  I'm not sure, but I don't think NCBI will
> support legacy BLAST that much longer.
>
>
By "legacy BLAST" do you refer to blast submission requests from the
"public"?

I ask because I use BLAST @ NCBI a fair amount and have scripts that use it.
 [Though I would be very happy for a "Blast Gateway" [Google SoC
opportunity???] that would run queries against NCBI, JGI, Ensembl & perhaps
the various Yeast/Insect/Nematode databases].  I state this because of the
genome scale efforts that I'm aware of Broad seems to be feeding the data to
Ensembl first while a lot of the data from JGI seems to take a long time to
make it to NCBI.]

I do realize that there is an some kind of an exponential growth problem
with the number of genomes sequenced and blast scans against the entire set
of genomes but I would hope that computing capacity is scaling with this.
 After all the number of species is finite.

But it would that if "free" resources for running blast scans are limited
that interfaces are going to have to move in the direction of a combined
"public"+"private" ("remote"+"local") methodology.

R.

From cjfields at illinois.edu  Wed Apr 14 12:45:49 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 11:45:49 -0500
Subject: [Bioperl-l] Fwd: question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
	<h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
Message-ID: <FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>

On Apr 14, 2010, at 10:43 AM, Robert Bradbury wrote:

> On Wed, Apr 14, 2010 at 9:16 AM, Chris Fields <cjfields at illinois.edu> wrote:
> 
>> I'm assuming that we will slowly be deprecating use of those modules as
>> users migrate over to BLAST+.  I'm not sure, but I don't think NCBI will
>> support legacy BLAST that much longer.
>> 
>> 
> By "legacy BLAST" do you refer to blast submission requests from the
> "public"?

No.  The changeover there should be relatively transparent.


> I ask because I use BLAST @ NCBI a fair amount and have scripts that use it.
> [Though I would be very happy for a "Blast Gateway" [Google SoC
> opportunity???] that would run queries against NCBI, JGI, Ensembl & perhaps
> the various Yeast/Insect/Nematode databases].  I state this because of the
> genome scale efforts that I'm aware of Broad seems to be feeding the data to
> Ensembl first while a lot of the data from JGI seems to take a long time to
> make it to NCBI.]
> 
> I do realize that there is an some kind of an exponential growth problem
> with the number of genomes sequenced and blast scans against the entire set
> of genomes but I would hope that computing capacity is scaling with this.
> After all the number of species is finite.

How so?  Do you have a reference for that?  There is this ongoing phenomenon I keep hearing of, called 'evolution'... (or, more specifically, 'speciation'...).

> But it would that if "free" resources for running blast scans are limited
> that interfaces are going to have to move in the direction of a combined
> "public"+"private" ("remote"+"local") methodology.
> 
> R.


Reality is, there will always be a public interface for some users, but there will similarly be local databases or power users who will require local BLAST capability for whatever reason (private data, large-scale analyses, etc).  If there were a demand for such a combined 'public:private' or similar service it certainly hasn't manifested itself yet.

chris




From bhakti.dwivedi at gmail.com  Wed Apr 14 13:20:08 2010
From: bhakti.dwivedi at gmail.com (Bhakti Dwivedi)
Date: Wed, 14 Apr 2010 13:20:08 -0400
Subject: [Bioperl-l] Tm calculation using thermodynamic concept for
	Degenerate Primers?
Message-ID: <n2jb643abd21004141020m828a06d0xbe84cc06b2cc1731@mail.gmail.com>

Does anyone know how to compute the melting temperature for Degenerate
Primers following the thermodynamic nearest neighbor model?  or how it
works? what I found so far is Tm calculations for primers with A,C,G, or T
only, but haven't came across anything that can help me explain the way it
works for degenerate primers, so I can implement that in my perl code.

any help please? Thanks!

Bhakti

From robert.bradbury at gmail.com  Wed Apr 14 13:39:14 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Wed, 14 Apr 2010 13:39:14 -0400
Subject: [Bioperl-l] Fwd: question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
	<h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
	<FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>
Message-ID: <x2ldeaa866a1004141039ifdaf0fd7t61e2f13bb914281d@mail.gmail.com>

>
>
>
> How so?  Do you have a reference for that?  There is this ongoing
> phenomenon I keep hearing of, called 'evolution'... (or, more specifically,
> 'speciation'...).
>

No reference.  I just know it from years of experience int software.  I was
employee #27 at Oracle Corp.  I had the opportunity of observe a company
"speciate".

>
> > But it would that if "free" resources for running blast scans are limited
> > that interfaces are going to have to move in the direction of a combined
> > "public"+"private" ("remote"+"local") methodology.
> >
> > R.
>
>
> Reality is, there will always be a public interface for some users, but
> there will similarly be local databases or power users who will require
> local BLAST capability for whatever reason (private data, large-scale
> analyses, etc).  If there were a demand for such a combined 'public:private'
> or similar service it certainly hasn't manifested itself yet.
>
> chris
>
>
>

From cjfields at illinois.edu  Wed Apr 14 14:06:05 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 13:06:05 -0500
Subject: [Bioperl-l] Fwd: question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <x2ldeaa866a1004141039ifdaf0fd7t61e2f13bb914281d@mail.gmail.com>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
	<h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
	<FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>
	<x2ldeaa866a1004141039ifdaf0fd7t61e2f13bb914281d@mail.gmail.com>
Message-ID: <8A8A1073-39A8-43FE-8DAA-4658A0B24B24@illinois.edu>


On Apr 14, 2010, at 12:39 PM, Robert Bradbury wrote:

>> 
>> 
>> 
>> How so?  Do you have a reference for that?  There is this ongoing
>> phenomenon I keep hearing of, called 'evolution'... (or, more specifically,
>> 'speciation'...).
>> 
> 
> No reference.  I just know it from years of experience int software.  I was
> employee #27 at Oracle Corp.  I had the opportunity of observe a company
> "speciate".

...which has absolutely nothing to do with organismal evolution, except in the realm of Terminator and similar sci-fi.

chris

From ajmackey at gmail.com  Wed Apr 14 14:52:27 2010
From: ajmackey at gmail.com (Aaron Mackey)
Date: Wed, 14 Apr 2010 14:52:27 -0400
Subject: [Bioperl-l] strange behavior of
	Bio::Tools::Run::Alignment::StandAloneFasta
In-Reply-To: <410EE006-BA2F-4BDF-AB3A-3CE85E3E89ED@illinois.edu>
References: <4BC5303C.7010504@bii.a-star.edu.sg>
	<410EE006-BA2F-4BDF-AB3A-3CE85E3E89ED@illinois.edu>
Message-ID: <q2i24c96eca1004141152v9116dc7cq99aa97895754c6d3@mail.gmail.com>

I also wouldn't be surprised if the BioPerl code doesn't play nicely with
the newer fasta 3.6 version you're using.

-Aaron

On Tue, Apr 13, 2010 at 11:34 PM, Chris Fields <cjfields at illinois.edu>wrote:

> You should file this as a bug.  My guess is something here is checking for
> boolean context instead of defined(), so is failing when set to 0.
>
> The other issue, setting of 'q', might be unimplemented.
>
> chris
>
> On Apr 13, 2010, at 10:02 PM, Dimitar Kenanov wrote:
>
> > Hello guys,
> > i found some strange behavior of the the module
> "Bio::Tools::Run::Alignment::StandAloneFasta". I am trying to run
> "ssearch36" or "fasta36" locally and parse the report. I want to get the
> hits name, e-values, and sequences out of the report and print them to
> another file which i can process further.
> >
> > Below is the code where - $fh_dbs=file with a list of fasta libraries;
> $line=my current fasta library; $seq=my query.
> >
> > my @arg=(
> >    'E' => '0.01',
> >    'd' => '0', #problem here
> >    'H' => '',
> >    'w' => '100',
> >    'O' => "$output",
> >    'program' => 'ssearch36',
> >    );
> >
> > my $line;
> > while($line=<$fh_dbs>){
> >    chomp($line);
> >    print "DB:$line:\n";
> >
> >
> >    my $factory=Bio::Tools::Run::Alignment::StandAloneFasta->new(@arg);
> >    $factory->library($line);
> >    my @fastreport=$factory->run($seq);
> >
> >    foreach  (@fastreport) {
> >    print "Parsed fasta report:\n";
> >    my $result = $_->next_result;
> >
> >        while( my $hit = $result->next_hit()) {
> >            print "\thit name: ", $hit->name();
> >            while( my $hsp = $hit->next_hsp()) {
> >                my $e_val=$hsp->evalue;
> >                my $qseq=$hsp->query_string;
> >                my $hseq=$hsp->hit_string;
> >                print "E:$e_val:\n",
> >                print "Q-SEQ:$qseq:\n";
> >                print "HIT-SEQ:$hseq:\n";
> >
> >
> >            }
> >        }
> >    }
> > }
> >
> > Now the weird thing is that if i mark the line 'd' => '0' then i can get
> the HIT and QUERY sequences but not the E-value and if its unmarked as i
> want it then i can get the E-value but not the sequences.
> > Its strange and i dont know how to solve that problem.
> > If someone has any idea how i can go around that i would be very
> thankful.
> >
> >
> > Thanks
> > Dimitar
> >
> > PS: Another problem i found is the "q" option. Even if i pass it through
> the @arg, its not working. I still see the output on my terminal.
> >
> > --
> > Dimitar Kenanov
> > Postdoctoral research fellow
> > Protein Sequence Analysis Group
> > Bioinformatics Institute
> > A*STAR, Singapore
> > email: dimitark at bii.a-star.edu.sg
> > tel: +65 6478 8514
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From pmiguel at purdue.edu  Wed Apr 14 16:08:49 2010
From: pmiguel at purdue.edu (Phillip San Miguel)
Date: Wed, 14 Apr 2010 16:08:49 -0400
Subject: [Bioperl-l] How to pull a codon by position from a rich sequence
	object
Message-ID: <4BC620D1.80300@purdue.edu>


I have a list of mutations positions (snps) in a reference genome 
(yeast). I would like to know what amino acid substitutions, if any, 
these mutations cause. How best to do this?

So my dream method would be called from a rich sequence object and take 
a single position (absolute base position in the genome) as an  argument 
and return the 3 base codon containing this position and an index (1, 2, 
or 3) of which base of the codon the argument was. Then I could 
translate the original codon and the mutant codon to get my answer using 
the Bio::Tools::CodonTable object.

Any such bioperl method? Any other recommendations? This would be fairly 
simple, were there not multiple exons to consider.

-- 
Phillip

From Jonathan.Moore at warwick.ac.uk  Fri Apr  9 09:39:40 2010
From: Jonathan.Moore at warwick.ac.uk (Moore, Jonathan)
Date: Fri, 9 Apr 2010 14:39:40 +0100
Subject: [Bioperl-l] Project: BioPerl 2.0 (and beyond)
References: <mailman.5904.1270766849.3372.bioperl-l@lists.open-bio.org>
Message-ID: <7BEB494D4E69964C8292CE4EDA2B9811F4490B@LAUREL.ads.warwick.ac.uk>

I've used Statistics::R without any problems for some plotting applications from within Perl on a webserver.  It lets you start up an R session silently from inside Perl, and issue R commands to the session.  Seems clean and easy to use.


Dr. Jonathan Moore
Senior Research Fellow in Bioinformatics
-- 
Warwick Systems Biology Centre 
Coventry House 
University of Warwick 
Coventry CV4 7AL 
U.K. 
+44 (0)24 761 50332 
http://go.warwick.ac.uk/jaymoore




From anomic at comcast.net  Sat Apr 10 20:41:29 2010
From: anomic at comcast.net (Joel Martin)
Date: Sat, 10 Apr 2010 17:41:29 -0700
Subject: [Bioperl-l] SeqIO::abi use
In-Reply-To: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
References: <2E5FF1ED-1F46-40DD-B9BE-54438E282C79@ohsu.edu>
Message-ID: <4BC11AB9.9070708@comcast.net>

I'd use phred instead of kbcaller, and with the -d for .poly files 
option, then parse the .poly files,
sounds like it might be the information you're after.

Joel

Tom Keller wrote:
> Greetings,
> Can the Bio::SeqIO::abi module be used to access the raw fluorescence data? Are there any examples available? I'm wondering how to calculate ratios of mixed bases prior to the smoothing and scaling done by the base caller.
>
> thank you
> Tom
> kellert at ohsu.edu<mailto:kellert at ohsu.edu>
> 503-494-2442
>
>
>
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>   


From chairman at yapc2010.com  Tue Apr 13 13:05:21 2010
From: chairman at yapc2010.com (Heath Bair)
Date: Tue, 13 Apr 2010 13:05:21 -0400
Subject: [Bioperl-l] Perl Conference at OSU, June 21-23rd 2010
Message-ID: <x2oae1dc6d41004131005q7d8c9e64hf843aec1ed2d604a@mail.gmail.com>

All:

My name is Heath Bair and I am the YAPC (Yet Another Perl Conference)
Chairman this year.  This year YAPC::NA 2010 is being held on the
campus of Ohio State University, in Columbus Ohio.  I apologize for
spamming your mailing list but I am just trying to get the word out
about this conference.

The conference website is http://conferences.mongueurs.net/yn2010

This year we are bring in Damian Conway from Australia, Randal
Schwartz, and of course Larry Wall, so it really could be an
extraordinary conference for everyone.

Please let me know if you have any questions or if you would like to
be involved in the conference.

Heath
YAPC::NA 2010 Conference Chairman
-- 
Heath
Cell:  (440) 289-9820

From mama at healthcare.uiowa.edu  Tue Apr 13 21:54:00 2010
From: mama at healthcare.uiowa.edu (Ma, Man Chun John)
Date: Tue, 13 Apr 2010 20:54:00 -0500
Subject: [Bioperl-l] Tools::Run::Primer3Redux
Message-ID: <8C486C1ABCFEEF439190FA27D3101EEB0478F9D1@HC-MAIL11.healthcare.uiowa.edu>

Hi,

This is the first time I write about development here and I hope I have
noticed most things.

It was until today I noticed the existence of Tools::Run::Primer3Redux
(which means the searching function needs improvement), and I already
have some code implementing the -p3_settings_file parameter-- however,
before I start rounding up, testing and commit, I see some problems we
have to discuss:

1. Should we implement the -io_version flag in primer3 2.X? Although it
does not seem difficult to implement, the major issue is we only do
sanity checks at set_parameters. Should the user change io_version after
settings parameters, the wrong kind of parameters may be fed to the
program.

2. Because I also do version check for p3_settings_file implementation
already, would it be better if we keep a permanent (program) version 2
flag in place? It'd be handy if we decided to re-implement $verbose, as
it will certainly trigger -echo_settings_file in p3_2.

Cheers,

John Ma
Kwitek Lab
Department of Internal Medicine
University of Iowa
Iowa City, Iowa, USA
 

__________ Information from ESET NOD32 Antivirus, version of virus
signature database 5026 (20100413) __________

The message was checked by ESET NOD32 Antivirus.

http://www.eset.com
 


From giles.weaver at googlemail.com  Wed Apr 14 16:36:37 2010
From: giles.weaver at googlemail.com (Giles Weaver)
Date: Wed, 14 Apr 2010 21:36:37 +0100
Subject: [Bioperl-l] Tm calculation using thermodynamic concept for
 Degenerate Primers?
In-Reply-To: <n2jb643abd21004141020m828a06d0xbe84cc06b2cc1731@mail.gmail.com>
References: <n2jb643abd21004141020m828a06d0xbe84cc06b2cc1731@mail.gmail.com>
Message-ID: <4BC62755.4020307@googlemail.com>

An HTML attachment was scrubbed...
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100414/389db66d/attachment.html>

From giles.weaver at googlemail.com  Wed Apr 14 17:08:43 2010
From: giles.weaver at googlemail.com (Giles Weaver)
Date: Wed, 14 Apr 2010 22:08:43 +0100
Subject: [Bioperl-l] Tm calculation using thermodynamic concept for
	Degenerate Primers?
In-Reply-To: <n2jb643abd21004141020m828a06d0xbe84cc06b2cc1731@mail.gmail.com>
References: <n2jb643abd21004141020m828a06d0xbe84cc06b2cc1731@mail.gmail.com>
Message-ID: <x2k1d06cd5d1004141408ia6e8fe73od2acacd874ebeaa9@mail.gmail.com>

Hi Bhakti,

My old code for calculating degenerate PCR primer Tm has been lurking
unloved on my computer for a while, so I've uploaded some snippets to
the BioPerl wiki scrapbook at
http://www.bioperl.org/wiki/Category:PCR_Primers/Scrapbook.

The code uses BioPerl together with Primer 3. I don't have a pure perl
implementation. I can't remember what Tm calculation methods are
available through Primer 3, but I believe there are several methods in
the documentation. I haven't seen a method for calculating the Tm of
primers with Inosine, but that may not matter to you.

The constituents of degenerate primers can have a wide range of
melting temperatures, so finding forward and reverse primers that
operate within an acceptable range could be tricky. As for what
constitutes an acceptable temperature range, I suggest you consult
your nearest friendly PCR technician. If you get any sensible answers
please report back.

I hope this helps, please let me know how you get on.

Giles

P.S. Apologies for the re-post, HTML email bad...

On 14/04/10 18:20, Bhakti Dwivedi wrote:

Does anyone know how to compute the melting temperature for Degenerate
Primers following the thermodynamic nearest neighbor model?  or how it
works? what I found so far is Tm calculations for primers with A,C,G, or T
only, but haven't came across anything that can help me explain the way it
works for degenerate primers, so I can implement that in my perl code.

any help please? Thanks!

Bhakti
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l

From cjfields at illinois.edu  Wed Apr 14 19:37:39 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 18:37:39 -0500
Subject: [Bioperl-l] strange behavior of
	Bio::Tools::Run::Alignment::StandAloneFasta
In-Reply-To: <q2i24c96eca1004141152v9116dc7cq99aa97895754c6d3@mail.gmail.com>
References: <4BC5303C.7010504@bii.a-star.edu.sg>
	<410EE006-BA2F-4BDF-AB3A-3CE85E3E89ED@illinois.edu>
	<q2i24c96eca1004141152v9116dc7cq99aa97895754c6d3@mail.gmail.com>
Message-ID: <F6A5150E-E2B4-41B1-B864-C97C1EBF99F5@illinois.edu>

Should be easy enough to test.

chris

On Apr 14, 2010, at 1:52 PM, Aaron Mackey wrote:

> I also wouldn't be surprised if the BioPerl code doesn't play nicely with
> the newer fasta 3.6 version you're using.
> 
> -Aaron
> 
> On Tue, Apr 13, 2010 at 11:34 PM, Chris Fields <cjfields at illinois.edu>wrote:
> 
>> You should file this as a bug.  My guess is something here is checking for
>> boolean context instead of defined(), so is failing when set to 0.
>> 
>> The other issue, setting of 'q', might be unimplemented.
>> 
>> chris
>> 
>> On Apr 13, 2010, at 10:02 PM, Dimitar Kenanov wrote:
>> 
>>> Hello guys,
>>> i found some strange behavior of the the module
>> "Bio::Tools::Run::Alignment::StandAloneFasta". I am trying to run
>> "ssearch36" or "fasta36" locally and parse the report. I want to get the
>> hits name, e-values, and sequences out of the report and print them to
>> another file which i can process further.
>>> 
>>> Below is the code where - $fh_dbs=file with a list of fasta libraries;
>> $line=my current fasta library; $seq=my query.
>>> 
>>> my @arg=(
>>>   'E' => '0.01',
>>>   'd' => '0', #problem here
>>>   'H' => '',
>>>   'w' => '100',
>>>   'O' => "$output",
>>>   'program' => 'ssearch36',
>>>   );
>>> 
>>> my $line;
>>> while($line=<$fh_dbs>){
>>>   chomp($line);
>>>   print "DB:$line:\n";
>>> 
>>> 
>>>   my $factory=Bio::Tools::Run::Alignment::StandAloneFasta->new(@arg);
>>>   $factory->library($line);
>>>   my @fastreport=$factory->run($seq);
>>> 
>>>   foreach  (@fastreport) {
>>>   print "Parsed fasta report:\n";
>>>   my $result = $_->next_result;
>>> 
>>>       while( my $hit = $result->next_hit()) {
>>>           print "\thit name: ", $hit->name();
>>>           while( my $hsp = $hit->next_hsp()) {
>>>               my $e_val=$hsp->evalue;
>>>               my $qseq=$hsp->query_string;
>>>               my $hseq=$hsp->hit_string;
>>>               print "E:$e_val:\n",
>>>               print "Q-SEQ:$qseq:\n";
>>>               print "HIT-SEQ:$hseq:\n";
>>> 
>>> 
>>>           }
>>>       }
>>>   }
>>> }
>>> 
>>> Now the weird thing is that if i mark the line 'd' => '0' then i can get
>> the HIT and QUERY sequences but not the E-value and if its unmarked as i
>> want it then i can get the E-value but not the sequences.
>>> Its strange and i dont know how to solve that problem.
>>> If someone has any idea how i can go around that i would be very
>> thankful.
>>> 
>>> 
>>> Thanks
>>> Dimitar
>>> 
>>> PS: Another problem i found is the "q" option. Even if i pass it through
>> the @arg, its not working. I still see the output on my terminal.
>>> 
>>> --
>>> Dimitar Kenanov
>>> Postdoctoral research fellow
>>> Protein Sequence Analysis Group
>>> Bioinformatics Institute
>>> A*STAR, Singapore
>>> email: dimitark at bii.a-star.edu.sg
>>> tel: +65 6478 8514
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Wed Apr 14 20:11:46 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 19:11:46 -0500
Subject: [Bioperl-l] Tools::Run::Primer3Redux
In-Reply-To: <8C486C1ABCFEEF439190FA27D3101EEB0478F9D1@HC-MAIL11.healthcare.uiowa.edu>
References: <8C486C1ABCFEEF439190FA27D3101EEB0478F9D1@HC-MAIL11.healthcare.uiowa.edu>
Message-ID: <0494AB8C-C40A-4D1C-89E9-2BF18ACD8F9D@illinois.edu>

John,

If you want you can submit a patch to address this.  The current Primer3Redux implementation is experimental (parameter work for the wrapper may be , but the API won't necessarily change much.  Though, it certainly isn't fixed in place, hence it being in bioperl-dev ;>

I'm a little unsure what you mean with #2 below.  If primer3 in now in v2 final (no longer alpha), yes we can change that.  Otherwise I'm not sure I want to make the default an alpha version.

chris

On Apr 13, 2010, at 8:54 PM, Ma, Man Chun John wrote:

> Hi,
> 
> This is the first time I write about development here and I hope I have
> noticed most things.
> 
> It was until today I noticed the existence of Tools::Run::Primer3Redux
> (which means the searching function needs improvement), and I already
> have some code implementing the -p3_settings_file parameter-- however,
> before I start rounding up, testing and commit, I see some problems we
> have to discuss:
> 
> 1. Should we implement the -io_version flag in primer3 2.X? Although it
> does not seem difficult to implement, the major issue is we only do
> sanity checks at set_parameters. Should the user change io_version after
> settings parameters, the wrong kind of parameters may be fed to the
> program.
> 
> 2. Because I also do version check for p3_settings_file implementation
> already, would it be better if we keep a permanent (program) version 2
> flag in place? It'd be handy if we decided to re-implement $verbose, as
> it will certainly trigger -echo_settings_file in p3_2.
> 
> Cheers,
> 
> John Ma
> Kwitek Lab
> Department of Internal Medicine
> University of Iowa
> Iowa City, Iowa, USA
> 
> 
> __________ Information from ESET NOD32 Antivirus, version of virus
> signature database 5026 (20100413) __________
> 
> The message was checked by ESET NOD32 Antivirus.
> 
> http://www.eset.com
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Wed Apr 14 22:48:12 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 14 Apr 2010 21:48:12 -0500
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <4BC55DD5.1030302@bioperl.org>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu>	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com>
	<EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
	<4BC55DD5.1030302@bioperl.org>
Message-ID: <50DA060E-E0FF-4984-B44B-A67F5ACF92D9@illinois.edu>

I'll work on a full test migration this weekend.

chris

On Apr 14, 2010, at 1:16 AM, Jason Stajich wrote:

> I think we should migrate as well. The primary can also be at github if you like - the lack of code.open-bio system is a real problem that doesn't seem to be getting fixed....
> We could also make the primary github if need be?
> 
> -jason
> 
> Chris Fields wrote, On 4/13/10 8:10 AM:
>> On Apr 13, 2010, at 9:30 AM, Peter wrote:
>> 
>>   
>>> On Mon, Feb 22, 2010 at 10:09 PM, Chris Fields<cjfields at illinois.edu>  wrote:
>>>     
>>>> All,
>>>> 
>>>> As a backup for the anonymous svn access on code.open-bio.org, I have
>>>> set up a few READ-ONLY mirrors on GitHub for the main trunk code of
>>>> several BioPerl distributions, generated using git-svn:
>>>> 
>>>> http://github.com/bioperl
>>>> 
>>>> These are sync'ed every 15 minutes.
>>>> 
>>>> Note the emphasis on 'read-only'; we don't anticipate migrating code
>>>> over to github completely, at least at the moment.  Based on that and
>>>> several issues with git/svn two-way syncing (outlined in the git-svn man
>>>> pages and elsewhere), we will not support pull requests directly in
>>>> github.
>>>> 
>>>> enjoy!
>>>> 
>>>> chris
>>>>       
>>> Hi all,
>>> 
>>> At the start of April GitHub announced support for accessing a
>>> github.com hosted git repository via SVN (and this is apparently
>>> not an April Fools joke):
>>> 
>>> http://github.com/blog/626-announcing-svn-support
>>> 
>>> This means in addition to using the github read only mirror via git, e.g.
>>> 
>>> git clone git://github.com/bioperl/bioperl-live.git
>>> 
>>> You can also use the github read only mirror via svn, e.g.
>>> 
>>> svn checkout http://svn.github.com/bioperl/bioperl-live.git
>>> 
>>> I've just used this to grab the latest code - it seems to work fine.
>>> This should be handy if code.open-bio.org (the OBF anonymous
>>> CVS and SVN server) is down.
>>> 
>>> Regards,
>>> 
>>> Peter
>>>     
>> 
>> Yes, saw that.  I'm thinking more and more we should start migrating our work to github...
>> 
>> chris
>> 
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>   
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From biopython at maubp.freeserve.co.uk  Thu Apr 15 04:51:53 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Thu, 15 Apr 2010 09:51:53 +0100
Subject: [Bioperl-l] Tools::Run::Primer3Redux
In-Reply-To: <0494AB8C-C40A-4D1C-89E9-2BF18ACD8F9D@illinois.edu>
References: <8C486C1ABCFEEF439190FA27D3101EEB0478F9D1@HC-MAIL11.healthcare.uiowa.edu>
	<0494AB8C-C40A-4D1C-89E9-2BF18ACD8F9D@illinois.edu>
Message-ID: <p2r320fb6e01004150151p965a0feu14fba0dc5844d1ce@mail.gmail.com>

On Thu, Apr 15, 2010 at 1:11 AM, Chris Fields <cjfields at illinois.edu> wrote:
> John,
>
> If you want you can submit a patch to address this. ?The current
> Primer3Redux implementation is experimental (parameter work for
> the wrapper may be , but the API won't necessarily change much.
> Though, it certainly isn't fixed in place, hence it being in bioperl-dev ;>
>
> I'm a little unsure what you mean with #2 below. ?If primer3 in now in v2
> final (no longer alpha), yes we can change that. ?Otherwise I'm not sure
> I want to make the default an alpha version.
>
> chris

Hi Chris,

Currently the latest release of primer3 is version 2.2.2 beta, so it does
look like a final release is coming and the command API should be
pretty static now (beta compared to an alpha release).
http://primer3.sourceforge.net/

Peter


From cjfields at illinois.edu  Thu Apr 15 08:23:32 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 15 Apr 2010 07:23:32 -0500
Subject: [Bioperl-l] Tools::Run::Primer3Redux
In-Reply-To: <p2r320fb6e01004150151p965a0feu14fba0dc5844d1ce@mail.gmail.com>
References: <8C486C1ABCFEEF439190FA27D3101EEB0478F9D1@HC-MAIL11.healthcare.uiowa.edu>
	<0494AB8C-C40A-4D1C-89E9-2BF18ACD8F9D@illinois.edu>
	<p2r320fb6e01004150151p965a0feu14fba0dc5844d1ce@mail.gmail.com>
Message-ID: <8F876BDF-B08C-4119-BFEC-1F278C26B6FB@illinois.edu>


On Apr 15, 2010, at 3:51 AM, Peter wrote:

> On Thu, Apr 15, 2010 at 1:11 AM, Chris Fields <cjfields at illinois.edu> wrote:
>> John,
>> 
>> If you want you can submit a patch to address this.  The current
>> Primer3Redux implementation is experimental (parameter work for
>> the wrapper may be , but the API won't necessarily change much.
>> Though, it certainly isn't fixed in place, hence it being in bioperl-dev ;>
>> 
>> I'm a little unsure what you mean with #2 below.  If primer3 in now in v2
>> final (no longer alpha), yes we can change that.  Otherwise I'm not sure
>> I want to make the default an alpha version.
>> 
>> chris
> 
> Hi Chris,
> 
> Currently the latest release of primer3 is version 2.2.2 beta, so it does
> look like a final release is coming and the command API should be
> pretty static now (beta compared to an alpha release).
> http://primer3.sourceforge.net/
> 
> Peter

Right, but it has taken a few years to go from alpha to beta.  Not to say that it will take a few more to final v2, but I've seen that happen (*cough*Infernal*cough*).

Best thing to do is contact the author.

chris

From robert.bradbury at gmail.com  Thu Apr 15 13:41:06 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Thu, 15 Apr 2010 13:41:06 -0400
Subject: [Bioperl-l] Fwd: question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <8A8A1073-39A8-43FE-8DAA-4658A0B24B24@illinois.edu>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
	<h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
	<FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>
	<x2ldeaa866a1004141039ifdaf0fd7t61e2f13bb914281d@mail.gmail.com>
	<8A8A1073-39A8-43FE-8DAA-4658A0B24B24@illinois.edu>
Message-ID: <j2vdeaa866a1004151041r5fe97a19sdefabe8443723e26@mail.gmail.com>

On Wed, Apr 14, 2010 at 2:06 PM, Chris Fields <cjfields at illinois.edu> wrote:

>
> ...which has absolutely nothing to do with organismal evolution, except in
> the realm of Terminator and similar sci-fi.


Chris, you are correct, because the rates of "organismal evolution" are
relatively fixed in our solar system.  Short of a GRB going off nearby they
are in effect constant [1].

So in effect you are asserting that there can be "no" non-sudden breaks in
the natural process of evolution?
[I would in contrast argue geological transitions which might indicate the
contrary.]
For example, can the mutational rate of an organism decline to zero or can
it evolve to the point where the genome destroys itself?

Granting your point of the question of # of species on the planet, I would
say that our ability to sequence their genomes is expanding much faster than
our ability to interpret them.  I would further assert that our ability to
sequence them is expanding more rapidly than their ability to speciate  [2]
[for mammals this appears to require several million years.]

That said, unless you view the number of species on the planet as being
created faster than our ability to sequence them, there is no argument.



1. A Global thermonuclear war or a slew of nuclear power reactor "accidents"
could increase the global mutation rate.  But it is likely that the mutation
rate is fixed for the short time period of human lives.
2. The ability to speciate is presumably fundamentally tied to ones ability
to mutate ones genome.

From cjfields at illinois.edu  Thu Apr 15 13:50:08 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 15 Apr 2010 12:50:08 -0500
Subject: [Bioperl-l] Fwd: question about Bio::Tools::Run::StandAloneBlast
In-Reply-To: <j2vdeaa866a1004151041r5fe97a19sdefabe8443723e26@mail.gmail.com>
References: <4BC59E20.1030200@bii.a-star.edu.sg>
	<5488B234-BDE4-4048-855D-5340C5DF79AF@sbc.su.se>
	<6E3B45FE-22EE-4BE6-9A3D-A91C12B4980C@illinois.edu>
	<k2pdeaa866a1004140841q84d56215x6a1a58a2f7ee3203@mail.gmail.com>
	<h2ydeaa866a1004140843h6085e445he14cf49ff89be161@mail.gmail.com>
	<FDBC643E-FF60-4765-9CA8-87D1687065C7@illinois.edu>
	<x2ldeaa866a1004141039ifdaf0fd7t61e2f13bb914281d@mail.gmail.com>
	<8A8A1073-39A8-43FE-8DAA-4658A0B24B24@illinois.edu>
	<j2vdeaa866a1004151041r5fe97a19sdefabe8443723e26@mail.gmail.com>
Message-ID: <44631EC4-2E6E-4269-BB49-4C0944DCB825@illinois.edu>

On Apr 15, 2010, at 12:41 PM, Robert Bradbury wrote:

> On Wed, Apr 14, 2010 at 2:06 PM, Chris Fields <cjfields at illinois.edu> wrote:
> 
>> 
>> ...which has absolutely nothing to do with organismal evolution, except in
>> the realm of Terminator and similar sci-fi.
> 
> 
> Chris, you are correct, because the rates of "organismal evolution" are
> relatively fixed in our solar system.  Short of a GRB going off nearby they
> are in effect constant [1].
> 
> So in effect you are asserting that there can be "no" non-sudden breaks in
> the natural process of evolution?
> [I would in contrast argue geological transitions which might indicate the
> contrary.]
> For example, can the mutational rate of an organism decline to zero or can
> it evolve to the point where the genome destroys itself?
> 
> Granting your point of the question of # of species on the planet, I would
> say that our ability to sequence their genomes is expanding much faster than
> our ability to interpret them.  I would further assert that our ability to
> sequence them is expanding more rapidly than their ability to speciate  [2]
> [for mammals this appears to require several million years.]
> 
> That said, unless you view the number of species on the planet as being
> created faster than our ability to sequence them, there is no argument.
> 
> 
> 
> 1. A Global thermonuclear war or a slew of nuclear power reactor "accidents"
> could increase the global mutation rate.  But it is likely that the mutation
> rate is fixed for the short time period of human lives.
> 2. The ability to speciate is presumably fundamentally tied to ones ability
> to mutate ones genome.

Um, okay?

chris

From madraghrua1690 at gmail.com  Thu Apr 15 20:07:54 2010
From: madraghrua1690 at gmail.com (MadraghRua)
Date: Thu, 15 Apr 2010 17:07:54 -0700 (PDT)
Subject: [Bioperl-l] General analysis report format convention
Message-ID: <08c1ff76-f48e-43a5-92e5-32e5d82703f1@5g2000yqj.googlegroups.com>

Folks
I'm trying to find a standardized report format that would support the
results of a variety of analysis tools, such as EMBOSS.  I realize
that GFF or BED might be a solution, I'm just not sure if anyone has
tried this out as a general report format. I know that formats like
Nexus for particular types of applications. Does anyone know of or
have experience with a more generalizable markup language, report
format or other convention?
Thanks!
MadraghRua



From cjfields at illinois.edu  Fri Apr 16 07:32:35 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 16 Apr 2010 06:32:35 -0500
Subject: [Bioperl-l] Fwd: about Bio::Tools::Run::Alignment::StandAloneFasta
References: <4BC7EB78.4070005@bii.a-star.edu.sg>
Message-ID: <836F50B3-E72C-4B08-98CB-44A3A063E468@illinois.edu>

Dimitar,

You should always forward bioperl-related matters directly to the mail list.  Unfortunately I'm unavailable until Monday, so I can't immediately get to it.  Can anyone take a look at this in the meantime?

chris

Begin forwarded message:

> From: Dimitar Kenanov <dimitark at bii.a-star.edu.sg>
> Date: April 15, 2010 11:45:44 PM CDT
> To: Chris Fields <cjfields at illinois.edu>
> Subject: about Bio::Tools::Run::Alignment::StandAloneFasta
> 
> Hi Chris,
> i wrote you about that the 'q' option in the module 'Bio::Tools::Run::Alignment::StandAloneFasta' is not functioning. I found out important thing. When 'ssearch' is used from terminal with -O (for the output) then theres always output and on the terminal. The only way to avoid that is to use '>' to direct to output to a file. So i went back to the module and modified it a bit :) Now i can give to the module the 'O' option as usual with my output file plus the 'q' option and i dont get output on the terminal.
> I just modified the '_setparams' and 'run' functions a bit. I attache the my modified module file where i commented the original lines with 'original' (very original :) ) and the others with 'dimitar'. There is the '$dim_out' = dimitar output :) to be clear and not to clash with something else.
> 
> May be there are some other users who dont want to see much output :)
> 
> Cheers
> Dimitar
> 
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
> 
-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: StandAloneFasta.pm
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100416/8c14ffd7/attachment.pl>
-------------- next part --------------
> 


From cjfields1 at gmail.com  Sat Apr 17 12:18:13 2010
From: cjfields1 at gmail.com (Chris Fields)
Date: Sat, 17 Apr 2010 11:18:13 -0500
Subject: [Bioperl-l] Possible migration to git/github
Message-ID: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>

All,

I wanted to get the BioPerl community's general input on a possible Subversion to git/github migration for the BioPerl repository.  The plans haven't been finalized in any way.  We haven't decided, for instance, on whether to make github the main site, a read-only mirror, or a downstream mirror for forking/pulling code from the community (with a central upstream dev repo for releases).  As a preliminary run I will be pushing a test run to github of bioperl-live (all tags/branches) this weekend.  

Thoughts have been circulating among the core developers for some time about a migration at some point, however recent problems with anon access to code has made this a more pressing issue.  The overall impression I am getting from the community at large is a move would be a positive thing and would swing the doors wide open for users to contribute much more easily (via forking). 

Therefore, I would like to outline the positive/negative aspects of a move to git/github, and a proposed path to migration if one should occur.  Remember, this is a project with 15+ years of code that has already undergone a recent migration from CVS->SVN.  Retaining history and branches/tags for all bioperl projects is key.  We also need to think logistically about other issues particularly with github (number of collaborators allowed per account, mapping authors, etc etc).

Personally, I think we should be moving forward with this as soon as possible, but I personally like git/github so I'm a bit biased.  The recently-added support for in-line code review comments and SVN support has particularly swayed me:

http://github.com/blog/626-announcing-svn-support
http://github.com/blog/622-inline-commit-notes

Thoughts?  Comments?  Flames?  Suggestions?

chris

From maj at fortinbras.us  Sat Apr 17 13:12:45 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Sat, 17 Apr 2010 13:12:45 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
Message-ID: <52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>

I think it's where we need to go. I agree that this need to move sooner rather 
than later. I also need to stop procrastinating and figure out git: Learn it, or 
be one.
cheers
----- Original Message ----- 
From: "Chris Fields" <cjfields1 at gmail.com>
To: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Saturday, April 17, 2010 12:18 PM
Subject: [Bioperl-l] Possible migration to git/github


> All,
>
> I wanted to get the BioPerl community's general input on a possible Subversion 
> to git/github migration for the BioPerl repository.  The plans haven't been 
> finalized in any way.  We haven't decided, for instance, on whether to make 
> github the main site, a read-only mirror, or a downstream mirror for 
> forking/pulling code from the community (with a central upstream dev repo for 
> releases).  As a preliminary run I will be pushing a test run to github of 
> bioperl-live (all tags/branches) this weekend.
>
> Thoughts have been circulating among the core developers for some time about a 
> migration at some point, however recent problems with anon access to code has 
> made this a more pressing issue.  The overall impression I am getting from the 
> community at large is a move would be a positive thing and would swing the 
> doors wide open for users to contribute much more easily (via forking).
>
> Therefore, I would like to outline the positive/negative aspects of a move to 
> git/github, and a proposed path to migration if one should occur.  Remember, 
> this is a project with 15+ years of code that has already undergone a recent 
> migration from CVS->SVN.  Retaining history and branches/tags for all bioperl 
> projects is key.  We also need to think logistically about other issues 
> particularly with github (number of collaborators allowed per account, mapping 
> authors, etc etc).
>
> Personally, I think we should be moving forward with this as soon as possible, 
> but I personally like git/github so I'm a bit biased.  The recently-added 
> support for in-line code review comments and SVN support has particularly 
> swayed me:
>
> http://github.com/blog/626-announcing-svn-support
> http://github.com/blog/622-inline-commit-notes
>
> Thoughts?  Comments?  Flames?  Suggestions?
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From bimber at wisc.edu  Sun Apr 18 16:30:26 2010
From: bimber at wisc.edu (Ben Bimber)
Date: Sun, 18 Apr 2010 15:30:26 -0500
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command that
	is executed?
Message-ID: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>

If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
is there an easy way to capture a string of the exact command that was
executed?  This would sometimes be useful for debugging / logging.
There are functions to capture stdout/stderror, but i did not see
anything with the command itself.  i could well have missed it though.
 Thanks.

From maj at fortinbras.us  Sun Apr 18 17:23:22 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Sun, 18 Apr 2010 17:23:22 -0400
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
Message-ID: <931BE65DB6514DCFA62236A29AB80422@NewLife>

Hi Ben, I believe the executable() method should have that-- MAJ
----- Original Message ----- 
From: "Ben Bimber" <bimber at wisc.edu>
To: "bioperl-l" <bioperl-l at lists.open-bio.org>
Sent: Sunday, April 18, 2010 4:30 PM
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command thatis 
executed?


> If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
> is there an easy way to capture a string of the exact command that was
> executed?  This would sometimes be useful for debugging / logging.
> There are functions to capture stdout/stderror, but i did not see
> anything with the command itself.  i could well have missed it though.
> Thanks.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From David.Messina at sbc.su.se  Mon Apr 19 07:35:31 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Mon, 19 Apr 2010 13:35:31 +0200
Subject: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
	to be parsed
In-Reply-To: <8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148731E47@iahcexch1.iah.bbsrc.ac.uk>
	<50F0159A-DE58-4405-A2FE-4FA95A3CDDA4@sbc.su.se>
	<8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>

Hi Mick,

Please email the list ? that way others who can help will know what's going on.

I looked at this for a few minutes and it seems that the issue is that the FASTA output doen't have any end-of-report indicator in a multiple query output file. The report just ends and then the next report begins.


e.g.

[ beginning of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

[ middle of report 1 omitted ]

                                 10        20   
2-210532                 UAGCUUAUCAGACUGAUGUUGAC
                         : :.:::::::. :::::     
cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG     
                            10        20        

[ implicit end of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
[ rest of report 2 omitted [


I don't know whether or how this has changed from earlier versions of FASTA ? presumably we were detecting end-of-report just fine for earlier versions ? but in any case we need to fix it for version 35.

I will try to work on it some more but I'm pretty short of time right now ? perhaps other devs could take a look?



Dave



On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:

> Hi Dave
> 
> I'm still having an associated bug from this fix, created last week:
> 
> http://bugzilla.open-bio.org/show_bug.cgi?id=3058
> 
> At present, this is a real show stopper for my analysis.  
> 
> Mick
> 
> -----Original Message-----
> From: Dave Messina [mailto:David.Messina at sbc.su.se] 
> Sent: 23 November 2009 17:46
> To: michael watson (IAH-C)
> Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be parsed
> 
> Hi Mick,
> 
> Sure thing -- the current build from subversion is packaged up every  
> night and available here:
> http://www.bioperl.org/DIST/nightly_builds/
> 
> Just grab bioperl-live.tar.gz from there and you'll get the changes.
> 
> 
> Dave
> 
> 
> 
> 
> On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
> 
>> Hi Dave
>> 
>> Thanks for the hard work.
>> 
>> Trying to get the latest updates so I can use this... don't have svn  
>> on my server, tried to install it and I don't have python either,  
>> which is needed to install it.
>> 
>> I face about 3 weeks whilst my IT department sort this out, unless I  
>> can access the changes any other way?
>> 
>> Thanks
>> Mick
>> 
>> -----Original Message-----
>> From: bugzilla-daemon at portal.open-bio.org [mailto:bugzilla- 
>> daemon at portal.open-bio.org]
>> Sent: 20 November 2009 15:12
>> To: michael watson (IAH-C)
>> Subject: [Bug 2937] Strand in fasta35 output does not seem to be  
>> parsed
>> 
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
>> 
>> 
>> online at davemessina.com changed:
>> 
>>          What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>            Status|NEW                         |RESOLVED
>>        Resolution|                            |FIXED
>> 
>> 
>> 
>> 
>> ------- Comment #7 from online at davemessina.com  2009-11-20 10:12 EST  
>> -------
>> Fixed in r16394.
>> 
>> Michael, thanks for the report. Your test cases pass, but please  
>> reopen the bug
>> if needed.
>> 
>> 
>> -- 
>> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi? 
>> tab=email
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
> 



From ajmackey at gmail.com  Mon Apr 19 07:48:58 2010
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 19 Apr 2010 07:48:58 -0400
Subject: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
	to be parsed
In-Reply-To: <2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>
References: <8D08960C647E64438CE5740657CBBDC50148731E47@iahcexch1.iah.bbsrc.ac.uk>
	<50F0159A-DE58-4405-A2FE-4FA95A3CDDA4@sbc.su.se>
	<8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
	<2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>
Message-ID: <q2r24c96eca1004190448kf5b01b4bpf756a864d37ddd0a@mail.gmail.com>

This doesn't looks like a multi-query report; rather this looks like
multiple separate executions, each with one query, that has been
concatenated together.  I don't think any of our report parsers will work in
this scenario.

-Aaron


On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se>wrote:

> Hi Mick,
>
> Please email the list ? that way others who can help will know what's going
> on.
>
> I looked at this for a few minutes and it seems that the issue is that the
> FASTA output doen't have any end-of-report indicator in a multiple query
> output file. The report just ends and then the next report begins.
>
>
> e.g.
>
> [ beginning of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
>
> [ middle of report 1 omitted ]
>
>                                 10        20
> 2-210532                 UAGCUUAUCAGACUGAUGUUGAC
>                         : :.:::::::. :::::
> cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
>                            10        20
>
> [ implicit end of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
> [ rest of report 2 omitted [
>
>
> I don't know whether or how this has changed from earlier versions of FASTA
> ? presumably we were detecting end-of-report just fine for earlier versions
> ? but in any case we need to fix it for version 35.
>
> I will try to work on it some more but I'm pretty short of time right now ?
> perhaps other devs could take a look?
>
>
>
> Dave
>
>
>
> On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:
>
> > Hi Dave
> >
> > I'm still having an associated bug from this fix, created last week:
> >
> > http://bugzilla.open-bio.org/show_bug.cgi?id=3058
> >
> > At present, this is a real show stopper for my analysis.
> >
> > Mick
> >
> > -----Original Message-----
> > From: Dave Messina [mailto:David.Messina at sbc.su.se]
> > Sent: 23 November 2009 17:46
> > To: michael watson (IAH-C)
> > Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be
> parsed
> >
> > Hi Mick,
> >
> > Sure thing -- the current build from subversion is packaged up every
> > night and available here:
> > http://www.bioperl.org/DIST/nightly_builds/
> >
> > Just grab bioperl-live.tar.gz from there and you'll get the changes.
> >
> >
> > Dave
> >
> >
> >
> >
> > On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
> >
> >> Hi Dave
> >>
> >> Thanks for the hard work.
> >>
> >> Trying to get the latest updates so I can use this... don't have svn
> >> on my server, tried to install it and I don't have python either,
> >> which is needed to install it.
> >>
> >> I face about 3 weeks whilst my IT department sort this out, unless I
> >> can access the changes any other way?
> >>
> >> Thanks
> >> Mick
> >>
> >> -----Original Message-----
> >> From: bugzilla-daemon at portal.open-bio.org [mailto:bugzilla-
> >> daemon at portal.open-bio.org]
> >> Sent: 20 November 2009 15:12
> >> To: michael watson (IAH-C)
> >> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
> >> parsed
> >>
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
> >>
> >>
> >> online at davemessina.com changed:
> >>
> >>          What    |Removed                     |Added
> >>
> ----------------------------------------------------------------------------
> >>            Status|NEW                         |RESOLVED
> >>        Resolution|                            |FIXED
> >>
> >>
> >>
> >>
> >> ------- Comment #7 from online at davemessina.com  2009-11-20 10:12 EST
> >> -------
> >> Fixed in r16394.
> >>
> >> Michael, thanks for the report. Your test cases pass, but please
> >> reopen the bug
> >> if needed.
> >>
> >>
> >> --
> >> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
> >> tab=email
> >> ------- You are receiving this mail because: -------
> >> You reported the bug, or are watching the reporter.
> >
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From michael.watson at bbsrc.ac.uk  Mon Apr 19 08:09:58 2010
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Mon, 19 Apr 2010 13:09:58 +0100
Subject: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
 to be parsed
In-Reply-To: <q2r24c96eca1004190448kf5b01b4bpf756a864d37ddd0a@mail.gmail.com>
References: <8D08960C647E64438CE5740657CBBDC50148731E47@iahcexch1.iah.bbsrc.ac.uk>
	<50F0159A-DE58-4405-A2FE-4FA95A3CDDA4@sbc.su.se>
	<8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
	<2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>,
	<q2r24c96eca1004190448kf5b01b4bpf756a864d37ddd0a@mail.gmail.com>
Message-ID: <8D08960C647E64438CE5740657CBBDC50210892668@iahcexch1.iah.bbsrc.ac.uk>

Hi 

I can guarantee this was from a single fasta execution, with input being a fasta file with multiple sequences. This output comes from the -O flag. There has been no concatenation.

Mick
________________________________________
From: Aaron Mackey [ajmackey at gmail.com]
Sent: 19 April 2010 12:48
To: Dave Messina
Cc: michael watson (IAH-C); BioPerl List
Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to   be parsed

This doesn't looks like a multi-query report; rather this looks like multiple separate executions, each with one query, that has been concatenated together.  I don't think any of our report parsers will work in this scenario.

-Aaron


On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>> wrote:
Hi Mick,

Please email the list ? that way others who can help will know what's going on.

I looked at this for a few minutes and it seems that the issue is that the FASTA output doen't have any end-of-report indicator in a multiple query output file. The report just ends and then the next report begins.


e.g.

[ beginning of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

[ middle of report 1 omitted ]

                                10        20
2-210532                 UAGCUUAUCAGACUGAUGUUGAC
                        : :.:::::::. :::::
cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
                           10        20

[ implicit end of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
[ rest of report 2 omitted [


I don't know whether or how this has changed from earlier versions of FASTA ? presumably we were detecting end-of-report just fine for earlier versions ? but in any case we need to fix it for version 35.

I will try to work on it some more but I'm pretty short of time right now ? perhaps other devs could take a look?



Dave



On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:

> Hi Dave
>
> I'm still having an associated bug from this fix, created last week:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=3058
>
> At present, this is a real show stopper for my analysis.
>
> Mick
>
> -----Original Message-----
> From: Dave Messina [mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>]
> Sent: 23 November 2009 17:46
> To: michael watson (IAH-C)
> Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be parsed
>
> Hi Mick,
>
> Sure thing -- the current build from subversion is packaged up every
> night and available here:
> http://www.bioperl.org/DIST/nightly_builds/
>
> Just grab bioperl-live.tar.gz from there and you'll get the changes.
>
>
> Dave
>
>
>
>
> On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
>
>> Hi Dave
>>
>> Thanks for the hard work.
>>
>> Trying to get the latest updates so I can use this... don't have svn
>> on my server, tried to install it and I don't have python either,
>> which is needed to install it.
>>
>> I face about 3 weeks whilst my IT department sort this out, unless I
>> can access the changes any other way?
>>
>> Thanks
>> Mick
>>
>> -----Original Message-----
>> From: bugzilla-daemon at portal.open-bio.org<mailto:bugzilla-daemon at portal.open-bio.org> [mailto:bugzilla-<mailto:bugzilla->
>> daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org>]
>> Sent: 20 November 2009 15:12
>> To: michael watson (IAH-C)
>> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
>> parsed
>>
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
>>
>>
>> online at davemessina.com<mailto:online at davemessina.com> changed:
>>
>>          What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>            Status|NEW                         |RESOLVED
>>        Resolution|                            |FIXED
>>
>>
>>
>>
>> ------- Comment #7 from online at davemessina.com<mailto:online at davemessina.com>  2009-11-20 10:12 EST
>> -------
>> Fixed in r16394.
>>
>> Michael, thanks for the report. Your test cases pass, but please
>> reopen the bug
>> if needed.
>>
>>
>> --
>> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
>> tab=email
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
>


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org>
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From maj at fortinbras.us  Mon Apr 19 08:05:42 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 19 Apr 2010 08:05:42 -0400
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
Message-ID: <5D89EC22743A460D96353F6FF82260A1@NewLife>

For the entire command line (program + parameters), there isn't a single place 
in WrapperBase where that is collected. WrapperBase::_setparams() produces the 
option string that can then  be appended to the program name for subsequent 
execution. In WrapperBase::CommandExts::_run(), the command line options are 
generated with _setparams, then passed to IPC::Run for a generic execution 
scheme. It would be easy enough from CommandExts to record the full command in a 
suitable object property; it's a good idea.
MAJ
----- Original Message ----- 
From: "Ben Bimber" <bimber at wisc.edu>
To: "bioperl-l" <bioperl-l at lists.open-bio.org>
Sent: Sunday, April 18, 2010 4:30 PM
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command thatis 
executed?


> If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
> is there an easy way to capture a string of the exact command that was
> executed?  This would sometimes be useful for debugging / logging.
> There are functions to capture stdout/stderror, but i did not see
> anything with the command itself.  i could well have missed it though.
> Thanks.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From maj at fortinbras.us  Mon Apr 19 09:03:49 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 19 Apr 2010 09:03:49 -0400
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
	<5D89EC22743A460D96353F6FF82260A1@NewLife>
	<p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
Message-ID: <7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>

Hey Ben,
Yes, the new stuff is in the bioperl-dev/trunk
svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
(code.open-bio.org was working as of this morning...)

This is all pretty experimental, so use at own risk. The XML-based
config system is experimental too at the moment (tho' all code
is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
good feedback from other Bio* peeps, who are advocating using an
existing config standard like emboss ACD or the Galaxy format.
I'll likely convert the wrappermaker system to using one of those,
but the custom format (in maker.xsd in bioperl-dev) will be there to
experiment with.

(To the list, any comments regarding this issue are welcome, see
 http://bioperl.org/wiki/HOWTO:Wrappers for an overview of
this project)

cheers MAJ
----- Original Message ----- 
From: "Ben Bimber" <bimber at wisc.edu>
To: "Mark A. Jensen" <maj at fortinbras.us>
Sent: Monday, April 19, 2010 8:27 AM
Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command 
thatis executed?


ok, that's what i thought.  whenever i need to debug something i've
been hacking CommandExts to print @ipc_args, but that's kind of an
ugly solution.

related to this - now that XML is supported instead of text-based
config files, is there a subversion repository where anyone is
gathering these files?  i saw your web-based XML generator, which is
useful.

-ben



On Mon, Apr 19, 2010 at 7:05 AM, Mark A. Jensen <maj at fortinbras.us> wrote:
> For the entire command line (program + parameters), there isn't a single
> place in WrapperBase where that is collected. WrapperBase::_setparams()
> produces the option string that can then be appended to the program name
> for subsequent execution. In WrapperBase::CommandExts::_run(), the command
> line options are generated with _setparams, then passed to IPC::Run for a
> generic execution scheme. It would be easy enough from CommandExts to record
> the full command in a suitable object property; it's a good idea.
> MAJ
> ----- Original Message ----- From: "Ben Bimber" <bimber at wisc.edu>
> To: "bioperl-l" <bioperl-l at lists.open-bio.org>
> Sent: Sunday, April 18, 2010 4:30 PM
> Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
> thatis executed?
>
>
>> If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
>> is there an easy way to capture a string of the exact command that was
>> executed? This would sometimes be useful for debugging / logging.
>> There are functions to capture stdout/stderror, but i did not see
>> anything with the command itself. i could well have missed it though.
>> Thanks.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
>



From cjfields at illinois.edu  Mon Apr 19 09:28:21 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 19 Apr 2010 08:28:21 -0500
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
	<5D89EC22743A460D96353F6FF82260A1@NewLife>
	<p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
	<7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
Message-ID: <F1073E99-F0DC-40C8-9580-8951756D14A6@illinois.edu>

Mark,

I think coming up with a cross-Bio* standard for wrappers is a very good idea, and would be worth further discussion here on-list and maybe at BOSC.  Centralizing around Galaxy is a good idea, though we may need to look into embellishing it if it doesn't suit all our needs.

Re: ACD, we essentially have the code for parsing ACD already in bioperl-run (I think Bio::Tools::Run::EMBOSSacd).

chris

On Apr 19, 2010, at 8:03 AM, Mark A. Jensen wrote:

> Hey Ben,
> Yes, the new stuff is in the bioperl-dev/trunk
> svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
> (code.open-bio.org was working as of this morning...)
> 
> This is all pretty experimental, so use at own risk. The XML-based
> config system is experimental too at the moment (tho' all code
> is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
> good feedback from other Bio* peeps, who are advocating using an
> existing config standard like emboss ACD or the Galaxy format.
> I'll likely convert the wrappermaker system to using one of those,
> but the custom format (in maker.xsd in bioperl-dev) will be there to
> experiment with.
> 
> (To the list, any comments regarding this issue are welcome, see
> http://bioperl.org/wiki/HOWTO:Wrappers for an overview of
> this project)
> 
> cheers MAJ
> ----- Original Message ----- From: "Ben Bimber" <bimber at wisc.edu>
> To: "Mark A. Jensen" <maj at fortinbras.us>
> Sent: Monday, April 19, 2010 8:27 AM
> Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command thatis executed?
> 
> 
> ok, that's what i thought.  whenever i need to debug something i've
> been hacking CommandExts to print @ipc_args, but that's kind of an
> ugly solution.
> 
> related to this - now that XML is supported instead of text-based
> config files, is there a subversion repository where anyone is
> gathering these files?  i saw your web-based XML generator, which is
> useful.
> 
> -ben
> 
> 
> 
> On Mon, Apr 19, 2010 at 7:05 AM, Mark A. Jensen <maj at fortinbras.us> wrote:
>> For the entire command line (program + parameters), there isn't a single
>> place in WrapperBase where that is collected. WrapperBase::_setparams()
>> produces the option string that can then be appended to the program name
>> for subsequent execution. In WrapperBase::CommandExts::_run(), the command
>> line options are generated with _setparams, then passed to IPC::Run for a
>> generic execution scheme. It would be easy enough from CommandExts to record
>> the full command in a suitable object property; it's a good idea.
>> MAJ
>> ----- Original Message ----- From: "Ben Bimber" <bimber at wisc.edu>
>> To: "bioperl-l" <bioperl-l at lists.open-bio.org>
>> Sent: Sunday, April 18, 2010 4:30 PM
>> Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
>> thatis executed?
>> 
>> 
>>> If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
>>> is there an easy way to capture a string of the exact command that was
>>> executed? This would sometimes be useful for debugging / logging.
>>> There are functions to capture stdout/stderror, but i did not see
>>> anything with the command itself. i could well have missed it though.
>>> Thanks.
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>>> 
>> 
>> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From ajmackey at gmail.com  Mon Apr 19 09:49:29 2010
From: ajmackey at gmail.com (Aaron Mackey)
Date: Mon, 19 Apr 2010 09:49:29 -0400
Subject: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
	to be parsed
In-Reply-To: <8D08960C647E64438CE5740657CBBDC50210892668@iahcexch1.iah.bbsrc.ac.uk>
References: <8D08960C647E64438CE5740657CBBDC50148731E47@iahcexch1.iah.bbsrc.ac.uk>
	<50F0159A-DE58-4405-A2FE-4FA95A3CDDA4@sbc.su.se>
	<8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
	<2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>
	<q2r24c96eca1004190448kf5b01b4bpf756a864d37ddd0a@mail.gmail.com>
	<8D08960C647E64438CE5740657CBBDC50210892668@iahcexch1.iah.bbsrc.ac.uk>
Message-ID: <z2t24c96eca1004190649i6b29523chc80c8c63c0b140d7@mail.gmail.com>

OK, my apologies.  When I saw the multiple "autodoc" lines, I figured
incorrectly.

-Aaron

On Mon, Apr 19, 2010 at 8:09 AM, michael watson (IAH-C) <
michael.watson at bbsrc.ac.uk> wrote:

> Hi
>
> I can guarantee this was from a single fasta execution, with input being a
> fasta file with multiple sequences. This output comes from the -O flag.
> There has been no concatenation.
>
> Mick
> ________________________________________
> From: Aaron Mackey [ajmackey at gmail.com]
> Sent: 19 April 2010 12:48
> To: Dave Messina
> Cc: michael watson (IAH-C); BioPerl List
> Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
> to   be parsed
>
> This doesn't looks like a multi-query report; rather this looks like
> multiple separate executions, each with one query, that has been
> concatenated together.  I don't think any of our report parsers will work in
> this scenario.
>
> -Aaron
>
>
> On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se
> <mailto:David.Messina at sbc.su.se>> wrote:
> Hi Mick,
>
> Please email the list ? that way others who can help will know what's going
> on.
>
> I looked at this for a few minutes and it seems that the issue is that the
> FASTA output doen't have any end-of-report indicator in a multiple query
> output file. The report just ends and then the next report begins.
>
>
> e.g.
>
> [ beginning of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
>
> [ middle of report 1 omitted ]
>
>                                10        20
> 2-210532                 UAGCUUAUCAGACUGAUGUUGAC
>                        : :.:::::::. :::::
> cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
>                           10        20
>
> [ implicit end of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
> [ rest of report 2 omitted [
>
>
> I don't know whether or how this has changed from earlier versions of FASTA
> ? presumably we were detecting end-of-report just fine for earlier versions
> ? but in any case we need to fix it for version 35.
>
> I will try to work on it some more but I'm pretty short of time right now ?
> perhaps other devs could take a look?
>
>
>
> Dave
>
>
>
> On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:
>
> > Hi Dave
> >
> > I'm still having an associated bug from this fix, created last week:
> >
> > http://bugzilla.open-bio.org/show_bug.cgi?id=3058
> >
> > At present, this is a real show stopper for my analysis.
> >
> > Mick
> >
> > -----Original Message-----
> > From: Dave Messina [mailto:David.Messina at sbc.su.se<mailto:
> David.Messina at sbc.su.se>]
> > Sent: 23 November 2009 17:46
> > To: michael watson (IAH-C)
> > Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be
> parsed
> >
> > Hi Mick,
> >
> > Sure thing -- the current build from subversion is packaged up every
> > night and available here:
> > http://www.bioperl.org/DIST/nightly_builds/
> >
> > Just grab bioperl-live.tar.gz from there and you'll get the changes.
> >
> >
> > Dave
> >
> >
> >
> >
> > On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
> >
> >> Hi Dave
> >>
> >> Thanks for the hard work.
> >>
> >> Trying to get the latest updates so I can use this... don't have svn
> >> on my server, tried to install it and I don't have python either,
> >> which is needed to install it.
> >>
> >> I face about 3 weeks whilst my IT department sort this out, unless I
> >> can access the changes any other way?
> >>
> >> Thanks
> >> Mick
> >>
> >> -----Original Message-----
> >> From: bugzilla-daemon at portal.open-bio.org<mailto:
> bugzilla-daemon at portal.open-bio.org> [mailto:bugzilla-<mailto:bugzilla->
> >> daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org>]
> >> Sent: 20 November 2009 15:12
> >> To: michael watson (IAH-C)
> >> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
> >> parsed
> >>
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
> >>
> >>
> >> online at davemessina.com<mailto:online at davemessina.com> changed:
> >>
> >>          What    |Removed                     |Added
> >>
> ----------------------------------------------------------------------------
> >>            Status|NEW                         |RESOLVED
> >>        Resolution|                            |FIXED
> >>
> >>
> >>
> >>
> >> ------- Comment #7 from online at davemessina.com<mailto:
> online at davemessina.com>  2009-11-20 10:12 EST
> >> -------
> >> Fixed in r16394.
> >>
> >> Michael, thanks for the report. Your test cases pass, but please
> >> reopen the bug
> >> if needed.
> >>
> >>
> >> --
> >> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
> >> tab=email
> >> ------- You are receiving this mail because: -------
> >> You reported the bug, or are watching the reporter.
> >
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org>
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


From maj at fortinbras.us  Mon Apr 19 09:46:39 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 19 Apr 2010 09:46:39 -0400
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the
	commandthatis executed?
In-Reply-To: <F1073E99-F0DC-40C8-9580-8951756D14A6@illinois.edu>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com><5D89EC22743A460D96353F6FF82260A1@NewLife><p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com><7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
	<F1073E99-F0DC-40C8-9580-8951756D14A6@illinois.edu>
Message-ID: <8B6C0AB7923F417CB63BC6B8CC33CE8D@NewLife>

great Chris-- yes, would be a good disc topic. thanks MAJ
----- Original Message ----- 
From: "Chris Fields" <cjfields at illinois.edu>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: "bioperl-l" <bioperl-l at lists.open-bio.org>; "Ben Bimber" <bimber at wisc.edu>
Sent: Monday, April 19, 2010 9:28 AM
Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the commandthatis 
executed?


> Mark,
>
> I think coming up with a cross-Bio* standard for wrappers is a very good idea, 
> and would be worth further discussion here on-list and maybe at BOSC. 
> Centralizing around Galaxy is a good idea, though we may need to look into 
> embellishing it if it doesn't suit all our needs.
>
> Re: ACD, we essentially have the code for parsing ACD already in bioperl-run 
> (I think Bio::Tools::Run::EMBOSSacd).
>
> chris
>
> On Apr 19, 2010, at 8:03 AM, Mark A. Jensen wrote:
>
>> Hey Ben,
>> Yes, the new stuff is in the bioperl-dev/trunk
>> svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
>> (code.open-bio.org was working as of this morning...)
>>
>> This is all pretty experimental, so use at own risk. The XML-based
>> config system is experimental too at the moment (tho' all code
>> is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
>> good feedback from other Bio* peeps, who are advocating using an
>> existing config standard like emboss ACD or the Galaxy format.
>> I'll likely convert the wrappermaker system to using one of those,
>> but the custom format (in maker.xsd in bioperl-dev) will be there to
>> experiment with.
>>
>> (To the list, any comments regarding this issue are welcome, see
>> http://bioperl.org/wiki/HOWTO:Wrappers for an overview of
>> this project)
>>
>> cheers MAJ
>> ----- Original Message ----- From: "Ben Bimber" <bimber at wisc.edu>
>> To: "Mark A. Jensen" <maj at fortinbras.us>
>> Sent: Monday, April 19, 2010 8:27 AM
>> Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command 
>> thatis executed?
>>
>>
>> ok, that's what i thought.  whenever i need to debug something i've
>> been hacking CommandExts to print @ipc_args, but that's kind of an
>> ugly solution.
>>
>> related to this - now that XML is supported instead of text-based
>> config files, is there a subversion repository where anyone is
>> gathering these files?  i saw your web-based XML generator, which is
>> useful.
>>
>> -ben
>>
>>
>>
>> On Mon, Apr 19, 2010 at 7:05 AM, Mark A. Jensen <maj at fortinbras.us> wrote:
>>> For the entire command line (program + parameters), there isn't a single
>>> place in WrapperBase where that is collected. WrapperBase::_setparams()
>>> produces the option string that can then be appended to the program name
>>> for subsequent execution. In WrapperBase::CommandExts::_run(), the command
>>> line options are generated with _setparams, then passed to IPC::Run for a
>>> generic execution scheme. It would be easy enough from CommandExts to record
>>> the full command in a suitable object property; it's a good idea.
>>> MAJ
>>> ----- Original Message ----- From: "Ben Bimber" <bimber at wisc.edu>
>>> To: "bioperl-l" <bioperl-l at lists.open-bio.org>
>>> Sent: Sunday, April 18, 2010 4:30 PM
>>> Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
>>> thatis executed?
>>>
>>>
>>>> If I write a wrapper for a program using Bio::Tools::Run::WrapperBase,
>>>> is there an easy way to capture a string of the exact command that was
>>>> executed? This would sometimes be useful for debugging / logging.
>>>> There are functions to capture stdout/stderror, but i did not see
>>>> anything with the command itself. i could well have missed it though.
>>>> Thanks.
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>>
>>>
>>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From biopython at maubp.freeserve.co.uk  Mon Apr 19 10:09:03 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Mon, 19 Apr 2010 15:09:03 +0100
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
	<5D89EC22743A460D96353F6FF82260A1@NewLife>
	<p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
	<7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
Message-ID: <i2k320fb6e01004190709p60ea6154t6823162462988a3c@mail.gmail.com>

On Mon, Apr 19, 2010 at 2:03 PM, Mark A. Jensen <maj at fortinbras.us> wrote:
> Hey Ben,
> Yes, the new stuff is in the bioperl-dev/trunk
> svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
> (code.open-bio.org was working as of this morning...)
>
> This is all pretty experimental, so use at own risk. The XML-based
> config system is experimental too at the moment (tho' all code
> is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
> good feedback from other Bio* peeps, who are advocating using an
> existing config standard like emboss ACD or the Galaxy format.

The EMBOSS ACD format is text based and as such rather niche.
I was more suggesting the ability to parse the EMBOSS ACD files
into the chosen XML format would be a neat way to automatically
generate wrappers for all the EMBOSS tools at once.

The Galaxy workflow command line tool description is XML and,
might be suitably general. There are likely others out there too
(no sense reinventing the wheel if possible).

> I'll likely convert the wrappermaker system to using one of those,
> but the custom format (in maker.xsd in bioperl-dev) will be there to
> experiment with.
>
> (To the list, any comments regarding this issue are welcome, see
> http://bioperl.org/wiki/HOWTO:Wrappers for an overview of
> this project)
>
> cheers MAJ

Regards,

Peter

From cjfields at illinois.edu  Mon Apr 19 10:30:04 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 19 Apr 2010 09:30:04 -0500
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	thatis executed?
In-Reply-To: <i2k320fb6e01004190709p60ea6154t6823162462988a3c@mail.gmail.com>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
	<5D89EC22743A460D96353F6FF82260A1@NewLife>
	<p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
	<7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
	<i2k320fb6e01004190709p60ea6154t6823162462988a3c@mail.gmail.com>
Message-ID: <06D3629B-C34A-48DB-8165-4F28B2B9BBA4@illinois.edu>

On Apr 19, 2010, at 9:09 AM, Peter wrote:

> On Mon, Apr 19, 2010 at 2:03 PM, Mark A. Jensen <maj at fortinbras.us> wrote:
>> Hey Ben,
>> Yes, the new stuff is in the bioperl-dev/trunk
>> svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
>> (code.open-bio.org was working as of this morning...)
>> 
>> This is all pretty experimental, so use at own risk. The XML-based
>> config system is experimental too at the moment (tho' all code
>> is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
>> good feedback from other Bio* peeps, who are advocating using an
>> existing config standard like emboss ACD or the Galaxy format.
> 
> The EMBOSS ACD format is text based and as such rather niche.
> I was more suggesting the ability to parse the EMBOSS ACD files
> into the chosen XML format would be a neat way to automatically
> generate wrappers for all the EMBOSS tools at once.
> 
> The Galaxy workflow command line tool description is XML and,
> might be suitably general. There are likely others out there too
> (no sense reinventing the wheel if possible).

...

The discussion we've been having with SoC on this (I think Brad Chapman's comments in particular) make me think this isn't a completely resolved issue, possibly b/c deriving a generic system is either extremely hard, not interesting, or simply that no one has thought of it yet.  Galaxy XML is the closest I can think of to a standard that might work.  I agree completely re: comments on ACD.

chris



From maj at fortinbras.us  Mon Apr 19 10:41:26 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 19 Apr 2010 10:41:26 -0400
Subject: [Bioperl-l] Wrapper definitions format standard (was:
	Bio::Tools::Run::WrapperBase: Capture the command thatis executed?)
In-Reply-To: <06D3629B-C34A-48DB-8165-4F28B2B9BBA4@illinois.edu>
References: <p2y9f985cdc1004181330y91b01820q9c4cfd5fe454e5a6@mail.gmail.com>
	<5D89EC22743A460D96353F6FF82260A1@NewLife>
	<p2z9f985cdc1004190527t7e5948ecy54a4e76d4eb69764@mail.gmail.com>
	<7ABCEAC1DC1F46CEB8BD02E3193FA3C4@NewLife>
	<i2k320fb6e01004190709p60ea6154t6823162462988a3c@mail.gmail.com>
	<06D3629B-C34A-48DB-8165-4F28B2B9BBA4@illinois.edu>
Message-ID: <3EEBD3547A4542FF9C6C89814BE21883@NewLife>

Sounds like both Galaxy and ACD converters to the underlying CommandExts config 
format (built on exported global vars) would be useful and make the system very 
flexible; could then import any existing wrapper definitions, and use emboss 
acds to make quick BP wrappers on the fly for any emboss program, producing 
wrappers with the unified api that CommandExts provides.

----- Original Message ----- 
From: "Chris Fields" <cjfields at illinois.edu>
To: "Peter" <biopython at maubp.freeserve.co.uk>
Cc: "Mark A. Jensen" <maj at fortinbras.us>; "bioperl-l" 
<bioperl-l at lists.open-bio.org>; "Ben Bimber" <bimber at wisc.edu>
Sent: Monday, April 19, 2010 10:30 AM
Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command 
thatis executed?


On Apr 19, 2010, at 9:09 AM, Peter wrote:

> On Mon, Apr 19, 2010 at 2:03 PM, Mark A. Jensen <maj at fortinbras.us> wrote:
>> Hey Ben,
>> Yes, the new stuff is in the bioperl-dev/trunk
>> svn://code.open-bio.org/bioperl/bioperl-dev/trunk/Bio/Tools/Run
>> (code.open-bio.org was working as of this morning...)
>>
>> This is all pretty experimental, so use at own risk. The XML-based
>> config system is experimental too at the moment (tho' all code
>> is available, in bioperl-dev/trunk/Bio/Tools). I've been getting
>> good feedback from other Bio* peeps, who are advocating using an
>> existing config standard like emboss ACD or the Galaxy format.
>
> The EMBOSS ACD format is text based and as such rather niche.
> I was more suggesting the ability to parse the EMBOSS ACD files
> into the chosen XML format would be a neat way to automatically
> generate wrappers for all the EMBOSS tools at once.
>
> The Galaxy workflow command line tool description is XML and,
> might be suitably general. There are likely others out there too
> (no sense reinventing the wheel if possible).

...

The discussion we've been having with SoC on this (I think Brad Chapman's 
comments in particular) make me think this isn't a completely resolved issue, 
possibly b/c deriving a generic system is either extremely hard, not 
interesting, or simply that no one has thought of it yet.  Galaxy XML is the 
closest I can think of to a standard that might work.  I agree completely re: 
comments on ACD.

chris




From robert.bradbury at gmail.com  Mon Apr 19 12:49:24 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Mon, 19 Apr 2010 12:49:24 -0400
Subject: [Bioperl-l] Interfaces to HGNC/genenames.org?
Message-ID: <x2ideaa866a1004190949vd8fd8517g4590ba0dc4df2d88@mail.gmail.com>

Are there any interfaces from BioPerl to the data in the HGNC data at
genenames.org?

I don't know if genenames.org has a documented program interface like NCBI
(it would seem like they should).

One could of course use the web interface and parse their web pages but that
would be dependent on their not changing the information format in them over
the long term.

Alternately, one could parse the downloaded data files they provide.  I
think they allow you to download the data in specific formats which might
make the BioPerl interface less subject to external changes.

If these interfaces don't exist, might I suggest a Google SOC project?

The reason this could be useful is that it would allow the parsing of
genomic data (e.g. PubMed records or even PDF references), perhaps something
like CPAN's Peptide-PubMed and have some confidence in separating real gene
names (or their alternates) from English or scientific terms (though perhaps
something like CPAN's WWW::Dictionary can do this)..

Robert

From sdavis2 at mail.nih.gov  Mon Apr 19 13:31:25 2010
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon, 19 Apr 2010 13:31:25 -0400
Subject: [Bioperl-l] Interfaces to HGNC/genenames.org?
In-Reply-To: <x2ideaa866a1004190949vd8fd8517g4590ba0dc4df2d88@mail.gmail.com>
References: <x2ideaa866a1004190949vd8fd8517g4590ba0dc4df2d88@mail.gmail.com>
Message-ID: <q2j264855a01004191031paa72bdf6r98ab6bc0980a95df@mail.gmail.com>

On Mon, Apr 19, 2010 at 12:49 PM, Robert Bradbury <robert.bradbury at gmail.com
> wrote:

> Are there any interfaces from BioPerl to the data in the HGNC data at
> genenames.org?
>
> I don't know if genenames.org has a documented program interface like NCBI
> (it would seem like they should).
>
> One could of course use the web interface and parse their web pages but
> that
> would be dependent on their not changing the information format in them
> over
> the long term.
>
> Alternately, one could parse the downloaded data files they provide.  I
> think they allow you to download the data in specific formats which might
> make the BioPerl interface less subject to external changes.
>
>
Hi, Robert.

I think the format is tab-delimited text.  These should be pretty easy to
parse.

Sean


> If these interfaces don't exist, might I suggest a Google SOC project?
>
> The reason this could be useful is that it would allow the parsing of
> genomic data (e.g. PubMed records or even PDF references), perhaps
> something
> like CPAN's Peptide-PubMed and have some confidence in separating real gene
> names (or their alternates) from English or scientific terms (though
> perhaps
> something like CPAN's WWW::Dictionary can do this)..
>
>

From robert.bradbury at gmail.com  Mon Apr 19 16:03:35 2010
From: robert.bradbury at gmail.com (Robert Bradbury)
Date: Mon, 19 Apr 2010 16:03:35 -0400
Subject: [Bioperl-l] Gene Expression Omnibus Data interface?
Message-ID: <g2ndeaa866a1004191303t8d636138n180bc80d4aaaf690@mail.gmail.com>

Next question is whether BioPerl has an interface to the NCBI GEO database
that would allow BioPerl programs to (regularly) query the datasets to
determine data relating to specific genes or organisms has been added?

I'm trying to automate my requests to various databases (PubMed, GEO, etc.)
to construct an expanding (topic specific) knowledge base.

Robert

From dan.kortschak at adelaide.edu.au  Mon Apr 19 17:18:04 2010
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Tue, 20 Apr 2010 06:48:04 +0930
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
 that is executed?
In-Reply-To: <mailman.6651.1271686149.3372.bioperl-l@lists.open-bio.org>
References: <mailman.6651.1271686149.3372.bioperl-l@lists.open-bio.org>
Message-ID: <1271711884.4446.4.camel@epistle>

Hi Ben and Mark,

I agree that an easy way to query the parameters passed to IPC::Run
would be nice for debugging, but is it really necessary for a fairly
limited set of use cases? - 'perl -d' does a very nice job of allowing
this kind of thing.

cheers
Dan

On Mon, 2010-04-19 at 10:09 -0400, bimber at wisc.edu wrote:
> ok, that's what i thought.  whenever i need to debug something i've
> been hacking CommandExts to print @ipc_args, but that's kind of an
> ugly solution.
> 
> related to this - now that XML is supported instead of text-based
> config files, is there a subversion repository where anyone is
> gathering these files?  i saw your web-based XML generator, which is
> useful.
> 
> -ben


From sdavis2 at mail.nih.gov  Mon Apr 19 17:31:26 2010
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon, 19 Apr 2010 17:31:26 -0400
Subject: [Bioperl-l] Gene Expression Omnibus Data interface?
In-Reply-To: <g2ndeaa866a1004191303t8d636138n180bc80d4aaaf690@mail.gmail.com>
References: <g2ndeaa866a1004191303t8d636138n180bc80d4aaaf690@mail.gmail.com>
Message-ID: <w2v264855a01004191431vfec57902y60f673e6af3e82c@mail.gmail.com>

On Mon, Apr 19, 2010 at 4:03 PM, Robert Bradbury
<robert.bradbury at gmail.com>wrote:

> Next question is whether BioPerl has an interface to the NCBI GEO database
> that would allow BioPerl programs to (regularly) query the datasets to
> determine data relating to specific genes or organisms has been added?
>
> I'm trying to automate my requests to various databases (PubMed, GEO, etc.)
> to construct an expanding (topic specific) knowledge base.
>
>
You could look at the GEOmetadb package for R.  The package provides an
interface to a standard SQLite database that we update weekly with ALL
metadata from GEO.  Additionally, there is an online version of the
database.   See:

http://gbnci.abcc.ncifcrf.gov/geo/
http://bioconductor.org/packages/release/bioc/html/GEOmetadb.html

Sean

From bimber at wisc.edu  Mon Apr 19 18:27:45 2010
From: bimber at wisc.edu (Ben Bimber)
Date: Mon, 19 Apr 2010 17:27:45 -0500
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	that is executed?
In-Reply-To: <1271711884.4446.4.camel@epistle>
References: <mailman.6651.1271686149.3372.bioperl-l@lists.open-bio.org>
	<1271711884.4446.4.camel@epistle>
Message-ID: <u2k9f985cdc1004191527s287831d4t2f0085d3a733dd10@mail.gmail.com>

Dan,

Beyond debugging, I could see cases where logging it would be useful.
Technically capturing the set of params given to CommandExts does more
or less the same thing, but sometimes giving people the exact command
makes it a little more transparent.  You are right that it's not
absolutely essential.

-Ben



On Mon, Apr 19, 2010 at 4:18 PM, Dan Kortschak
<dan.kortschak at adelaide.edu.au> wrote:
> Hi Ben and Mark,
>
> I agree that an easy way to query the parameters passed to IPC::Run
> would be nice for debugging, but is it really necessary for a fairly
> limited set of use cases? - 'perl -d' does a very nice job of allowing
> this kind of thing.
>
> cheers
> Dan
>
> On Mon, 2010-04-19 at 10:09 -0400, bimber at wisc.edu wrote:
>> ok, that's what i thought. ?whenever i need to debug something i've
>> been hacking CommandExts to print @ipc_args, but that's kind of an
>> ugly solution.
>>
>> related to this - now that XML is supported instead of text-based
>> config files, is there a subversion repository where anyone is
>> gathering these files? ?i saw your web-based XML generator, which is
>> useful.
>>
>> -ben
>
>


From heikki.lehvaslaiho at gmail.com  Tue Apr 20 02:05:44 2010
From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho)
Date: Tue, 20 Apr 2010 09:05:44 +0300
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu> 
	<52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>
Message-ID: <o2sddde1f421004192305p5695c67ai8315e12101b82e52@mail.gmail.com>

Looking forward to that.

Do try to do full migration of whole history and leave as it it. It is
better not to try do two completely separate things, migration and
splitting, at the same time.

I am not worried about the size at this point. Git does really
good job in compressing everything at transfer. For read only access,
we need to educate people on '--depth 1' option.

Cheers,

     -Heikki

P.S. I am in github with this address. Please sign me in whenever it
is convenient.


On 17 April 2010 20:12, Mark A. Jensen <maj at fortinbras.us> wrote:
> I think it's where we need to go. I agree that this need to move sooner
> rather than later. I also need to stop procrastinating and figure out git:
> Learn it, or be one.
> cheers
> ----- Original Message ----- From: "Chris Fields" <cjfields1 at gmail.com>
> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Saturday, April 17, 2010 12:18 PM
> Subject: [Bioperl-l] Possible migration to git/github
>
>
>> All,
>>
>> I wanted to get the BioPerl community's general input on a possible
>> Subversion to git/github migration for the BioPerl repository. ?The plans
>> haven't been finalized in any way. ?We haven't decided, for instance, on
>> whether to make github the main site, a read-only mirror, or a downstream
>> mirror for forking/pulling code from the community (with a central upstream
>> dev repo for releases). ?As a preliminary run I will be pushing a test run
>> to github of bioperl-live (all tags/branches) this weekend.
>>
>> Thoughts have been circulating among the core developers for some time
>> about a migration at some point, however recent problems with anon access to
>> code has made this a more pressing issue. ?The overall impression I am
>> getting from the community at large is a move would be a positive thing and
>> would swing the doors wide open for users to contribute much more easily
>> (via forking).
>>
>> Therefore, I would like to outline the positive/negative aspects of a move
>> to git/github, and a proposed path to migration if one should occur.
>> ?Remember, this is a project with 15+ years of code that has already
>> undergone a recent migration from CVS->SVN. ?Retaining history and
>> branches/tags for all bioperl projects is key. ?We also need to think
>> logistically about other issues particularly with github (number of
>> collaborators allowed per account, mapping authors, etc etc).
>>
>> Personally, I think we should be moving forward with this as soon as
>> possible, but I personally like git/github so I'm a bit biased. ?The
>> recently-added support for in-line code review comments and SVN support has
>> particularly swayed me:
>>
>> http://github.com/blog/626-announcing-svn-support
>> http://github.com/blog/622-inline-commit-notes
>>
>> Thoughts? ?Comments? ?Flames? ?Suggestions?
>>
>> chris
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From michael.watson at bbsrc.ac.uk  Tue Apr 20 04:03:54 2010
From: michael.watson at bbsrc.ac.uk (michael watson (IAH-C))
Date: Tue, 20 Apr 2010 09:03:54 +0100
Subject: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem
 to be parsed
In-Reply-To: <z2t24c96eca1004190649i6b29523chc80c8c63c0b140d7@mail.gmail.com>
References: <8D08960C647E64438CE5740657CBBDC50148731E47@iahcexch1.iah.bbsrc.ac.uk>
	<50F0159A-DE58-4405-A2FE-4FA95A3CDDA4@sbc.su.se>
	<8D08960C647E64438CE5740657CBBDC502108B9F48@iahcexch1.iah.bbsrc.ac.uk>
	<2E990521-503F-4BB6-912F-4D29F18ADF07@sbc.su.se>
	<q2r24c96eca1004190448kf5b01b4bpf756a864d37ddd0a@mail.gmail.com>
	<8D08960C647E64438CE5740657CBBDC50210892668@iahcexch1.iah.bbsrc.ac.uk>
	<z2t24c96eca1004190649i6b29523chc80c8c63c0b140d7@mail.gmail.com>
Message-ID: <8D08960C647E64438CE5740657CBBDC502108B9F6E@iahcexch1.iah.bbsrc.ac.uk>

Hi Guys

Thanks for picking this up.  Let me know if I can help further.

Mick

From: Aaron Mackey [mailto:ajmackey at gmail.com]
Sent: 19 April 2010 14:49
To: michael watson (IAH-C)
Cc: Dave Messina; BioPerl List; William Pearson
Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to be parsed

OK, my apologies.  When I saw the multiple "autodoc" lines, I figured incorrectly.

-Aaron
On Mon, Apr 19, 2010 at 8:09 AM, michael watson (IAH-C) <michael.watson at bbsrc.ac.uk<mailto:michael.watson at bbsrc.ac.uk>> wrote:
Hi

I can guarantee this was from a single fasta execution, with input being a fasta file with multiple sequences. This output comes from the -O flag. There has been no concatenation.

Mick
________________________________________
From: Aaron Mackey [ajmackey at gmail.com<mailto:ajmackey at gmail.com>]
Sent: 19 April 2010 12:48
To: Dave Messina
Cc: michael watson (IAH-C); BioPerl List
Subject: Re: [Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to   be parsed

This doesn't looks like a multi-query report; rather this looks like multiple separate executions, each with one query, that has been concatenated together.  I don't think any of our report parsers will work in this scenario.

-Aaron


On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se><mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>>> wrote:
Hi Mick,

Please email the list - that way others who can help will know what's going on.

I looked at this for a few minutes and it seems that the issue is that the FASTA output doen't have any end-of-report indicator in a multiple query output file. The report just ends and then the next report begins.


e.g.

[ beginning of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

[ middle of report 1 omitted ]

                               10        20
2-210532                 UAGCUUAUCAGACUGAUGUUGAC
                       : :.:::::::. :::::
cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
                          10        20

[ implicit end of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
[ rest of report 2 omitted [


I don't know whether or how this has changed from earlier versions of FASTA - presumably we were detecting end-of-report just fine for earlier versions - but in any case we need to fix it for version 35.

I will try to work on it some more but I'm pretty short of time right now - perhaps other devs could take a look?



Dave



On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:

> Hi Dave
>
> I'm still having an associated bug from this fix, created last week:
>
> http://bugzilla.open-bio.org/show_bug.cgi?id=3058
>
> At present, this is a real show stopper for my analysis.
>
> Mick
>
> -----Original Message-----
> From: Dave Messina [mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se><mailto:David.Messina at sbc.su.se<mailto:David.Messina at sbc.su.se>>]
> Sent: 23 November 2009 17:46
> To: michael watson (IAH-C)
> Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be parsed
>
> Hi Mick,
>
> Sure thing -- the current build from subversion is packaged up every
> night and available here:
> http://www.bioperl.org/DIST/nightly_builds/
>
> Just grab bioperl-live.tar.gz from there and you'll get the changes.
>
>
> Dave
>
>
>
>
> On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
>
>> Hi Dave
>>
>> Thanks for the hard work.
>>
>> Trying to get the latest updates so I can use this... don't have svn
>> on my server, tried to install it and I don't have python either,
>> which is needed to install it.
>>
>> I face about 3 weeks whilst my IT department sort this out, unless I
>> can access the changes any other way?
>>
>> Thanks
>> Mick
>>
>> -----Original Message-----
>> From: bugzilla-daemon at portal.open-bio.org<mailto:bugzilla-daemon at portal.open-bio.org><mailto:bugzilla-daemon at portal.open-bio.org<mailto:bugzilla-daemon at portal.open-bio.org>> [mailto:bugzilla-<mailto:bugzilla-><mailto:bugzilla-<mailto:bugzilla->>
>> daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org><mailto:daemon at portal.open-bio.org<mailto:daemon at portal.open-bio.org>>]
>> Sent: 20 November 2009 15:12
>> To: michael watson (IAH-C)
>> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
>> parsed
>>
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
>>
>>
>> online at davemessina.com<mailto:online at davemessina.com><mailto:online at davemessina.com<mailto:online at davemessina.com>> changed:
>>
>>          What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>            Status|NEW                         |RESOLVED
>>        Resolution|                            |FIXED
>>
>>
>>
>>
>> ------- Comment #7 from online at davemessina.com<mailto:online at davemessina.com><mailto:online at davemessina.com<mailto:online at davemessina.com>>  2009-11-20 10:12 EST
>> -------
>> Fixed in r16394.
>>
>> Michael, thanks for the report. Your test cases pass, but please
>> reopen the bug
>> if needed.
>>
>>
>> --
>> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
>> tab=email
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
>


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org><mailto:Bioperl-l at lists.open-bio.org<mailto:Bioperl-l at lists.open-bio.org>>
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From bioperl at etrumeus.com  Tue Apr 20 06:20:02 2010
From: bioperl at etrumeus.com (D. Joe Anderson)
Date: Tue, 20 Apr 2010 06:20:02 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
Message-ID: <20100420102001.GM12306@poppy.etrumeus.com>

On Sat, Apr 17, 2010 at 11:18:13AM -0500, Chris Fields wrote:

> I wanted to get the BioPerl community's general input on a
> possible Subversion to git/github migration for the BioPerl
> repository.

Moving to git seems like a great good thing with few downsides. 
Distributed revision control has been gaining ground for years,
and seems to have exploded with the development and adoption of
git.  All the cool kids are doing it.

Moving to github, however, brings up all the usual concerns with
getting locked-in to a proprietary application, since the github
software is not open source.  Granted, given the decentralized
nature of git development, the code itself would be fine. 
However, contributor metadata and workflows could be at risk
from changes in github's business model down the line.

I realize these concerns face an uphill battle, given the
popularity of github in particular and of proprietary
software-as-a-service more generally (Google, various social
networking sites) and, most perniciously, the intrusion of
proprietary software-as-a-service into partially- or mostly-FOSS
projects (like Ubuntu One), but I felt they needed airing.

We should note here that Biopython is already using git and
github in some fashion:

http://www.biopython.org/wiki/GitUsage

and that gitorious also offers git project hosting backed by
FOSS software, even if it doesn't reproduce all the qualities of
github:

http://www.gitorious.org

a comparison between github and gitorious

http://stackoverflow.com/questions/78991/why-is-github-more-popular-than-gitorious


-- 
Joe
man screen | grep -A2 weird
  A weird imagination is most useful to gain full advantage of
  all the features.


From biopython at maubp.freeserve.co.uk  Tue Apr 20 09:24:22 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 20 Apr 2010 14:24:22 +0100
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <20100420102001.GM12306@poppy.etrumeus.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
Message-ID: <i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>

On Tue, Apr 20, 2010 at 11:20 AM, D. Joe Anderson <bioperl at etrumeus.com> wrote:
> On Sat, Apr 17, 2010 at 11:18:13AM -0500, Chris Fields wrote:
>
>> I wanted to get the BioPerl community's general input on a
>> possible Subversion to git/github migration for the BioPerl
>> repository.
>
> Moving to git seems like a great good thing with few downsides.
> Distributed revision control has been gaining ground for years,
> and seems to have exploded with the development and adoption of
> git. ?All the cool kids are doing it.
>
> Moving to github, however, brings up all the usual concerns with
> getting locked-in to a proprietary application, since the github
> software is not open source. ?Granted, given the decentralized
> nature of git development, the code itself would be fine.
> However, contributor metadata and workflows could be at risk
> from changes in github's business model down the line.
>
> I realize these concerns face an uphill battle, given the
> popularity of github in particular and of proprietary
> software-as-a-service more generally (Google, various social
> networking sites) and, most perniciously, the intrusion of
> proprietary software-as-a-service into partially- or mostly-FOSS
> projects (like Ubuntu One), but I felt they needed airing.

Using git does not in anyway tie us to github.com - we could
in theory host the "official" repository on the OBF servers or
anywhere else (such as gitorious as you mentioned), and
from a technical perspective this is easy. The authorship
metadata would also be preserved (I don't understand your
concern here).

You are right there is a potential concern if the project comes
depend on any of github's additions like the network diagram
or commenting features, or using the github "pull request"
notification system as part of a workflow to review code for
merging. But a workflow is a social convention that can be
changed as needed.

I have no concerns over using git hosted on github from a
vendor lock in point of view.

> We should note here that Biopython is already using git and
> github in some fashion:
>
> http://www.biopython.org/wiki/GitUsage

Don't forget that BioRuby has been using github for even longer,
as I pointed out near the start of this thread:

http://lists.open-bio.org/pipermail/bioperl-l/2010-February/032353.html
http://github.com/bioruby/bioruby

Also Chris mentioned (off list) that Biolib is using github too:
http://github.com/pjotrp/biolib/

This does seem to confirm your observation of the popularity
of github ;)

Peter
(Biopython)


From David.Messina at sbc.su.se  Tue Apr 20 13:22:39 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Tue, 20 Apr 2010 19:22:39 +0200
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
Message-ID: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>

Hi everyone,

I've got about 250 NCBI IDs that I'm pulling from NCBI using Bio::DB::SoapEUtilities. It works fine if I send 10 IDs at a time, but much more than that and I get an 'unspecified internal server error'.

I thought the limit with 500 IDs at a time ? anyone have an idea whether that's true?


And a separate, related question:

All I really want to get is the last-modified date for these records.

And it's kinda slow.

Using some code from the EUtilities_Web_Services HOWTO, I use the seq Fetch adaptor and the add_wanted_slot() Bio::Seq::SeqBuilder trick to get just the annotation part of a RichSeq object, and from there I pull out the dates using

$seq->annotation->get_Annotations('date_changed')


Can someone suggest a faster way?


Thanks,
Dave



From bioperl at etrumeus.com  Tue Apr 20 13:26:40 2010
From: bioperl at etrumeus.com (D. Joe Anderson)
Date: Tue, 20 Apr 2010 13:26:40 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
Message-ID: <20100420172639.GA15841@poppy.etrumeus.com>

On Tue, Apr 20, 2010 at 02:24:22PM +0100, Peter wrote:
> On Tue, Apr 20, 2010 at 11:20 AM, D. Joe Anderson wrote:
> > On Sat, Apr 17, 2010 at 11:18:13AM -0500, Chris Fields wrote:
> >
> >> I wanted to get the BioPerl community's general input on a
> >> possible Subversion to git/github migration for the BioPerl
> >> repository.
> >
> > Moving to git seems like a great good thing with few downsides.

> > Moving to github, however, brings up all the usual concerns with
> > getting locked-in to a proprietary application, since the github
> > software is not open source.

> Using git does not in anyway tie us to github.com - we could
> in theory host the "official" repository on the OBF servers or
> anywhere else (such as gitorious as you mentioned), and
> from a technical perspective this is easy. 

Fair enough.  One sometimes sees git and github discussed almost
as if they are inseparable, when, as you point out, they are
not.

> The authorship metadata would also be preserved (I don't
> understand your concern here).

I meant this sort of thing, really:

> You are right there is a potential concern if the project comes
> depend on any of github's additions like the network diagram
> or commenting features, 

Given that the github additions are usually cited in favor of
putting a project into github, I would say that such concerns
are likely to be realized.

> I have no concerns over using git hosted on github from a
> vendor lock in point of view.

Right.

> Don't forget that BioRuby has been using github for even longer,
> as I pointed out near the start of this thread:
> 
> http://lists.open-bio.org/pipermail/bioperl-l/2010-February/032353.html
> http://github.com/bioruby/bioruby

Sorry, this is a new thread that Chris started.  I'd missed the
earlier one.  Thanks for pointing it out.

> Also Chris mentioned (off list) that Biolib is using github too:
> http://github.com/pjotrp/biolib/
> 
> This does seem to confirm your observation of the popularity
> of github ;)

And of the momentum towards its adoption. 

In any case, those are my concerns.  Again, thanks for pointing
out the earlier thread, and for giving me the opportunity to
clarify my point about the added features of github.

-- 
Joe
man screen | grep -A2 weird
  A weird imagination is most useful to gain full advantage of
  all the features.


From biopython at maubp.freeserve.co.uk  Tue Apr 20 14:51:38 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 20 Apr 2010 19:51:38 +0100
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <20100420172639.GA15841@poppy.etrumeus.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
	<20100420172639.GA15841@poppy.etrumeus.com>
Message-ID: <l2o320fb6e01004201151l92b01a81v6bca1c4381de3f0a@mail.gmail.com>

On Tue, Apr 20, 2010 at 6:26 PM, D. Joe Anderson wrote:
> On Tue, Apr 20, 2010 at 02:24:22PM +0100, Peter wrote:
>> You are right there is a potential concern if the project comes
>> depend on any of github's additions like the network diagram
>> or commenting features,
>
> Given that the github additions are usually cited in favor of
> putting a project into github, I would say that such concerns
> are likely to be realized.

It is certainly worth keeping in mind (especially if BioPerl
does move to github). While we are on this topic, to me
the nicest parts about github are two things:

(*) Easy tracking of other forks of a project (or rather,
other forks also on github)

(*) Building on this, the network diagram. I imagine a similar
figure *could* be made as a standalone tool. If such a thing
exists, I'd be interested to try it.

> Sorry, this is a new thread that Chris started. ?I'd missed the
> earlier one. ?Thanks for pointing it out.

Yeah - that was a while back, but in my mind it was just a
continuation of the old thread.

Peter


From cjfields at illinois.edu  Tue Apr 20 14:57:48 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 13:57:48 -0500
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
Message-ID: <B1E4F38A-2A25-4FE8-92C5-725766400127@illinois.edu>

Not sure about the upper limit with SOAP, but simple ol' EUtilities can take ~250-500 IDs (somewhere in that range) with a direct efetch/esummary/elink, and many many more if you use epost first.  I have been able to fetch a couple thousand with epost.  

As an example, this code works for me:

use Modern::Perl;
use Bio::DB::EUtilities;

my $eutil = Bio::DB::EUtilities->new(-eutil => 'esearch',
                                     -db    => 'protein',
                                     -email => 'cjfields at bioperl.org',
                                     -term  => 'pyrR',
                                     -retmax => 250,
                                     -usehistory => 'y');

my $hist = $eutil->next_History || die "No history returned";

$eutil->set_parameters(-eutil => 'esummary',
                       -history => $hist);

my %id_map;

while (my $ds = $eutil->next_DocSum) {
    my ($cdate) = $ds->get_contents_by_name('CreateDate');
    $id_map{$ds->get_id} = $cdate;
}

say join("\t", $_, $id_map{$_}) for sort keys %id_map;




On Apr 20, 2010, at 12:22 PM, Dave Messina wrote:

> Hi everyone,
> 
> I've got about 250 NCBI IDs that I'm pulling from NCBI using Bio::DB::SoapEUtilities. It works fine if I send 10 IDs at a time, but much more than that and I get an 'unspecified internal server error'.
> 
> I thought the limit with 500 IDs at a time ? anyone have an idea whether that's true?
> 
> 
> And a separate, related question:
> 
> All I really want to get is the last-modified date for these records.
> 
> And it's kinda slow.
> 
> Using some code from the EUtilities_Web_Services HOWTO, I use the seq Fetch adaptor and the add_wanted_slot() Bio::Seq::SeqBuilder trick to get just the annotation part of a RichSeq object, and from there I pull out the dates using
> 
> $seq->annotation->get_Annotations('date_changed')
> 
> 
> Can someone suggest a faster way?
> 
> 
> Thanks,
> Dave
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Tue Apr 20 15:00:49 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 14:00:49 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
Message-ID: <47A3890D-4847-40B2-BF40-3CD193C9D1A4@illinois.edu>

On Apr 20, 2010, at 8:24 AM, Peter wrote:

> On Tue, Apr 20, 2010 at 11:20 AM, D. Joe Anderson <bioperl at etrumeus.com> wrote:
>> On Sat, Apr 17, 2010 at 11:18:13AM -0500, Chris Fields wrote:
>> 
>>> I wanted to get the BioPerl community's general input on a
>>> possible Subversion to git/github migration for the BioPerl
>>> repository.
>> 
>> Moving to git seems like a great good thing with few downsides.
>> Distributed revision control has been gaining ground for years,
>> and seems to have exploded with the development and adoption of
>> git.  All the cool kids are doing it.
>> 
>> Moving to github, however, brings up all the usual concerns with
>> getting locked-in to a proprietary application, since the github
>> software is not open source.  Granted, given the decentralized
>> nature of git development, the code itself would be fine.
>> However, contributor metadata and workflows could be at risk
>> from changes in github's business model down the line.
>> 
>> I realize these concerns face an uphill battle, given the
>> popularity of github in particular and of proprietary
>> software-as-a-service more generally (Google, various social
>> networking sites) and, most perniciously, the intrusion of
>> proprietary software-as-a-service into partially- or mostly-FOSS
>> projects (like Ubuntu One), but I felt they needed airing.
> 
> Using git does not in anyway tie us to github.com - we could
> in theory host the "official" repository on the OBF servers or
> anywhere else (such as gitorious as you mentioned), and
> from a technical perspective this is easy. The authorship
> metadata would also be preserved (I don't understand your
> concern here).
> 
> You are right there is a potential concern if the project comes
> depend on any of github's additions like the network diagram
> or commenting features, or using the github "pull request"
> notification system as part of a workflow to review code for
> merging. But a workflow is a social convention that can be
> changed as needed.
> 
> I have no concerns over using git hosted on github from a
> vendor lock in point of view.
> 
>> We should note here that Biopython is already using git and
>> github in some fashion:
>> 
>> http://www.biopython.org/wiki/GitUsage
> 
> Don't forget that BioRuby has been using github for even longer,
> as I pointed out near the start of this thread:
> 
> http://lists.open-bio.org/pipermail/bioperl-l/2010-February/032353.html
> http://github.com/bioruby/bioruby
> 
> Also Chris mentioned (off list) that Biolib is using github too:
> http://github.com/pjotrp/biolib/
> 
> This does seem to confirm your observation of the popularity
> of github ;)
> 
> Peter
> (Biopython)

I do share some of D. Joe Anderson's concerns, mainly re: use of github's other tools.  However, I don't particularly see this as an insurmountable issue, just one that needs to be clarified w/ regards to how many of the github tools we intend on supporting.  I don't envision a complete migration to their wiki services or bug tools for the time being.

And glad that Gitorious was mentioned, as it was another option I wanted to raise as well.  It does have several large and very active projects (Qt, FreeBSD, etc), but very few (any?) bioperl devs on it, beyond me.

chris




From cjfields at illinois.edu  Tue Apr 20 15:05:19 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 14:05:19 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <l2o320fb6e01004201151l92b01a81v6bca1c4381de3f0a@mail.gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
	<20100420172639.GA15841@poppy.etrumeus.com>
	<l2o320fb6e01004201151l92b01a81v6bca1c4381de3f0a@mail.gmail.com>
Message-ID: <AF9CB250-43A2-413E-8D66-68C0AF2A821D@illinois.edu>

On Apr 20, 2010, at 1:51 PM, Peter wrote:

> On Tue, Apr 20, 2010 at 6:26 PM, D. Joe Anderson wrote:
>> On Tue, Apr 20, 2010 at 02:24:22PM +0100, Peter wrote:
>>> You are right there is a potential concern if the project comes
>>> depend on any of github's additions like the network diagram
>>> or commenting features,
>> 
>> Given that the github additions are usually cited in favor of
>> putting a project into github, I would say that such concerns
>> are likely to be realized.
> 
> It is certainly worth keeping in mind (especially if BioPerl
> does move to github). While we are on this topic, to me
> the nicest parts about github are two things:
> 
> (*) Easy tracking of other forks of a project (or rather,
> other forks also on github)
> 
> (*) Building on this, the network diagram. I imagine a similar
> figure *could* be made as a standalone tool. If such a thing
> exists, I'd be interested to try it.

For tracking in-repo branches I use gitk, but I assume tracking forks would probably require some programmatic access for determining who has forked code within github.  I'm not aware of tools that track that outside of github.

>> Sorry, this is a new thread that Chris started.  I'd missed the
>> earlier one.  Thanks for pointing it out.
> 
> Yeah - that was a while back, but in my mind it was just a
> continuation of the old thread.
> 
> Peter

Pretty much.  Just making sure it stays on people's radars, particularly when our main anon. mirror is down 90% of the time.

chris

From biopython at maubp.freeserve.co.uk  Tue Apr 20 15:38:12 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 20 Apr 2010 20:38:12 +0100
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <47A3890D-4847-40B2-BF40-3CD193C9D1A4@illinois.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
	<47A3890D-4847-40B2-BF40-3CD193C9D1A4@illinois.edu>
Message-ID: <x2i320fb6e01004201238s56ee1d17y13f603badb61cf53@mail.gmail.com>

On Tue, Apr 20, 2010 at 8:00 PM, Chris Fields <cjfields at illinois.edu> wrote:
>
> I do share some of D. Joe Anderson's concerns, mainly re: use of
> github's other tools. ?However, I don't particularly see this as an
> insurmountable issue, just one that needs to be clarified w/ regards
> to how many of the github tools we intend on supporting. ?I don't
> envision a complete migration to their wiki services or bug tools
> for the time being.
>

Good point - There are lots of optional features offered by
github.com beyond just hosting git repositories.

For Biopython we don't use the github bug system, wiki, or
downloads feature - we continue to use the OBF hosted
resources for everything like this. Looking at BioRuby, they
also seem to ignore these bits of github in favour of OBF
servers (for the wiki and source code archives) and
rubyforge.org (for bugs and the latest downloads).

In the case of the wiki, the OBF hosted media-wiki works
fine and is under the project's own domain name. Moving
it to github seems pointless to me.

In the case of the downloads, github can allow people to
download any tag from the repository as a tar ball - quite
handy, but for Biopython we prefer to get people to download
our official archives which contain the compiled HTML and
PDF documentation.

Peter


From rec3141 at mcmaster.ca  Tue Apr 20 16:20:33 2010
From: rec3141 at mcmaster.ca (Eric Collins)
Date: Tue, 20 Apr 2010 16:20:33 -0400
Subject: [Bioperl-l] Bio::DB::Taxonomy and each_Descendent
In-Reply-To: <m2g1961621c1004161449h1e7c84f1zcef0b8af0825ca99@mail.gmail.com>
References: <m2g1961621c1004161449h1e7c84f1zcef0b8af0825ca99@mail.gmail.com>
Message-ID: <i2v1961621c1004201320nedb3c28fm1f24b2d2cb65379@mail.gmail.com>

Hello,

I tried the Bio::DB::Taxonomy example on this wiki page using perl
5.8.5 with BioPerl 1.6.0
http://www.bioperl.org/wiki/Module:Bio::DB::Taxonomy

It ran for 100 cpu seconds and output:

33090 Viridiplantae kingdom

I was expecting it to also output the descendents. Some questions:

1) are calls to 'each_Descendent' or 'get_all_Descendents' actually
implemented? It looks to be in Taxon.pm but it is not documented and
when I ran Data::Dumper on $node the value '_desc' was empty.

2) is the flatfile reader always so slow? after replacing 'flatfile'
with a call to 'entrez' it took only 0.02 cpu seconds to come
up with the same result.

thanks,
Eric

From cjfields at illinois.edu  Tue Apr 20 16:48:24 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 15:48:24 -0500
Subject: [Bioperl-l] Bio::DB::Taxonomy and each_Descendent
In-Reply-To: <i2v1961621c1004201320nedb3c28fm1f24b2d2cb65379@mail.gmail.com>
References: <m2g1961621c1004161449h1e7c84f1zcef0b8af0825ca99@mail.gmail.com>
	<i2v1961621c1004201320nedb3c28fm1f24b2d2cb65379@mail.gmail.com>
Message-ID: <42E5A75A-438A-4AF7-AC60-226395329A9B@illinois.edu>

Sounds like this is going through an initial indexing step (for flatfiles).  I would expect the initial indexing of the tables to take time as you have to create the DB, but subsequent lookups post-indexing should be much faster if the index is already present.  Maybe Jason could answer in more detail?

chris

On Apr 20, 2010, at 3:20 PM, Eric Collins wrote:

> Hello,
> 
> I tried the Bio::DB::Taxonomy example on this wiki page using perl
> 5.8.5 with BioPerl 1.6.0
> http://www.bioperl.org/wiki/Module:Bio::DB::Taxonomy
> 
> It ran for 100 cpu seconds and output:
> 
> 33090 Viridiplantae kingdom
> 
> I was expecting it to also output the descendents. Some questions:
> 
> 1) are calls to 'each_Descendent' or 'get_all_Descendents' actually
> implemented? It looks to be in Taxon.pm but it is not documented and
> when I ran Data::Dumper on $node the value '_desc' was empty.
> 
> 2) is the flatfile reader always so slow? after replacing 'flatfile'
> with a call to 'entrez' it took only 0.02 cpu seconds to come
> up with the same result.
> 
> thanks,
> Eric
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Tue Apr 20 17:16:22 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 16:16:22 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <o2sddde1f421004192305p5695c67ai8315e12101b82e52@mail.gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>
	<o2sddde1f421004192305p5695c67ai8315e12101b82e52@mail.gmail.com>
Message-ID: <1271798182.28484.3.camel@pyrimidine.igb.uiuc.edu>

Agreed, we won't move forward with splitting up any code until after we
make the move over to git/github.  

I may end up steering clear of the simple approach (using github's
automated svn import) as it's not pulling authors over in an easy way
(web forms?!?), and seems to take forever for even simple repos.  I'm
currently attempting a pull this way using jason's google code mirror
for bioperl since code.open-bio.org is comatose.  Also looking at
git-svn-abandon and snerp vortex as possible means of conversion.

chris

On Tue, 2010-04-20 at 09:05 +0300, Heikki Lehvaslaiho wrote: 
> Looking forward to that.
> 
> Do try to do full migration of whole history and leave as it it. It is
> better not to try do two completely separate things, migration and
> splitting, at the same time.
> 
> I am not worried about the size at this point. Git does really
> good job in compressing everything at transfer. For read only access,
> we need to educate people on '--depth 1' option.
> 
> Cheers,
> 
>      -Heikki
> 
> P.S. I am in github with this address. Please sign me in whenever it
> is convenient.
> 
> 
> On 17 April 2010 20:12, Mark A. Jensen <maj at fortinbras.us> wrote:
> > I think it's where we need to go. I agree that this need to move sooner
> > rather than later. I also need to stop procrastinating and figure out git:
> > Learn it, or be one.
> > cheers
> > ----- Original Message ----- From: "Chris Fields" <cjfields1 at gmail.com>
> > To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> > Sent: Saturday, April 17, 2010 12:18 PM
> > Subject: [Bioperl-l] Possible migration to git/github
> >
> >
> >> All,
> >>
> >> I wanted to get the BioPerl community's general input on a possible
> >> Subversion to git/github migration for the BioPerl repository.  The plans
> >> haven't been finalized in any way.  We haven't decided, for instance, on
> >> whether to make github the main site, a read-only mirror, or a downstream
> >> mirror for forking/pulling code from the community (with a central upstream
> >> dev repo for releases).  As a preliminary run I will be pushing a test run
> >> to github of bioperl-live (all tags/branches) this weekend.
> >>
> >> Thoughts have been circulating among the core developers for some time
> >> about a migration at some point, however recent problems with anon access to
> >> code has made this a more pressing issue.  The overall impression I am
> >> getting from the community at large is a move would be a positive thing and
> >> would swing the doors wide open for users to contribute much more easily
> >> (via forking).
> >>
> >> Therefore, I would like to outline the positive/negative aspects of a move
> >> to git/github, and a proposed path to migration if one should occur.
> >>  Remember, this is a project with 15+ years of code that has already
> >> undergone a recent migration from CVS->SVN.  Retaining history and
> >> branches/tags for all bioperl projects is key.  We also need to think
> >> logistically about other issues particularly with github (number of
> >> collaborators allowed per account, mapping authors, etc etc).
> >>
> >> Personally, I think we should be moving forward with this as soon as
> >> possible, but I personally like git/github so I'm a bit biased.  The
> >> recently-added support for in-line code review comments and SVN support has
> >> particularly swayed me:
> >>
> >> http://github.com/blog/626-announcing-svn-support
> >> http://github.com/blog/622-inline-commit-notes
> >>
> >> Thoughts?  Comments?  Flames?  Suggestions?
> >>
> >> chris
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> >>
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From dan.kortschak at adelaide.edu.au  Tue Apr 20 17:24:26 2010
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Wed, 21 Apr 2010 06:54:26 +0930
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
 that is executed?
In-Reply-To: <mailman.15.1271779204.6014.bioperl-l@lists.open-bio.org>
References: <mailman.15.1271779204.6014.bioperl-l@lists.open-bio.org>
Message-ID: <1271798666.4440.5.camel@epistle>

Hi Ben,

Yeah, that's a good point. An attribute and accessor pair would do the
job: keep the last command string sent to IPC::Run and allow the user to
see this if they want.

Is there any reason this would be objected to as an addition to the
CommandExts and WrapperBase APIs?

Dan

On Tue, 2010-04-20 at 12:00 -0400, bimber at wisc.edu wrote:
> Dan,
> 
> Beyond debugging, I could see cases where logging it would be useful.
> Technically capturing the set of params given to CommandExts does more
> or less the same thing, but sometimes giving people the exact command
> makes it a little more transparent.  You are right that it's not
> absolutely essential.
> 
> -Ben
> 
-- 
_____________________________________________________________   .`.`o
                                                         o| ,\__ `./`r
  Dr. Dan Kortschak  dan.kortschak at adelaide.edu.au    <\/    \_O> O
                                                          "|`...'.\
  Every time I see an adult on a bicycle, I no longer?      `      :\
  despair for the future of the human race.                       : \
    -- H. G. Wells, 1904

  By replying to this email you implicitly accept that your response
  may be forwarded to other recipients, unless otherwise specified.


From David.Messina at sbc.su.se  Tue Apr 20 17:48:41 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Tue, 20 Apr 2010 23:48:41 +0200
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <B1E4F38A-2A25-4FE8-92C5-725766400127@illinois.edu>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
	<B1E4F38A-2A25-4FE8-92C5-725766400127@illinois.edu>
Message-ID: <43B55351-9C9C-4AC4-BB1F-64FCF3239086@sbc.su.se>

Great, thanks Chris, I'll try it that way.

Dave



On Apr 20, 2010, at 8:57 PM, Chris Fields wrote:

> Not sure about the upper limit with SOAP, but simple ol' EUtilities can take ~250-500 IDs (somewhere in that range) with a direct efetch/esummary/elink, and many many more if you use epost first.  I have been able to fetch a couple thousand with epost.  
> 
> As an example, this code works for me:
> 
> use Modern::Perl;
> use Bio::DB::EUtilities;
> 
> my $eutil = Bio::DB::EUtilities->new(-eutil => 'esearch',
>                                     -db    => 'protein',
>                                     -email => 'cjfields at bioperl.org',
>                                     -term  => 'pyrR',
>                                     -retmax => 250,
>                                     -usehistory => 'y');
> 
> my $hist = $eutil->next_History || die "No history returned";
> 
> $eutil->set_parameters(-eutil => 'esummary',
>                       -history => $hist);
> 
> my %id_map;
> 
> while (my $ds = $eutil->next_DocSum) {
>    my ($cdate) = $ds->get_contents_by_name('CreateDate');
>    $id_map{$ds->get_id} = $cdate;
> }
> 
> say join("\t", $_, $id_map{$_}) for sort keys %id_map;


From maj at fortinbras.us  Tue Apr 20 20:11:49 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Tue, 20 Apr 2010 20:11:49 -0400
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	that is executed?
In-Reply-To: <1271798666.4440.5.camel@epistle>
References: <mailman.15.1271779204.6014.bioperl-l@lists.open-bio.org>
	<1271798666.4440.5.camel@epistle>
Message-ID: <0A4B479A891B4CE49E1E2D63F934E54B@NewLife>

By all means patch it in, I say--
----- Original Message ----- 
From: "Dan Kortschak" <dan.kortschak at adelaide.edu.au>
To: <bimber at wisc.edu>
Cc: <bioperl-l at lists.open-bio.org>
Sent: Tuesday, April 20, 2010 5:24 PM
Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command that 
is executed?


> Hi Ben,
>
> Yeah, that's a good point. An attribute and accessor pair would do the
> job: keep the last command string sent to IPC::Run and allow the user to
> see this if they want.
>
> Is there any reason this would be objected to as an addition to the
> CommandExts and WrapperBase APIs?
>
> Dan
>
> On Tue, 2010-04-20 at 12:00 -0400, bimber at wisc.edu wrote:
>> Dan,
>>
>> Beyond debugging, I could see cases where logging it would be useful.
>> Technically capturing the set of params given to CommandExts does more
>> or less the same thing, but sometimes giving people the exact command
>> makes it a little more transparent.  You are right that it's not
>> absolutely essential.
>>
>> -Ben
>>
> -- 
> _____________________________________________________________   .`.`o
>                                                         o| ,\__ `./`r
>  Dr. Dan Kortschak  dan.kortschak at adelaide.edu.au    <\/    \_O> O
>                                                          "|`...'.\
>  Every time I see an adult on a bicycle, I no longer?      `      :\
>  despair for the future of the human race.                       : \
>    -- H. G. Wells, 1904
>
>  By replying to this email you implicitly accept that your response
>  may be forwarded to other recipients, unless otherwise specified.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l 


From dan.kortschak at adelaide.edu.au  Tue Apr 20 21:22:20 2010
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Wed, 21 Apr 2010 10:52:20 +0930
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
 that is executed?
In-Reply-To: <0A4B479A891B4CE49E1E2D63F934E54B@NewLife>
References: <mailman.15.1271779204.6014.bioperl-l@lists.open-bio.org>
	<1271798666.4440.5.camel@epistle>
	<0A4B479A891B4CE49E1E2D63F934E54B@NewLife>
Message-ID: <1271812940.9032.2.camel@zoidberg.mbs.adelaide.edu.au>

I'll do that for WrapperBase::CommandExts this afternoon, but I'd like
to get comment from Jason or Chris before I go changing WrapperBase
itself.

cheers
Dan

On Tue, 2010-04-20 at 20:11 -0400, Mark A. Jensen wrote:
> By all means patch it in, I say--
> ----- Original Message ----- 
> From: "Dan Kortschak" <dan.kortschak at adelaide.edu.au>
> To: <bimber at wisc.edu>
> Cc: <bioperl-l at lists.open-bio.org>
> Sent: Tuesday, April 20, 2010 5:24 PM
> Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command that 
> is executed?
> 
> 
> > Hi Ben,
> >
> > Yeah, that's a good point. An attribute and accessor pair would do the
> > job: keep the last command string sent to IPC::Run and allow the user to
> > see this if they want.
> >
> > Is there any reason this would be objected to as an addition to the
> > CommandExts and WrapperBase APIs?
> >
> > Dan
> 


From jonathan at leto.net  Tue Apr 20 21:53:46 2010
From: jonathan at leto.net (Jonathan Leto)
Date: Tue, 20 Apr 2010 18:53:46 -0700
Subject: [Bioperl-l] Bioperl on GitHub
In-Reply-To: <50DA060E-E0FF-4984-B44B-A67F5ACF92D9@illinois.edu>
References: <1266872963.4519.103.camel@pyrimidine.igb.uiuc.edu> 
	<n2t320fb6e01004130730o8fefbb79r2665815c27e25f1@mail.gmail.com> 
	<EF6CA715-0A0F-420F-B842-B9A599D7CA97@illinois.edu>
	<4BC55DD5.1030302@bioperl.org> 
	<50DA060E-E0FF-4984-B44B-A67F5ACF92D9@illinois.edu>
Message-ID: <t2t9aaadf9c1004201853s303482c4p759ffba5a25ce473@mail.gmail.com>

Howdy,

I am excited to hear that BioPerl is converting to git, and can
provide some help if necessary.

I highly recommend doing the actual SVN -> Git conversion with
svn-all-fast-export [0]. An example of how to use it is here [1].

Good Luck!

Cheers,

PS; http://repo.or.cz provides free git mirrors.

[0] - http://repo.or.cz/w/svn-all-fast-export.git
[1] - http://starlink.jach.hawaii.edu/starlink/GitConversion

On Wed, Apr 14, 2010 at 7:48 PM, Chris Fields <cjfields at illinois.edu> wrote:
> I'll work on a full test migration this weekend.
>
> chris
>
> On Apr 14, 2010, at 1:16 AM, Jason Stajich wrote:
>
>> I think we should migrate as well. The primary can also be at github if you like - the lack of code.open-bio system is a real problem that doesn't seem to be getting fixed....
>> We could also make the primary github if need be?
>>
>> -jason
>>
>> Chris Fields wrote, On 4/13/10 8:10 AM:
>>> On Apr 13, 2010, at 9:30 AM, Peter wrote:
>>>
>>>
>>>> On Mon, Feb 22, 2010 at 10:09 PM, Chris Fields<cjfields at illinois.edu> ?wrote:
>>>>
>>>>> All,
>>>>>
>>>>> As a backup for the anonymous svn access on code.open-bio.org, I have
>>>>> set up a few READ-ONLY mirrors on GitHub for the main trunk code of
>>>>> several BioPerl distributions, generated using git-svn:
>>>>>
>>>>> http://github.com/bioperl
>>>>>
>>>>> These are sync'ed every 15 minutes.
>>>>>
>>>>> Note the emphasis on 'read-only'; we don't anticipate migrating code
>>>>> over to github completely, at least at the moment. ?Based on that and
>>>>> several issues with git/svn two-way syncing (outlined in the git-svn man
>>>>> pages and elsewhere), we will not support pull requests directly in
>>>>> github.
>>>>>
>>>>> enjoy!
>>>>>
>>>>> chris
>>>>>
>>>> Hi all,
>>>>
>>>> At the start of April GitHub announced support for accessing a
>>>> github.com hosted git repository via SVN (and this is apparently
>>>> not an April Fools joke):
>>>>
>>>> http://github.com/blog/626-announcing-svn-support
>>>>
>>>> This means in addition to using the github read only mirror via git, e.g.
>>>>
>>>> git clone git://github.com/bioperl/bioperl-live.git
>>>>
>>>> You can also use the github read only mirror via svn, e.g.
>>>>
>>>> svn checkout http://svn.github.com/bioperl/bioperl-live.git
>>>>
>>>> I've just used this to grab the latest code - it seems to work fine.
>>>> This should be handy if code.open-bio.org (the OBF anonymous
>>>> CVS and SVN server) is down.
>>>>
>>>> Regards,
>>>>
>>>> Peter
>>>>
>>>
>>> Yes, saw that. ?I'm thinking more and more we should start migrating our work to github...
>>>
>>> chris
>>>
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net


From maj at fortinbras.us  Tue Apr 20 21:30:11 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Tue, 20 Apr 2010 21:30:11 -0400
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
Message-ID: <D35330FF421144A3BA2BA8D3F21CBC19@NewLife>

Hey Dave-- 
I think you've got to set

-RetMax => 250

in the fetch call.

To get the date without the other stuff, you might try working with docsums 
instead of sequences. It's been a while, so I'm fuzzy on the details (and the 
details are fuzzy anyway). Can you send a gist of your code?
MAJ
----- Original Message ----- 
From: "Dave Messina" <David.Messina at sbc.su.se>
To: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Tuesday, April 20, 2010 1:22 PM
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast


Hi everyone,

I've got about 250 NCBI IDs that I'm pulling from NCBI using 
Bio::DB::SoapEUtilities. It works fine if I send 10 IDs at a time, but much more 
than that and I get an 'unspecified internal server error'.

I thought the limit with 500 IDs at a time ? anyone have an idea whether that's 
true?


And a separate, related question:

All I really want to get is the last-modified date for these records.

And it's kinda slow.

Using some code from the EUtilities_Web_Services HOWTO, I use the seq Fetch 
adaptor and the add_wanted_slot() Bio::Seq::SeqBuilder trick to get just the 
annotation part of a RichSeq object, and from there I pull out the dates using

$seq->annotation->get_Annotations('date_changed')


Can someone suggest a faster way?


Thanks,
Dave


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jonathan at leto.net  Tue Apr 20 22:05:37 2010
From: jonathan at leto.net (Jonathan Leto)
Date: Tue, 20 Apr 2010 19:05:37 -0700
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <1271798182.28484.3.camel@pyrimidine.igb.uiuc.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu> 
	<52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>
	<o2sddde1f421004192305p5695c67ai8315e12101b82e52@mail.gmail.com>
	<1271798182.28484.3.camel@pyrimidine.igb.uiuc.edu>
Message-ID: <g2z9aaadf9c1004201905r44d1a540p6607d20ccb447380@mail.gmail.com>

Howdy,


On Tue, Apr 20, 2010 at 2:16 PM, Chris Fields <cjfields at illinois.edu> wrote:
> Agreed, we won't move forward with splitting up any code until after we
> make the move over to git/github.

After conversion from svn to git with svn-all-fast-export is done, you
can use git filter branch to split code into as many repos as needed.
It is a process that is separate from conversion.

> I may end up steering clear of the simple approach (using github's
> automated svn import) as it's not pulling authors over in an easy way
> (web forms?!?), and seems to take forever for even simple repos. ?I'm

+1 to abandoning that approach.

> currently attempting a pull this way using jason's google code mirror
> for bioperl since code.open-bio.org is comatose. ?Also looking at
> git-svn-abandon and snerp vortex as possible means of conversion.
>

To address some other concerns, github should only be considered a
mirror with a few extra features that the community can decide what to
do with. Vendor lock-in does not exist.

Cheers,

-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net


From cjfields at illinois.edu  Tue Apr 20 23:32:10 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 22:32:10 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <g2z9aaadf9c1004201905r44d1a540p6607d20ccb447380@mail.gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<52D6ACB5616D459BB4C1E8E01739E3BF@NewLife>
	<o2sddde1f421004192305p5695c67ai8315e12101b82e52@mail.gmail.com>
	<1271798182.28484.3.camel@pyrimidine.igb.uiuc.edu>
	<g2z9aaadf9c1004201905r44d1a540p6607d20ccb447380@mail.gmail.com>
Message-ID: <2C6CBA72-96F1-4CE3-AE56-A149C58EBA24@illinois.edu>


On Apr 20, 2010, at 9:05 PM, Jonathan Leto wrote:

> Howdy,
> 
> 
> On Tue, Apr 20, 2010 at 2:16 PM, Chris Fields <cjfields at illinois.edu> wrote:
>> Agreed, we won't move forward with splitting up any code until after we
>> make the move over to git/github.
> 
> After conversion from svn to git with svn-all-fast-export is done, you
> can use git filter branch to split code into as many repos as needed.
> It is a process that is separate from conversion.

Okay, I'm convinced!  I'll give it a go.  Thanks for the pointer, Duke, was looking at a few other options (git-svn-abandon being one).

>> I may end up steering clear of the simple approach (using github's
>> automated svn import) as it's not pulling authors over in an easy way
>> (web forms?!?), and seems to take forever for even simple repos.  I'm
> 
> +1 to abandoning that approach.

Yes, it seems more painful than it's worth.  Also easier to map authors using other approaches.

>> currently attempting a pull this way using jason's google code mirror
>> for bioperl since code.open-bio.org is comatose.  Also looking at
>> git-svn-abandon and snerp vortex as possible means of conversion.
>> 
> 
> To address some other concerns, github should only be considered a
> mirror with a few extra features that the community can decide what to
> do with. Vendor lock-in does not exist.
> 
> Cheers,
> 
> -- 
> Jonathan "Duke" Leto
> jonathan at leto.net
> http://leto.net

We could place the main repo on our developer server, but we could still feasibly make github the main repo as long as we direct bug reports and other resources elsewhere.

chris

From cjfields at illinois.edu  Tue Apr 20 23:32:12 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 22:32:12 -0500
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <D35330FF421144A3BA2BA8D3F21CBC19@NewLife>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
	<D35330FF421144A3BA2BA8D3F21CBC19@NewLife>
Message-ID: <DB16F67E-40B3-472F-89B4-F8273018F3F7@illinois.edu>

Interesting, that's essentially what the example I sent did, just with the standard eutils interface.  Would be interesting to see how the two compare.

chris

On Apr 20, 2010, at 8:30 PM, Mark A. Jensen wrote:

> Hey Dave-- I think you've got to set
> 
> -RetMax => 250
> 
> in the fetch call.
> 
> To get the date without the other stuff, you might try working with docsums instead of sequences. It's been a while, so I'm fuzzy on the details (and the details are fuzzy anyway). Can you send a gist of your code?
> MAJ
> ----- Original Message ----- From: "Dave Messina" <David.Messina at sbc.su.se>
> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Tuesday, April 20, 2010 1:22 PM
> Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
> 
> 
> Hi everyone,
> 
> I've got about 250 NCBI IDs that I'm pulling from NCBI using Bio::DB::SoapEUtilities. It works fine if I send 10 IDs at a time, but much more than that and I get an 'unspecified internal server error'.
> 
> I thought the limit with 500 IDs at a time ? anyone have an idea whether that's true?
> 
> 
> And a separate, related question:
> 
> All I really want to get is the last-modified date for these records.
> 
> And it's kinda slow.
> 
> Using some code from the EUtilities_Web_Services HOWTO, I use the seq Fetch adaptor and the add_wanted_slot() Bio::Seq::SeqBuilder trick to get just the annotation part of a RichSeq object, and from there I pull out the dates using
> 
> $seq->annotation->get_Annotations('date_changed')
> 
> 
> Can someone suggest a faster way?
> 
> 
> Thanks,
> Dave
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Tue Apr 20 23:39:38 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 20 Apr 2010 22:39:38 -0500
Subject: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command
	that is executed?
In-Reply-To: <1271812940.9032.2.camel@zoidberg.mbs.adelaide.edu.au>
References: <mailman.15.1271779204.6014.bioperl-l@lists.open-bio.org>
	<1271798666.4440.5.camel@epistle>
	<0A4B479A891B4CE49E1E2D63F934E54B@NewLife>
	<1271812940.9032.2.camel@zoidberg.mbs.adelaide.edu.au>
Message-ID: <0B2313FD-A111-4EE6-8707-C487E853BB10@illinois.edu>

I don't necessarily have a problem with it, as long as Mark's okay with it and it doesn't introduce additional dependencies to core.  

chris

On Apr 20, 2010, at 8:22 PM, Dan Kortschak wrote:

> I'll do that for WrapperBase::CommandExts this afternoon, but I'd like
> to get comment from Jason or Chris before I go changing WrapperBase
> itself.
> 
> cheers
> Dan
> 
> On Tue, 2010-04-20 at 20:11 -0400, Mark A. Jensen wrote:
>> By all means patch it in, I say--
>> ----- Original Message ----- 
>> From: "Dan Kortschak" <dan.kortschak at adelaide.edu.au>
>> To: <bimber at wisc.edu>
>> Cc: <bioperl-l at lists.open-bio.org>
>> Sent: Tuesday, April 20, 2010 5:24 PM
>> Subject: Re: [Bioperl-l] Bio::Tools::Run::WrapperBase: Capture the command that 
>> is executed?
>> 
>> 
>>> Hi Ben,
>>> 
>>> Yeah, that's a good point. An attribute and accessor pair would do the
>>> job: keep the last command string sent to IPC::Run and allow the user to
>>> see this if they want.
>>> 
>>> Is there any reason this would be objected to as an addition to the
>>> CommandExts and WrapperBase APIs?
>>> 
>>> Dan
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From maj at fortinbras.us  Wed Apr 21 00:13:05 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Wed, 21 Apr 2010 00:13:05 -0400
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <DB16F67E-40B3-472F-89B4-F8273018F3F7@illinois.edu>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
	<D35330FF421144A3BA2BA8D3F21CBC19@NewLife>
	<DB16F67E-40B3-472F-89B4-F8273018F3F7@illinois.edu>
Message-ID: <BFD4B350A25E4E9BACB84CAF38B65514@NewLife>

As I remember, the two were slightly different, but only at the most aggravating 
points. The parameters don't map completely consistently; I think there is a 
kludge or two in SoapEU that makes sure certain things work (like taking -retmax 
to -RetMax, 'cause all of sudden there's case sensitivity). I wasn't very 
systematic about this, however-- One aggravating thing was the 'unspecified 
internal error' (or was it the 'lazy contractor error'?), that seems to get 
thrown when you specify a general parameter (like retmax) that doesn't happen to 
be used by the method you're calling. Seems to me that these were just ignored 
under original EU. And so on.-- MAJ
----- Original Message ----- 
From: "Chris Fields" <cjfields at illinois.edu>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: "Dave Messina" <David.Messina at sbc.su.se>; "BioPerl List" 
<bioperl-l at lists.open-bio.org>
Sent: Tuesday, April 20, 2010 11:32 PM
Subject: Re: [Bioperl-l] NCBI efetch: request limits and getting dates fast


Interesting, that's essentially what the example I sent did, just with the 
standard eutils interface.  Would be interesting to see how the two compare.

chris

On Apr 20, 2010, at 8:30 PM, Mark A. Jensen wrote:

> Hey Dave-- I think you've got to set
>
> -RetMax => 250
>
> in the fetch call.
>
> To get the date without the other stuff, you might try working with docsums 
> instead of sequences. It's been a while, so I'm fuzzy on the details (and the 
> details are fuzzy anyway). Can you send a gist of your code?
> MAJ
> ----- Original Message ----- From: "Dave Messina" <David.Messina at sbc.su.se>
> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Tuesday, April 20, 2010 1:22 PM
> Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
>
>
> Hi everyone,
>
> I've got about 250 NCBI IDs that I'm pulling from NCBI using 
> Bio::DB::SoapEUtilities. It works fine if I send 10 IDs at a time, but much 
> more than that and I get an 'unspecified internal server error'.
>
> I thought the limit with 500 IDs at a time ? anyone have an idea whether 
> that's true?
>
>
> And a separate, related question:
>
> All I really want to get is the last-modified date for these records.
>
> And it's kinda slow.
>
> Using some code from the EUtilities_Web_Services HOWTO, I use the seq Fetch 
> adaptor and the add_wanted_slot() Bio::Seq::SeqBuilder trick to get just the 
> annotation part of a RichSeq object, and from there I pull out the dates using
>
> $seq->annotation->get_Annotations('date_changed')
>
>
> Can someone suggest a faster way?
>
>
> Thanks,
> Dave
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From sdavis2 at mail.nih.gov  Wed Apr 21 10:40:26 2010
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Wed, 21 Apr 2010 10:40:26 -0400
Subject: [Bioperl-l] Gene Expression Omnibus Data interface?
In-Reply-To: <w2v264855a01004191431vfec57902y60f673e6af3e82c@mail.gmail.com>
References: <g2ndeaa866a1004191303t8d636138n180bc80d4aaaf690@mail.gmail.com>
	<w2v264855a01004191431vfec57902y60f673e6af3e82c@mail.gmail.com>
Message-ID: <j2n264855a01004210740p715c962fx8d7763df1837f431@mail.gmail.com>

On Mon, Apr 19, 2010 at 5:31 PM, Sean Davis <sdavis2 at mail.nih.gov> wrote:

>
>
> On Mon, Apr 19, 2010 at 4:03 PM, Robert Bradbury <
> robert.bradbury at gmail.com> wrote:
>
>> Next question is whether BioPerl has an interface to the NCBI GEO database
>> that would allow BioPerl programs to (regularly) query the datasets to
>> determine data relating to specific genes or organisms has been added?
>>
>> I'm trying to automate my requests to various databases (PubMed, GEO,
>> etc.)
>> to construct an expanding (topic specific) knowledge base.
>>
>>
> You could look at the GEOmetadb package for R.  The package provides an
> interface to a standard SQLite database that we update weekly with ALL
> metadata from GEO.  Additionally, there is an online version of the
> database.   See:
>
> http://gbnci.abcc.ncifcrf.gov/geo/
> http://bioconductor.org/packages/release/bioc/html/GEOmetadb.html
>
>
Robert,

I forgot to mention an RSS feed that we set up using the above tools.  The
feed tracks released data from NCBI GEO.  The GEO folks are working on such
a thing themselves, but to my knowledge have not made it available yet.  The
blog post describing the technology is here:

http://bio-blue.blogspot.com/2010/03/rss-feed-for-ncbi-geo-submissions-using.html

The GEO RSS feed is here:

http://feeds.feedburner.com/ncbiGeo

Sean

From bimber at wisc.edu  Wed Apr 21 10:45:06 2010
From: bimber at wisc.edu (Ben Bimber)
Date: Wed, 21 Apr 2010 09:45:06 -0500
Subject: [Bioperl-l] last execution
In-Reply-To: <1271847137.10836.1.camel@epistle>
References: <1271847137.10836.1.camel@epistle>
Message-ID: <s2i9f985cdc1004210745t9450d5d0me212404fc07f72ff@mail.gmail.com>

works fine as far as I can tell.  thanks for adding it.

-ben



On Wed, Apr 21, 2010 at 5:52 AM, Dan Kortschak
<dan.kortschak at adelaide.edu.au> wrote:
> Hi Ben,
>
> Would you like to try out the last_execution method in CommandExts - it
> should do what you wanted. Passes tests, but my test suite for
> bioperl-run is not hugely populated with runnables.
>
> cheers
> Dan
> --
> Dan Kortschak <dan.kortschak at adelaide.edu.au>
>
>

From rec3141 at mcmaster.ca  Wed Apr 21 11:45:46 2010
From: rec3141 at mcmaster.ca (Eric Collins)
Date: Wed, 21 Apr 2010 11:45:46 -0400
Subject: [Bioperl-l] Bio::DB::Taxonomy and each_Descendent
In-Reply-To: <9081_1271796557_o3KKnAcq015381_42E5A75A-438A-4AF7-AC60-226395329A9B@illinois.edu>
References: <m2g1961621c1004161449h1e7c84f1zcef0b8af0825ca99@mail.gmail.com> 
	<i2v1961621c1004201320nedb3c28fm1f24b2d2cb65379@mail.gmail.com> 
	<9081_1271796557_o3KKnAcq015381_42E5A75A-438A-4AF7-AC60-226395329A9B@illinois.edu>
Message-ID: <j2i1961621c1004210845wac403f7emaf57118e2046f8ef@mail.gmail.com>

Thanks, that was indeed the answer to #2. Any idea about each_Descendent?
Eric

On Tue, Apr 20, 2010 at 4:48 PM, Chris Fields <cjfields at illinois.edu> wrote:
> Sounds like this is going through an initial indexing step (for flatfiles). ?I would expect the initial indexing of the tables to take time as you have to create the DB, but subsequent lookups post-indexing should be much faster if the index is already present. ?Maybe Jason could answer in more detail?
>
> chris
>
> On Apr 20, 2010, at 3:20 PM, Eric Collins wrote:
>
>> Hello,
>>
>> I tried the Bio::DB::Taxonomy example on this wiki page using perl
>> 5.8.5 with BioPerl 1.6.0
>> http://www.bioperl.org/wiki/Module:Bio::DB::Taxonomy
>>
>> It ran for 100 cpu seconds and output:
>>
>> 33090 Viridiplantae kingdom
>>
>> I was expecting it to also output the descendents. Some questions:
>>
>> 1) are calls to 'each_Descendent' or 'get_all_Descendents' actually
>> implemented? It looks to be in Taxon.pm but it is not documented and
>> when I ran Data::Dumper on $node the value '_desc' was empty.
>>
>> 2) is the flatfile reader always so slow? after replacing 'flatfile'
>> with a call to 'entrez' it took only 0.02 cpu seconds to come
>> up with the same result.
>>
>> thanks,
>> Eric
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


From bernd.web at gmail.com  Wed Apr 21 13:08:29 2010
From: bernd.web at gmail.com (Bernd Web)
Date: Wed, 21 Apr 2010 19:08:29 +0200
Subject: [Bioperl-l] SimpleAlign Ids
Message-ID: <w2v716af09c1004211008za4f9dacfq29e0bf8591ed4529@mail.gmail.com>

Hi

Would it be an idea to change SimpleAlign/AlignIO as not to use
sequence IDs in the hash to store the sequences?
Quite regularly I run into issues with alignments that do not have
unique IDs. This esp. occurs with alignments from the CDD at NCBI.
When I know the input format I (or a user) is using, I have a
pre-processing step to make all IDs unique.
However, when the input format can change everytime, it is really
handy to use SimpleAlign with the format guesser.
When the sequence objects would be stored using unique keys instead of
Ids this issue would not occur.
I can image that for other using large alignments this might not be
handy as I suppose an extra lookup step would be needed.

Is the above an issue that  others run into too?

Kind regards,
Bernd

From David.Messina at sbc.su.se  Wed Apr 21 15:08:34 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Wed, 21 Apr 2010 21:08:34 +0200
Subject: [Bioperl-l] NCBI efetch: request limits and getting dates fast
In-Reply-To: <BFD4B350A25E4E9BACB84CAF38B65514@NewLife>
References: <8C54F1D6-7963-4289-A736-8875C84D534A@sbc.su.se>
	<D35330FF421144A3BA2BA8D3F21CBC19@NewLife>
	<DB16F67E-40B3-472F-89B4-F8273018F3F7@illinois.edu>
	<BFD4B350A25E4E9BACB84CAF38B65514@NewLife>
Message-ID: <A5F9A46D-0A4F-49AC-9ACE-6DAD141515EF@sbc.su.se>

Thanks Chris and Mark for your help.

You were right that docsums were the way to go, and so Chris' code sample was just what I needed.

I'm pushing on this project so I didn't stop to try to recreate the same using the SoapEUtils, but I think it's safe to say that the speedup I saw came from the switch from efetch to esearch.

If I get a chance, though, I will test -RetMax in SoapEU and see if that was the initial problem there.


Dave



From rec3141 at mcmaster.ca  Fri Apr 16 17:49:08 2010
From: rec3141 at mcmaster.ca (Eric Collins)
Date: Fri, 16 Apr 2010 17:49:08 -0400
Subject: [Bioperl-l] Bio::DB::Taxonomy and each_Descendent
Message-ID: <m2g1961621c1004161449h1e7c84f1zcef0b8af0825ca99@mail.gmail.com>

Hello,

I tried the Bio::DB::Taxonomy example on this wiki page using perl
5.8.5 with BioPerl 1.6.0
http://www.bioperl.org/wiki/Module:Bio::DB::Taxonomy

It ran for 100 cpu seconds and output:
33090 Viridiplantae kingdom

I was expecting it to also output the descendents.

Some questions:

1) are calls to 'each_Descendent' or 'get_all_Descendents' actually
implemented? I ran Data::Dumper on $node and '_desc' was empty.

2) is the flatfile reader always so slow? after replacing 'flatfile'
with a call to 'entrez' it took only 0.02 cpu seconds.

thanks,
Eric

From rvos at interchange.ubc.ca  Wed Apr 21 07:18:25 2010
From: rvos at interchange.ubc.ca (Rutger Vos)
Date: Wed, 21 Apr 2010 12:18:25 +0100
Subject: [Bioperl-l] Computational Phyloinformatics: A BGI-Shenzhen and
	NESCent Course, 5/8 - 17/8 '10
Message-ID: <l2v2bb9b24a1004210418r9d141250p19118fd1b0381d23@mail.gmail.com>

Dear bioperlers,

the National Evolutionary Synthesis Center (http://www.nescent.org)
and BGI-Shenzhen (formerly Beijing Genomics Institute,
http://www.genomics.cn/) are organizing a course in Computational
Phyloinformatics 5 August - 17 August 2010, in Shenzhen, PRC. The
course will have a very strong (Bio)Perl component, which is why I
thought it appropriate to post to this list. There are still spots
available for graduate students and postdocs who can come to Shenzhen,
so please help us reach them by forwarding the announcement below to
any suitable channels, thank you!

------------------------------
Computational Phyloinformatics: A BGI-Shenzhen and NESCent Course
5 August - 17 August 2010

http://www.nescent.org/courses/2010/comphy/
http://www.genomics.cn/en/edu.php?type=show&id=477

Course Contacts: Wang Xiaoling (training at genomics.org.cn) and William
Piel (piel at treebase.org)
Organizing Committee: Li Zhuo, Wang Xiaoling, Hilmar Lapp, William
Piel, Todd Vision

Computational Phyloinformatics is an 11-day intensive summer course
co-sponsored by BGI-Shenzhen and the U.S. National Evolutionary
Synthesis Center (NESCent), and will take place at the BGI-Shenzhen
genomics institute in Yah Tian District, Shenzhen, China.  The venue
is in proximity to beaches, national forests, and holiday resorts. The
course aims to give students practical knowledge and hands-on
programming skills in phyloinformatics.

SYNOPSIS
Biologists are faced with ever-larger datasets, more complex
evolutionary models, and increasingly elaborate analytical methods.
Seldom is it sufficient to run a dataset with an off-the-shelf program
on a desktop PC; increasingly, biologists need to write scripts to
interface with internet services and databases, build analytical
pipelines, customize analyses, and distribute computation over
multiple processors.  This course is designed for graduate students,
postdocs, and researchers in phylogenetics interested in receiving
practical, hands-on training in the use of Perl and SQL for
phyloinformatics applications.

The course is divided into three parts:

? Part I: A tutorial review of of Perl, including object oriented
programming and building packages

? Part II: Introduction and practical use of BioPerl and Bio::Phylo,
(e.g. scripting for large tree inference engines, automating model
testing, supertree assembly, rate smoothing and branch calibration,
tree traversal, etc).

? Part III: Introduction to database design; computing and querying
nested sets and transitive closure; topological querying of both large
trees (e.g. NCBI) and large collections of trees (e.g. TreeBASE)..

Students  will learn how to write basic phylogenetic or comparative
analysis scripts, parse NEXUS files, traverse and compute over trees,
and make practical use of phylogenetic software libraries.  These
skills will be learned in a biological context, touching on a diverse
array of topics such as analysis of large datasets, automation of
supertree assembly, querying for topological patterns in large
collections of trees, etc.

INSTRUCTORS
Darin London, William Piel, Rutger Vos

PREREQUISITES
Biology: A solid understanding of phylogenetics (maximum parsimony,
maximum likelihood, bayesian inference, neighbor-joining, substitution
models) ? for example, having already taken the Workshop on Molecular
Evolution (http://www.molecularevolution.org/), Bodega Applied
Phylogenetics Workshop (http://bodegaphylo.wikispot.org/), or
equivalent coursework or experience.

Computing: Prior experience with Perl or careful study of the
suggested reading materials (see web site). Students should have
experience with basic Unix shell commands. All students are expected
to bring either their own Mac OSX computer or a LINUX computer;
otherwise LINUX computers will be provided.

FEES
Full tuition is ?6,800 (~$996), and includes lunches, coffee, computer
equipment, and an outing on one of two free days. Students are free to
find their own accommodation, but shuttle service is offered to/from
the recommended hotels: Pattaya Hotel and East Coast Blue Club Hotel,
located near Dameisha beach.

HOW TO APPLY
Apply through the course website. You will be asked to provide a
resume and a motivation statement (including a self-assessment of your
skills, experience, and knowledge of both phylogenetics and
computing).
------------------------------

-- 
Dr. Rutger A. Vos
School of Biological Sciences
Philip Lyle Building, Level 4
University of Reading
Reading
RG6 6BX
United Kingdom
Tel: +44 (0) 118 378 7535
http://www.nexml.org
http://rutgervos.blogspot.com


From avilella at gmail.com  Thu Apr 22 11:10:34 2010
From: avilella at gmail.com (Albert Vilella)
Date: Thu, 22 Apr 2010 16:10:34 +0100
Subject: [Bioperl-l] Stem-and-leaf plot for fastq scores in a file?
Message-ID: <u2m358f4d651004220810mcb2ed0e4xa5a995e7dfdc71f8@mail.gmail.com>

Hi,

Maybe someone has figured this script out, so I am asking the list:

Given a fastq file with all reads of identical length like this one
(presumably not huge):
http://www.ebi.ac.uk/~avilella/example.fastq

how can I produce a stem-and-leaf plot (or stemplot) of the qscores?

Something simple that prints out the plot to the terminal,

Cheers,

Albert.

From hlapp at drycafe.net  Thu Apr 22 16:54:29 2010
From: hlapp at drycafe.net (Hilmar Lapp)
Date: Thu, 22 Apr 2010 16:54:29 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <47A3890D-4847-40B2-BF40-3CD193C9D1A4@illinois.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<20100420102001.GM12306@poppy.etrumeus.com>
	<i2t320fb6e01004200624je55a955ew14451d3c9bc28f47@mail.gmail.com>
	<47A3890D-4847-40B2-BF40-3CD193C9D1A4@illinois.edu>
Message-ID: <CBB3EC37-34A6-40F8-995B-F56E1DE1E4CC@drycafe.net>


On Apr 20, 2010, at 3:00 PM, Chris Fields wrote:

> It does have several large and very active projects (Qt, FreeBSD,  
> etc), but very few (any?) bioperl devs on it, beyond me.


I am, since a couple days :)
-- 
===========================================================
: Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net :
===========================================================





From maj at fortinbras.us  Thu Apr 22 17:42:00 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 22 Apr 2010 17:42:00 -0400
Subject: [Bioperl-l] SimpleAlign Ids
In-Reply-To: <w2v716af09c1004211008za4f9dacfq29e0bf8591ed4529@mail.gmail.com>
References: <w2v716af09c1004211008za4f9dacfq29e0bf8591ed4529@mail.gmail.com>
Message-ID: <A8F8ADFA3532433486E7EF3FBDC6A4BB@NewLife>

Hi Bernd,
I'm for the idea of an internal uid for sequences; tree nodes already work like 
this, for example, and I think it's the Right Thing To Do.
MAJ
----- Original Message ----- 
From: "Bernd Web" <bernd.web at gmail.com>
To: "BioPerl List" <bioperl-l at bioperl.org>
Sent: Wednesday, April 21, 2010 1:08 PM
Subject: [Bioperl-l] SimpleAlign Ids


> Hi
>
> Would it be an idea to change SimpleAlign/AlignIO as not to use
> sequence IDs in the hash to store the sequences?
> Quite regularly I run into issues with alignments that do not have
> unique IDs. This esp. occurs with alignments from the CDD at NCBI.
> When I know the input format I (or a user) is using, I have a
> pre-processing step to make all IDs unique.
> However, when the input format can change everytime, it is really
> handy to use SimpleAlign with the format guesser.
> When the sequence objects would be stored using unique keys instead of
> Ids this issue would not occur.
> I can image that for other using large alignments this might not be
> handy as I suppose an extra lookup step would be needed.
>
> Is the above an issue that  others run into too?
>
> Kind regards,
> Bernd
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From cjfields at illinois.edu  Thu Apr 22 19:31:01 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Thu, 22 Apr 2010 18:31:01 -0500
Subject: [Bioperl-l] SimpleAlign Ids
In-Reply-To: <A8F8ADFA3532433486E7EF3FBDC6A4BB@NewLife>
References: <w2v716af09c1004211008za4f9dacfq29e0bf8591ed4529@mail.gmail.com>
	<A8F8ADFA3532433486E7EF3FBDC6A4BB@NewLife>
Message-ID: <344DFD0C-CC7D-4A4E-927F-34ED431E476B@illinois.edu>

It's something to take into consideration if the SoC project goes through.  We should know for sure next week.

chris

On Apr 22, 2010, at 4:42 PM, Mark A. Jensen wrote:

> Hi Bernd,
> I'm for the idea of an internal uid for sequences; tree nodes already work like this, for example, and I think it's the Right Thing To Do.
> MAJ
> ----- Original Message ----- From: "Bernd Web" <bernd.web at gmail.com>
> To: "BioPerl List" <bioperl-l at bioperl.org>
> Sent: Wednesday, April 21, 2010 1:08 PM
> Subject: [Bioperl-l] SimpleAlign Ids
> 
> 
>> Hi
>> 
>> Would it be an idea to change SimpleAlign/AlignIO as not to use
>> sequence IDs in the hash to store the sequences?
>> Quite regularly I run into issues with alignments that do not have
>> unique IDs. This esp. occurs with alignments from the CDD at NCBI.
>> When I know the input format I (or a user) is using, I have a
>> pre-processing step to make all IDs unique.
>> However, when the input format can change everytime, it is really
>> handy to use SimpleAlign with the format guesser.
>> When the sequence objects would be stored using unique keys instead of
>> Ids this issue would not occur.
>> I can image that for other using large alignments this might not be
>> handy as I suppose an extra lookup step would be needed.
>> 
>> Is the above an issue that  others run into too?
>> 
>> Kind regards,
>> Bernd
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From dimitark at bii.a-star.edu.sg  Thu Apr 22 21:02:31 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Fri, 23 Apr 2010 09:02:31 +0800
Subject: [Bioperl-l] about Bio::Tools::Run::Alignment::StandAloneFasta
Message-ID: <4BD0F1A7.5090705@bii.a-star.edu.sg>

Hi guys,
i am sorry for the repeating but i was told to post it on the list. So 
below is
what was my problem and how i solved it for me:

I wrote about that the 'q' option in the module
'Bio::Tools::Run::Alignment::StandAloneFasta' is not functioning. I
found out important thing. When 'ssearch' is used from terminal with -O
(for the output) then there is always output and on the terminal. The only
way to avoid that is to use '>' to direct to output to a file. So i went
back to the module and modified it a bit :) Now i can give to the module
the 'O' option as usual with my output file plus the 'q' option and i
dont get output on the terminal.
I just modified the '_setparams' and 'run' functions a bit. I attach
the modified module file where i commented the original lines with
'original' (very original :) ) and the others with 'dimitar'. There is
the '$dim_out' = dimitar output :) to be clear and not to clash with
something else.

May be there are some other users who dont want to see much output :)

Cheers
Dimitar

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


-------------- next part --------------
An embedded and charset-unspecified text was scrubbed...
Name: StandAloneFasta.pm
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100423/931ddeb5/attachment.pl>

From iftekharul.haque at gmail.com  Thu Apr 22 22:24:35 2010
From: iftekharul.haque at gmail.com (Iftekharul Haque)
Date: Fri, 23 Apr 2010 10:24:35 +0800
Subject: [Bioperl-l] Seeking to Contribute
Message-ID: <y2j56128e5e1004221924x3ac4521bnc0c08a78e6c00b42@mail.gmail.com>

Hi All,

I'm a Perl developer of 4 years now, and I wanted to contribute to the
BioPerl project.

I'm trying to apply to medical school (attempting a career shift from
a developer), and I'd like some technical volunteer work under my
belt. Clinically-related "research" is good, but I figured this is the
best place where my existing skills can contribute most, indirect
though it may be.

I've been following the e-mails for a month or so now, and I tried
Google'ing around for some place where you can "pick up" projects or a
to-do list of sorts, or help in code-cleanups or the like, and I found
one, except most of them were crossed out, and completed by Chris
Fields. :-)

I was wondering if there were any modules I could pick up, help
refactor, add features to, and basically ship some good, clean code.

I'm experienced in working in a Linux environment, and with the CPAN.
I haven't worked extensively with Moose, but I think this might be a
good opportunity to learn!

Regards,
Ifty.

From maj at fortinbras.us  Thu Apr 22 23:05:27 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Thu, 22 Apr 2010 23:05:27 -0400
Subject: [Bioperl-l] about Bio::Tools::Run::Alignment::StandAloneFasta
In-Reply-To: <4BD0F1A7.5090705@bii.a-star.edu.sg>
References: <4BD0F1A7.5090705@bii.a-star.edu.sg>
Message-ID: <4478093E752A4D33926C3398C6B0CFBB@NewLife>

Thanks Dimitar-- I'm having a look at the code; will see if I can patch it in.
MAJ
----- Original Message ----- 
From: "Dimitar Kenanov" <dimitark at bii.a-star.edu.sg>
To: <bioperl-l at bioperl.org>
Sent: Thursday, April 22, 2010 9:02 PM
Subject: [Bioperl-l] about Bio::Tools::Run::Alignment::StandAloneFasta


> Hi guys,
> i am sorry for the repeating but i was told to post it on the list. So
> below is
> what was my problem and how i solved it for me:
>
> I wrote about that the 'q' option in the module
> 'Bio::Tools::Run::Alignment::StandAloneFasta' is not functioning. I
> found out important thing. When 'ssearch' is used from terminal with -O
> (for the output) then there is always output and on the terminal. The only
> way to avoid that is to use '>' to direct to output to a file. So i went
> back to the module and modified it a bit :) Now i can give to the module
> the 'O' option as usual with my output file plus the 'q' option and i
> dont get output on the terminal.
> I just modified the '_setparams' and 'run' functions a bit. I attach
> the modified module file where i commented the original lines with
> 'original' (very original :) ) and the others with 'dimitar'. There is
> the '$dim_out' = dimitar output :) to be clear and not to clash with
> something else.
>
> May be there are some other users who dont want to see much output :)
>
> Cheers
> Dimitar
>
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
>
>
>


--------------------------------------------------------------------------------


> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l 


From biopython at maubp.freeserve.co.uk  Fri Apr 23 05:13:55 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Fri, 23 Apr 2010 10:13:55 +0100
Subject: [Bioperl-l] about Bio::Tools::Run::Alignment::StandAloneFasta
In-Reply-To: <4BD0F1A7.5090705@bii.a-star.edu.sg>
References: <4BD0F1A7.5090705@bii.a-star.edu.sg>
Message-ID: <w2v320fb6e01004230213o19ceba64pf00edb286c988fc5@mail.gmail.com>

On Fri, Apr 23, 2010 at 2:02 AM, Dimitar Kenanov
<dimitark at bii.a-star.edu.sg> wrote:
> Hi guys,
> i am sorry for the repeating but i was told to post it on the list. So below
> is
> what was my problem and how i solved it for me:
>
> I wrote about that the 'q' option in the module
> 'Bio::Tools::Run::Alignment::StandAloneFasta' is not functioning. I
> found out important thing. When 'ssearch' is used from terminal with -O
> (for the output) then there is always output and on the terminal. The only
> way to avoid that is to use '>' to direct to output to a file. So i went
> back to the module and modified it a bit :) Now i can give to the module
> the 'O' option as usual with my output file plus the 'q' option and i
> dont get output on the terminal.

There was a bug in fasta34 here which I asked Bill Pearson about
back in May 2008, you can check this on the FASTA mailing list if
you are a subscriber.
https://list.mail.virginia.edu/mailman/listinfo/fasta_list

I was finding even when -O was used, some important information
was still going to stdout. Bill said that the -O support was left over
from when fasta could only do one sequence search at a time. I
don't know if it has been addressed yet, but certainly fasta35 and
fasta36 still put a lot of output on stdout even with the -O option.

I therefore followed his advice and never use -O at all, and instead
always capture stdout.

Peter

From Frederic.SAPET at biogemma.com  Fri Apr 23 11:16:55 2010
From: Frederic.SAPET at biogemma.com (Frederic.SAPET at biogemma.com)
Date: Fri, 23 Apr 2010 17:16:55 +0200
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast has)
	in Bio::Search::Tiling::MapTiling
Message-ID: <OF80F707D9.56E5DF4E-ONC125770E.0051B473-C125770E.00540EA8@LGLimagrain.com>

Hello

Based on bp_search2gff.pl script and Bio::Search::Tiling::MapTiling 
documentation (http://www.bioperl.org/wiki/HOWTO:Tiling), I'm trying to 
write a generic blast to gff3 parser.

My idea is to filter hits on frac_aligned and percent_identity values.

I'm facing a problem with a BlastX result and the corresponding TBlastN.

Please find my script and the two example files attached.

The example is a piece of Maize Chromosome where a protein seems to be 
duplicated.

When I launch the parsing of BlastX file and I want to retrieve data from 
a Query View ( >tiling.pl BlastX query), I have :

Chr6:159690000-159718000        BLASTX  match_set       23971   25620 
121.6   +       . 
ID=Os03g17980.2:1.1.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
Chr6:159690000-159718000        BLASTX  match_part      23971   24186 331  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
Chr6:159690000-159718000        BLASTX  match_part      24820   24915 100  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
Chr6:159690000-159718000        BLASTX  match_part      25195   25308   89 
     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
Chr6:159690000-159718000        BLASTX  match_part      25390   25620 192  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472

Chr6:159690000-159718000        BLASTX  match_set       918     2567 121.6 
  +       . 
ID=Os03g17980.2:1.2.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
Chr6:159690000-159718000        BLASTX  match_part      918     1148 192  
-       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 395 472
Chr6:159690000-159718000        BLASTX  match_part      1230    1343    89 
     -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 358 395
Chr6:159690000-159718000        BLASTX  match_part      1623    1718 100  
-       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 291 322
Chr6:159690000-159718000        BLASTX  match_part      2352    2567 331  
-       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 120 191

this is perfect, I retrieve two nice hits, with perfectly tiled HSP.

But, with the TBlastN report (using a Hit View :  >tiling.pl TBlastN hit), 
I have :
Chr6:159690000-159718000        TBLASTN match_set       7666    25620 
121.6   +       . 
ID=Os03g17980.2:1.1.1;alignLength=303;eValue=4.9e-137;fractionAligned=98.8212180746562;gapNumber=18;Name=Os03g17980.2;percentageIdentity=66.0052390307793
Chr6:159690000-159718000        TBLASTN match_part      7666    7917    44 
     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 332 416
Chr6:159690000-159718000        TBLASTN match_part      23971   24186 331  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
Chr6:159690000-159718000        TBLASTN match_part      24820   24915 100  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
Chr6:159690000-159718000        TBLASTN match_part      25195   25308   89 
     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
Chr6:159690000-159718000        TBLASTN match_part      25390   25620 192  
  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472

I lose one of my hit, because another HSP is tiled to my hit, so I trash 
it when I filter the context using identitie values (line 42 to 54 of my 
script).
This HSP is far away in 5', so I would like to know if it could be 
possible to add (or help me to develop this) a sort of 
hspsepQmax/hspsepSmax (maximum allowed separation along the query(or 
subject) sequence between two HSPs ) as a new parameter during the tiling 
phase ?



Thank you.

Fred


-------------- next part --------------
A non-text attachment was scrubbed...
Name: BlastX
Type: application/octet-stream
Size: 12781 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100423/02c50e8e/attachment-0003.obj>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: TBlastN
Type: application/octet-stream
Size: 11308 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100423/02c50e8e/attachment-0004.obj>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: tiling.pl
Type: application/octet-stream
Size: 6152 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100423/02c50e8e/attachment-0005.obj>

From rmb32 at cornell.edu  Fri Apr 23 20:14:24 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Fri, 23 Apr 2010 17:14:24 -0700
Subject: [Bioperl-l] Seeking to Contribute
In-Reply-To: <y2j56128e5e1004221924x3ac4521bnc0c08a78e6c00b42@mail.gmail.com>
References: <y2j56128e5e1004221924x3ac4521bnc0c08a78e6c00b42@mail.gmail.com>
Message-ID: <4BD237E0.3080109@cornell.edu>

Hi Ifty,

Great to hear it!  A great place to start would be the BioPerl bugzilla:
http://bugzilla.open-bio.org/buglist.cgi?product=Bioperl&bug_status=NEW&bug_status=ASSIGNED&bug_status=REOPENED

Grab a bug, mail us if you have questions about it, and submit a patch 
to this list, and we'll apply it.  After a while, if we see that you're 
doing good work, you get a commit bit.  Simple as that!

Rob


Iftekharul Haque wrote:
> Hi All,
> 
> I'm a Perl developer of 4 years now, and I wanted to contribute to the
> BioPerl project.
> 
> I'm trying to apply to medical school (attempting a career shift from
> a developer), and I'd like some technical volunteer work under my
> belt. Clinically-related "research" is good, but I figured this is the
> best place where my existing skills can contribute most, indirect
> though it may be.
> 
> I've been following the e-mails for a month or so now, and I tried
> Google'ing around for some place where you can "pick up" projects or a
> to-do list of sorts, or help in code-cleanups or the like, and I found
> one, except most of them were crossed out, and completed by Chris
> Fields. :-)
> 
> I was wondering if there were any modules I could pick up, help
> refactor, add features to, and basically ship some good, clean code.
> 
> I'm experienced in working in a Linux environment, and with the CPAN.
> I haven't worked extensively with Moose, but I think this might be a
> good opportunity to learn!
> 
> Regards,
> Ifty.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 


From iftekharul.haque at gmail.com  Sat Apr 24 05:25:42 2010
From: iftekharul.haque at gmail.com (Iftekharul Haque)
Date: Sat, 24 Apr 2010 17:25:42 +0800
Subject: [Bioperl-l] Bug # 2908: ecoli.nt not available
Message-ID: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com>

Hi All,

Thinking I'll start small, just to get the hang of how this works.

First, an administrative question: most of the discussions on the bug
tracker look very brief and to the point. I imagine all initial
discussion first happens on the mailing list, and then comments are
put on the tracker, to reduce "noise"?

Second: I've looked at bug # 2908
http://bugzilla.open-bio.org/show_bug.cgi?id=2908 (ecoli.nt not
available from ftp://ncbi.nlm.nih.gov, causes
t/Tools/Run/StandaloneBlast.t to fail)

Looks like ecoli.nt is no longer on the NCBI ftp server. This can be
adjusted to point to another file, and then the tests adjusted to
expect the correct results, but this bug would have to be reopened
when that other file disappears as well, which is conceivable.

Wondering aloud here: would it make sense to include a compressed
reference file to test against rather than depend on a changing
source? Then this problem could be solved once and for all.

Regards,
Ifty.

From iftekharul.haque at gmail.com  Sat Apr 24 05:29:51 2010
From: iftekharul.haque at gmail.com (Iftekharul Haque)
Date: Sat, 24 Apr 2010 17:29:51 +0800
Subject: [Bioperl-l] Seeking to Contribute
In-Reply-To: <4BD237E0.3080109@cornell.edu>
References: <y2j56128e5e1004221924x3ac4521bnc0c08a78e6c00b42@mail.gmail.com> 
	<4BD237E0.3080109@cornell.edu>
Message-ID: <m2t56128e5e1004240229p1330544bz171d2cfbfda847ef@mail.gmail.com>

Hi Rob,

Thanks very much!

Regards,
Ifty.

On Sat, Apr 24, 2010 at 8:14 AM, Robert Buels <rmb32 at cornell.edu> wrote:
> Hi Ifty,
>
> Great to hear it! ?A great place to start would be the BioPerl bugzilla:
> http://bugzilla.open-bio.org/buglist.cgi?product=Bioperl&bug_status=NEW&bug_status=ASSIGNED&bug_status=REOPENED
>
> Grab a bug, mail us if you have questions about it, and submit a patch to
> this list, and we'll apply it. ?After a while, if we see that you're doing
> good work, you get a commit bit. ?Simple as that!
>
> Rob
>
>
> Iftekharul Haque wrote:
>>
>> Hi All,
>>
>> I'm a Perl developer of 4 years now, and I wanted to contribute to the
>> BioPerl project.
>>
>> I'm trying to apply to medical school (attempting a career shift from
>> a developer), and I'd like some technical volunteer work under my
>> belt. Clinically-related "research" is good, but I figured this is the
>> best place where my existing skills can contribute most, indirect
>> though it may be.
>>
>> I've been following the e-mails for a month or so now, and I tried
>> Google'ing around for some place where you can "pick up" projects or a
>> to-do list of sorts, or help in code-cleanups or the like, and I found
>> one, except most of them were crossed out, and completed by Chris
>> Fields. :-)
>>
>> I was wondering if there were any modules I could pick up, help
>> refactor, add features to, and basically ship some good, clean code.
>>
>> I'm experienced in working in a Linux environment, and with the CPAN.
>> I haven't worked extensively with Moose, but I think this might be a
>> good opportunity to learn!
>>
>> Regards,
>> Ifty.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>


From maj at fortinbras.us  Sat Apr 24 17:52:06 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Sat, 24 Apr 2010 17:52:06 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
Message-ID: <3332A139F12A45FB882D9FCC1E73FD76@NewLife>

There's a wiki page for discussing this topic now at 
http://www.bioperl.org/wiki/From_SVN_to_Git; I put a couple of interesting 
tutorial links etc up there. Please add stuff.
MAJ
----- Original Message ----- 
From: "Chris Fields" <cjfields1 at gmail.com>
To: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Saturday, April 17, 2010 12:18 PM
Subject: [Bioperl-l] Possible migration to git/github


> All,
>
> I wanted to get the BioPerl community's general input on a possible Subversion 
> to git/github migration for the BioPerl repository.  The plans haven't been 
> finalized in any way.  We haven't decided, for instance, on whether to make 
> github the main site, a read-only mirror, or a downstream mirror for 
> forking/pulling code from the community (with a central upstream dev repo for 
> releases).  As a preliminary run I will be pushing a test run to github of 
> bioperl-live (all tags/branches) this weekend.
>
> Thoughts have been circulating among the core developers for some time about a 
> migration at some point, however recent problems with anon access to code has 
> made this a more pressing issue.  The overall impression I am getting from the 
> community at large is a move would be a positive thing and would swing the 
> doors wide open for users to contribute much more easily (via forking).
>
> Therefore, I would like to outline the positive/negative aspects of a move to 
> git/github, and a proposed path to migration if one should occur.  Remember, 
> this is a project with 15+ years of code that has already undergone a recent 
> migration from CVS->SVN.  Retaining history and branches/tags for all bioperl 
> projects is key.  We also need to think logistically about other issues 
> particularly with github (number of collaborators allowed per account, mapping 
> authors, etc etc).
>
> Personally, I think we should be moving forward with this as soon as possible, 
> but I personally like git/github so I'm a bit biased.  The recently-added 
> support for in-line code review comments and SVN support has particularly 
> swayed me:
>
> http://github.com/blog/626-announcing-svn-support
> http://github.com/blog/622-inline-commit-notes
>
> Thoughts?  Comments?  Flames?  Suggestions?
>
> chris
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> 


From cjfields1 at gmail.com  Sat Apr 24 18:04:35 2010
From: cjfields1 at gmail.com (Christopher Fields)
Date: Sat, 24 Apr 2010 17:04:35 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <3332A139F12A45FB882D9FCC1E73FD76@NewLife>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<3332A139F12A45FB882D9FCC1E73FD76@NewLife>
Message-ID: <7DAB5C80-6643-4742-AE9B-64C351D53EC8@gmail.com>

Basically it's a done deal.  Working on some logistical bits that Jonathan Leto linked to recently (been busy here, so a bit behind on that).

chris

On Apr 24, 2010, at 4:52 PM, Mark A. Jensen wrote:

> There's a wiki page for discussing this topic now at http://www.bioperl.org/wiki/From_SVN_to_Git; I put a couple of interesting tutorial links etc up there. Please add stuff.
> MAJ
> ----- Original Message ----- From: "Chris Fields" <cjfields1 at gmail.com>
> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Saturday, April 17, 2010 12:18 PM
> Subject: [Bioperl-l] Possible migration to git/github
> 
> 
>> All,
>> 
>> I wanted to get the BioPerl community's general input on a possible Subversion to git/github migration for the BioPerl repository.  The plans haven't been finalized in any way.  We haven't decided, for instance, on whether to make github the main site, a read-only mirror, or a downstream mirror for forking/pulling code from the community (with a central upstream dev repo for releases).  As a preliminary run I will be pushing a test run to github of bioperl-live (all tags/branches) this weekend.
>> 
>> Thoughts have been circulating among the core developers for some time about a migration at some point, however recent problems with anon access to code has made this a more pressing issue.  The overall impression I am getting from the community at large is a move would be a positive thing and would swing the doors wide open for users to contribute much more easily (via forking).
>> 
>> Therefore, I would like to outline the positive/negative aspects of a move to git/github, and a proposed path to migration if one should occur.  Remember, this is a project with 15+ years of code that has already undergone a recent migration from CVS->SVN.  Retaining history and branches/tags for all bioperl projects is key.  We also need to think logistically about other issues particularly with github (number of collaborators allowed per account, mapping authors, etc etc).
>> 
>> Personally, I think we should be moving forward with this as soon as possible, but I personally like git/github so I'm a bit biased.  The recently-added support for in-line code review comments and SVN support has particularly swayed me:
>> 
>> http://github.com/blog/626-announcing-svn-support
>> http://github.com/blog/622-inline-commit-notes
>> 
>> Thoughts?  Comments?  Flames?  Suggestions?
>> 
>> chris
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From maj at fortinbras.us  Sat Apr 24 21:43:13 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Sat, 24 Apr 2010 21:43:13 -0400
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <7DAB5C80-6643-4742-AE9B-64C351D53EC8@gmail.com>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<3332A139F12A45FB882D9FCC1E73FD76@NewLife>
	<7DAB5C80-6643-4742-AE9B-64C351D53EC8@gmail.com>
Message-ID: <C59EFDBD253B4B7C9AB68D2A76E767FB@NewLife>

Still, there are links for those unfamiliar with git, and a model of development 
that might be worth talking about. MAJ
----- Original Message ----- 
From: "Christopher Fields" <cjfields1 at gmail.com>
To: "Mark A. Jensen" <maj at fortinbras.us>
Cc: "BioPerl List" <bioperl-l at lists.open-bio.org>
Sent: Saturday, April 24, 2010 6:04 PM
Subject: Re: [Bioperl-l] Possible migration to git/github


Basically it's a done deal.  Working on some logistical bits that Jonathan Leto 
linked to recently (been busy here, so a bit behind on that).

chris

On Apr 24, 2010, at 4:52 PM, Mark A. Jensen wrote:

> There's a wiki page for discussing this topic now at 
> http://www.bioperl.org/wiki/From_SVN_to_Git; I put a couple of interesting 
> tutorial links etc up there. Please add stuff.
> MAJ
> ----- Original Message ----- From: "Chris Fields" <cjfields1 at gmail.com>
> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Saturday, April 17, 2010 12:18 PM
> Subject: [Bioperl-l] Possible migration to git/github
>
>
>> All,
>>
>> I wanted to get the BioPerl community's general input on a possible 
>> Subversion to git/github migration for the BioPerl repository.  The plans 
>> haven't been finalized in any way.  We haven't decided, for instance, on 
>> whether to make github the main site, a read-only mirror, or a downstream 
>> mirror for forking/pulling code from the community (with a central upstream 
>> dev repo for releases).  As a preliminary run I will be pushing a test run to 
>> github of bioperl-live (all tags/branches) this weekend.
>>
>> Thoughts have been circulating among the core developers for some time about 
>> a migration at some point, however recent problems with anon access to code 
>> has made this a more pressing issue.  The overall impression I am getting 
>> from the community at large is a move would be a positive thing and would 
>> swing the doors wide open for users to contribute much more easily (via 
>> forking).
>>
>> Therefore, I would like to outline the positive/negative aspects of a move to 
>> git/github, and a proposed path to migration if one should occur.  Remember, 
>> this is a project with 15+ years of code that has already undergone a recent 
>> migration from CVS->SVN.  Retaining history and branches/tags for all bioperl 
>> projects is key.  We also need to think logistically about other issues 
>> particularly with github (number of collaborators allowed per account, 
>> mapping authors, etc etc).
>>
>> Personally, I think we should be moving forward with this as soon as 
>> possible, but I personally like git/github so I'm a bit biased.  The 
>> recently-added support for in-line code review comments and SVN support has 
>> particularly swayed me:
>>
>> http://github.com/blog/626-announcing-svn-support
>> http://github.com/blog/622-inline-commit-notes
>>
>> Thoughts?  Comments?  Flames?  Suggestions?
>>
>> chris
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




From cjfields1 at gmail.com  Sun Apr 25 00:57:59 2010
From: cjfields1 at gmail.com (Christopher Fields)
Date: Sat, 24 Apr 2010 23:57:59 -0500
Subject: [Bioperl-l] Possible migration to git/github
In-Reply-To: <C59EFDBD253B4B7C9AB68D2A76E767FB@NewLife>
References: <74030598-5D17-4752-8323-EE69E2C31EE6@illinois.edu>
	<3332A139F12A45FB882D9FCC1E73FD76@NewLife>
	<7DAB5C80-6643-4742-AE9B-64C351D53EC8@gmail.com>
	<C59EFDBD253B4B7C9AB68D2A76E767FB@NewLife>
Message-ID: <DD265DEF-B06E-4F04-9C14-675B899BE35E@gmail.com>

Oh, I didn't want to imply I in disagreement with the content of that page or that it needs further discussion.  Just that the responses I've heard have been largely in the affirmative.  The links (first one in particular on dev model) are good points of discussion

chris

On Apr 24, 2010, at 8:43 PM, Mark A. Jensen wrote:

> Still, there are links for those unfamiliar with git, and a model of development that might be worth talking about. MAJ
> ----- Original Message ----- From: "Christopher Fields" <cjfields1 at gmail.com>
> To: "Mark A. Jensen" <maj at fortinbras.us>
> Cc: "BioPerl List" <bioperl-l at lists.open-bio.org>
> Sent: Saturday, April 24, 2010 6:04 PM
> Subject: Re: [Bioperl-l] Possible migration to git/github
> 
> 
> Basically it's a done deal.  Working on some logistical bits that Jonathan Leto linked to recently (been busy here, so a bit behind on that).
> 
> chris
> 
> On Apr 24, 2010, at 4:52 PM, Mark A. Jensen wrote:
> 
>> There's a wiki page for discussing this topic now at http://www.bioperl.org/wiki/From_SVN_to_Git; I put a couple of interesting tutorial links etc up there. Please add stuff.
>> MAJ
>> ----- Original Message ----- From: "Chris Fields" <cjfields1 at gmail.com>
>> To: "BioPerl List" <bioperl-l at lists.open-bio.org>
>> Sent: Saturday, April 17, 2010 12:18 PM
>> Subject: [Bioperl-l] Possible migration to git/github
>> 
>> 
>>> All,
>>> 
>>> I wanted to get the BioPerl community's general input on a possible Subversion to git/github migration for the BioPerl repository.  The plans haven't been finalized in any way.  We haven't decided, for instance, on whether to make github the main site, a read-only mirror, or a downstream mirror for forking/pulling code from the community (with a central upstream dev repo for releases).  As a preliminary run I will be pushing a test run to github of bioperl-live (all tags/branches) this weekend.
>>> 
>>> Thoughts have been circulating among the core developers for some time about a migration at some point, however recent problems with anon access to code has made this a more pressing issue.  The overall impression I am getting from the community at large is a move would be a positive thing and would swing the doors wide open for users to contribute much more easily (via forking).
>>> 
>>> Therefore, I would like to outline the positive/negative aspects of a move to git/github, and a proposed path to migration if one should occur.  Remember, this is a project with 15+ years of code that has already undergone a recent migration from CVS->SVN.  Retaining history and branches/tags for all bioperl projects is key.  We also need to think logistically about other issues particularly with github (number of collaborators allowed per account, mapping authors, etc etc).
>>> 
>>> Personally, I think we should be moving forward with this as soon as possible, but I personally like git/github so I'm a bit biased.  The recently-added support for in-line code review comments and SVN support has particularly swayed me:
>>> 
>>> http://github.com/blog/626-announcing-svn-support
>>> http://github.com/blog/622-inline-commit-notes
>>> 
>>> Thoughts?  Comments?  Flames?  Suggestions?
>>> 
>>> chris
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Sun Apr 25 05:27:39 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sun, 25 Apr 2010 11:27:39 +0200
Subject: [Bioperl-l] Bug # 2908: ecoli.nt not available
In-Reply-To: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com>
References: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com>
Message-ID: <D1B699A6-B3FE-4977-9675-DE879520772E@sbc.su.se>


On Apr 24, 2010, at 11:25 AM, Iftekharul Haque wrote:

> Hi All,
> 
> Thinking I'll start small, just to get the hang of how this works.
> 
> First, an administrative question: most of the discussions on the bug
> tracker look very brief and to the point. I imagine all initial
> discussion first happens on the mailing list, and then comments are
> put on the tracker, to reduce "noise"?

I don't think there's a hard and fast rule on this. Often discussion starts on the list because that's where the bug is first reported.

In my opinion all of the critical information relevant to the bug should be on the bug report, and often some of that info is simply a link to the relevant mailing list thread.



> Second: I've looked at bug # 2908
> http://bugzilla.open-bio.org/show_bug.cgi?id=2908 (ecoli.nt not
> available from ftp://ncbi.nlm.nih.gov, causes
> t/Tools/Run/StandaloneBlast.t to fail)
[snip]
> Wondering aloud here: would it make sense to include a compressed
> reference file to test against rather than depend on a changing
> source? Then this problem could be solved once and for all.

Agreed.

Actually, we could make the database ourselves and have it contain only a handful of sequences. From my reading of the testfile, there's no need to use a downloaded database to test against here.


Dave



From cjfields at illinois.edu  Sun Apr 25 09:47:09 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 25 Apr 2010 08:47:09 -0500
Subject: [Bioperl-l] Bug # 2908: ecoli.nt not available
In-Reply-To: <D1B699A6-B3FE-4977-9675-DE879520772E@sbc.su.se>
References: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com>
	<D1B699A6-B3FE-4977-9675-DE879520772E@sbc.su.se>
Message-ID: <3CBE216D-2267-4762-A95C-6378FF8E7DC0@illinois.edu>


On Apr 25, 2010, at 4:27 AM, Dave Messina wrote:

> 
> On Apr 24, 2010, at 11:25 AM, Iftekharul Haque wrote:
> 
>> Hi All,
>> 
>> Thinking I'll start small, just to get the hang of how this works.
>> 
>> First, an administrative question: most of the discussions on the bug
>> tracker look very brief and to the point. I imagine all initial
>> discussion first happens on the mailing list, and then comments are
>> put on the tracker, to reduce "noise"?
> 
> I don't think there's a hard and fast rule on this. Often discussion starts on the list because that's where the bug is first reported.
> 
> In my opinion all of the critical information relevant to the bug should be on the bug report, and often some of that info is simply a link to the relevant mailing list thread.

Yes, and bug reports should be something 'closable'.  This (to me) means short and to the point.  Bug reports with a number of issues that need to be addressed should be broken into several reports, primarily b/c we can close each issue out as they are fixed, and if the bug needs to be reopened it doesn't require reopening a report containing other extraneous fixed bugs.

>> Second: I've looked at bug # 2908
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2908 (ecoli.nt not
>> available from ftp://ncbi.nlm.nih.gov, causes
>> t/Tools/Run/StandaloneBlast.t to fail)
> [snip]
>> Wondering aloud here: would it make sense to include a compressed
>> reference file to test against rather than depend on a changing
>> source? Then this problem could be solved once and for all.
> 
> Agreed.
> 
> Actually, we could make the database ourselves and have it contain only a handful of sequences. From my reading of the testfile, there's no need to use a downloaded database to test against here.
> 
> 
> Dave

How does this work cross-platform, cross-OS, 32 vs 64 bit, new vs old BLAST versions, etc?  That's my only concern with using a single database.

I don't think there is an issue, just can't recall.

chris





From iftekharul.haque at gmail.com  Sun Apr 25 10:44:49 2010
From: iftekharul.haque at gmail.com (Iftekharul Haque)
Date: Sun, 25 Apr 2010 22:44:49 +0800
Subject: [Bioperl-l] Bug # 2908: ecoli.nt not available
In-Reply-To: <3CBE216D-2267-4762-A95C-6378FF8E7DC0@illinois.edu>
References: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com> 
	<D1B699A6-B3FE-4977-9675-DE879520772E@sbc.su.se>
	<3CBE216D-2267-4762-A95C-6378FF8E7DC0@illinois.edu>
Message-ID: <n2z56128e5e1004250744i71b456cfoc31cc3a6ba2c0442@mail.gmail.com>

On Sun, Apr 25, 2010 at 9:47 PM, Chris Fields <cjfields at illinois.edu> wrote:
[snip]
>>> Second: I've looked at bug # 2908
>>> http://bugzilla.open-bio.org/show_bug.cgi?id=2908 (ecoli.nt not
>>> available from ftp://ncbi.nlm.nih.gov, causes
>>> t/Tools/Run/StandaloneBlast.t to fail)
>> [snip]
>>> Wondering aloud here: would it make sense to include a compressed
>>> reference file to test against rather than depend on a changing
>>> source? Then this problem could be solved once and for all.
>>
>> Agreed.
>>
>> Actually, we could make the database ourselves and have it contain only a handful of sequences. From my reading of the testfile, there's no need to use a downloaded database to test against here.

Hi Dave,

If we were to include a database ourselves, where would it reside? And
I imagine you use the word "database" fairly loosely, as in, it could
be just a flat text file?

I was thinking if other tools need reference sequences to run tests as
well, if we had a standing set of sequences to test tools against, you
wouldn't have to add too many sequence files with the distribution
(helping control download file size).

With the cornucopia of conversion tools, I imagine a test for any tool
that uses a specific format could easily be coded for in the test
itself (rather than having to include another reference sequence file
for that tool).

I'm not too familiar with the existing corpus of work to tell if this
would be a need looking forward, though.

>>
>>
>> Dave
>
> How does this work cross-platform, cross-OS, 32 vs 64 bit, new vs old BLAST versions, etc? ?That's my only concern with using a single database.

Hi Chris,

Do you mean how multi-platform IO would occur with this single database?

Regards,
Ifty.

>
> I don't think there is an issue, just can't recall.
>
> chris
>
>
>
>


From David.Messina at sbc.su.se  Sun Apr 25 15:59:58 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sun, 25 Apr 2010 21:59:58 +0200
Subject: [Bioperl-l] Bug # 2908: ecoli.nt not available
In-Reply-To: <3CBE216D-2267-4762-A95C-6378FF8E7DC0@illinois.edu>
References: <w2y56128e5e1004240225r49a72b77od958a8bb6c5b8393@mail.gmail.com>
	<D1B699A6-B3FE-4977-9675-DE879520772E@sbc.su.se>
	<3CBE216D-2267-4762-A95C-6378FF8E7DC0@illinois.edu>
Message-ID: <59D09F7C-9593-48B3-8FB8-88567E9D57A5@sbc.su.se>


On Apr 25, 2010, at 3:47 PM, Chris Fields wrote:
> How does this work cross-platform, cross-OS, 32 vs 64 bit, new vs old BLAST versions, etc?  That's my only concern with using a single database.

Good point; I hadn't thought about that. I assumed that since NCBI offers downloadable databases, the BLAST db binary format was "universal" ? network byte order etc.

> I don't think there is an issue, just can't recall.

I don't know for sure, either. And I don't know whether, with the switch from old-style BLAST to BLAST+ if there's a db format change. One option for us would be to start with a FASTA file of sequences and have our test code build the necessary test dbs using locally installed formatdb if present and skip otherwise.


On Apr 25, 2010, at 4:44 PM, Iftekharul Haque wrote:
> If we were to include a database ourselves, where would it reside?

In t/data/


> I imagine you use the word "database" fairly loosely, as in, it could
> be just a flat text file?

If I read the test correctly, the database needed for some of the StandAloneBlast.t tests was a BLAST database, which is a special binary format and not a flat text file.

Now, the bug report was about the ecoli.nt FASTA flatfile being missing. I'll admit I'm a little confused about that, because I didn't see anywhere in StandAloneBlast.t that said how ecoli.nt was downloaded and how it was formatdb'd into a BLAST database.

The tests seem to be assuming those steps have already been done. Which I can't imagine they very often would have been, so probably these tests have been almost always skipped (as Chris' comment on the bug report suggests).

Arguably the more important part of the bugfix would be fixing the testing structure such that test 43 doesn't fail due to the absence of output from the skipped tests; presumably it should be skipped too.

That is, if that failure is even still happening. I just ran it and all tests are passed or skipped. (But I don't have blastall installed on this machine, so the SKIP is triggered in a wider scope for me).



> I was thinking if other tools need reference sequences to run tests as
> well, if we had a standing set of sequences to test tools against, you
> wouldn't have to add too many sequence files with the distribution
> (helping control download file size).

We sort of have this in the form of the t/data directory. Undoubtedly there's some redundancy and cruft in there that's built up a little over the years, but as far as I know it hasn't been too much of a problem.

One thing that we could do to impose a little more order on that dir is to put the files in t/data in subdirectories to match the existing hierarchy of modules in Bio/ (as the t/ directory of tests itself does for the most part).

But since we'll be likely splitting out tests and testfiles in the relatively near future as part of the overall decentralization of BioPerl into smaller independent distributions, it may not be worth the time.


Dave

From asidhu at biomap.org  Mon Apr 26 02:26:22 2010
From: asidhu at biomap.org (Amandeep Sidhu)
Date: Mon, 26 Apr 2010 14:26:22 +0800
Subject: [Bioperl-l] CFP: 23rd IEEE International Symposium on
	Computer-Based Medical Systems 2010
Message-ID: <F25D460D-0DA5-4251-882F-F6E1B12548F0@biomap.org>

IEEE CBMS 2010
23rd IEEE International Symposium on Computer-Based Medical Systems 2010
Perth, Australia, 12-15 October 2010

http://www.cbms2010.curtin.edu.au/

The 23rd IEEE International Symposium on Computer-Based Medical Systems (CBMS 2010) is intended to provide an international forum for discussing the latest results in the field of computational medicine. The scientific program of CBMS 2010 will consist of invited keynote talks given by leading scientists in the field, and regular and special track sessions that cover a broad array of issues which relate computing to medicine.

RELEVANT TOPICS

Network and Telemedicine Systems
Medical Databases & Information Systems
Computer-Aided Diagnosis
Medical Devices with Embedded Computers
Bioinformatics in Medicine
Software Systems in Medicine
Pervasive Health Systems and Services
Web-based Delivery of Medical Information
Medical Image Segmentation & Compression
Content Analysis of Biomedical Image Data
Knowledge-Based & Decision Support Systems
Hand-held Computing Applications in Medicine
Knowledge Discovery & Data Mining
Signal and Image Processing in Medicine
Multimedia Biomedical Databases

CBMS 2010 invites original previously unpublished contributions that are not submitted concurrently to a journal or another conference. Many of the above listed topics are represented by corresponding Special Tracks, while others are solely covered by the general CBMS track. Prospective authors are expected to submit their contributions to one of the corresponding Special Tracks or to the general track if none of the special tracks is relevant.

SPECIAL TRACKS

ST1: Computational Proteomics and Genomics
ST2: Knowledge Discovery and Decision Systems in Biomedicine
ST3: Ontologies for Biomedical Systems
ST4: HealthGrid & Cloud Computing
ST5: Technology Enhanced Learning in Medical Education
ST6: Intelligent Patient Management
ST7: Data Streams in Healthcare
ST8: Supporting Collaboration among Healthcare Workers
ST9: Telemedicine
ST10: Computer-Based Systems for Mental Health
ST11: Image Informatics in Biomedical Research and Clinical Medicine
ST12: e-Health

SUBMISSION GUIDELINES

Papers should be submitted electronically using EasyChair online submission system. The papers must be prepared following the IEEE two-column format and should not exceed the length of 6 (six) Letter-sized pages. LaTeX or Microsoft Word templates can be used when preparing the papers. Please, note that only PDF format of submissions is allowed.

Submission web site: http://www.easychair.org/conferences/?conf=cbms2010

All submissions will be peer-reviewed by at least three reviewers. The proceedings will be published by the IEEE Computer Society Press. At least one of the authors of accepted papers is required to register and present the work at the conference; otherwise their papers will be removed from the digital library after the conference.

IMPORTANT DATES

Submission deadline for regular papers:        		24 June 2010
Deadline for tutorial submission:                       24 June 2010
Notification of acceptation for papers and tutorials:    2 Aug 2010
Final camera ready due:                                  2 Sep 2010
Author registration:                                     2 Sep 2010

INTENDED AUDIENCE

Engineers, scientists, clinicians and managers involved in medical computing projects are encouraged to submit papers to the symposium and/or attend the symposium. The symposium provides its attendees with an opportunity to experience state-of-the-art research and development in a variety of topics directly and indirectly related to their own work. In addition to research papers, keynote speakers and tutorial sessions it provides participants with an opportunity to come up-to-date on important technological issues. The symposium encourages the participation of students engaged in research/development in computer-based medical systems.

Organizing Committee

GENERAL CHAIRS

Tharam Dillon, Curtin University of Technology, Australia
Daniel Rubin, National Center for Biomedical Ontologies, USA
William Gallagher, University College Dublin, Ireland

PROGRAM CHAIRS

Amandeep Sidhu, Curtin University of Technology, Australia
Alexey Tsymbal, Siemens, Germany

PUBLICATION CHAIRS

Mykola Pechenizkiy, Eindhoven University of Technology, Netherlands
Tony Hu, Drexel University, USA

SPECIAL TRACK CHAIRS

Maja Hadzic, Curtin University of Technology, Australia
Jake Chen, Indiana University, USA

TUTORIAL CHAIRS

Phoebe Chen, La Trobe University, Australia
Xiaofang Zhou, University of Queensland, Australia

PUBLICITY CHAIRS

Carolyn McGregor, University of Ontario Institute of Technology, Canada
Meifania Chen, Curtin University of Technology, Australia

From maj at fortinbras.us  Mon Apr 26 07:54:04 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 26 Apr 2010 07:54:04 -0400
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast
	has)in Bio::Search::Tiling::MapTiling
In-Reply-To: <OF80F707D9.56E5DF4E-ONC125770E.0051B473-C125770E.00540EA8@LGLimagrain.com>
References: <OF80F707D9.56E5DF4E-ONC125770E.0051B473-C125770E.00540EA8@LGLimagrain.com>
Message-ID: <FE5CD7EE8B8F49889D6046B97D276CE0@NewLife>

Hi Fred-- I'll have a look at this- thanks MAJ
----- Original Message ----- 
From: <Frederic.SAPET at biogemma.com>
To: <bioperl-l at bioperl.org>
Sent: Friday, April 23, 2010 11:16 AM
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast has)in 
Bio::Search::Tiling::MapTiling


> Hello
>
> Based on bp_search2gff.pl script and Bio::Search::Tiling::MapTiling
> documentation (http://www.bioperl.org/wiki/HOWTO:Tiling), I'm trying to
> write a generic blast to gff3 parser.
>
> My idea is to filter hits on frac_aligned and percent_identity values.
>
> I'm facing a problem with a BlastX result and the corresponding TBlastN.
>
> Please find my script and the two example files attached.
>
> The example is a piece of Maize Chromosome where a protein seems to be
> duplicated.
>
> When I launch the parsing of BlastX file and I want to retrieve data from
> a Query View ( >tiling.pl BlastX query), I have :
>
> Chr6:159690000-159718000        BLASTX  match_set       23971   25620
> 121.6   +       .
> ID=Os03g17980.2:1.1.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
> Chr6:159690000-159718000        BLASTX  match_part      23971   24186 331
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> Chr6:159690000-159718000        BLASTX  match_part      24820   24915 100
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        BLASTX  match_part      25195   25308   89
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        BLASTX  match_part      25390   25620 192
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
>
> Chr6:159690000-159718000        BLASTX  match_set       918     2567 121.6
>  +       .
> ID=Os03g17980.2:1.2.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
> Chr6:159690000-159718000        BLASTX  match_part      918     1148 192
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 395 472
> Chr6:159690000-159718000        BLASTX  match_part      1230    1343    89
>     -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        BLASTX  match_part      1623    1718 100
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        BLASTX  match_part      2352    2567 331
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 120 191
>
> this is perfect, I retrieve two nice hits, with perfectly tiled HSP.
>
> But, with the TBlastN report (using a Hit View :  >tiling.pl TBlastN hit),
> I have :
> Chr6:159690000-159718000        TBLASTN match_set       7666    25620
> 121.6   +       .
> ID=Os03g17980.2:1.1.1;alignLength=303;eValue=4.9e-137;fractionAligned=98.8212180746562;gapNumber=18;Name=Os03g17980.2;percentageIdentity=66.0052390307793
> Chr6:159690000-159718000        TBLASTN match_part      7666    7917    44
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 332 416
> Chr6:159690000-159718000        TBLASTN match_part      23971   24186 331
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> Chr6:159690000-159718000        TBLASTN match_part      24820   24915 100
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        TBLASTN match_part      25195   25308   89
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        TBLASTN match_part      25390   25620 192
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
>
> I lose one of my hit, because another HSP is tiled to my hit, so I trash
> it when I filter the context using identitie values (line 42 to 54 of my
> script).
> This HSP is far away in 5', so I would like to know if it could be
> possible to add (or help me to develop this) a sort of
> hspsepQmax/hspsepSmax (maximum allowed separation along the query(or
> subject) sequence between two HSPs ) as a new parameter during the tiling
> phase ?
>
>
>
> Thank you.
>
> Fred
>
>
>


--------------------------------------------------------------------------------


> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l 


From maj at fortinbras.us  Mon Apr 26 09:17:51 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Mon, 26 Apr 2010 09:17:51 -0400
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast
	has)in Bio::Search::Tiling::MapTiling
In-Reply-To: <OF80F707D9.56E5DF4E-ONC125770E.0051B473-C125770E.00540EA8@LGLimagrain.com>
References: <OF80F707D9.56E5DF4E-ONC125770E.0051B473-C125770E.00540EA8@LGLimagrain.com>
Message-ID: <4EF812C0949F4FEA8AA188BEC2B6EFDC@NewLife>

Hi Fred,

I'll tell you how you can write a kludge; maybe you can expand it into
a more general method.

For your tblastn data, get the coverage map array

 @map = $tiling->coverage_map('hit', 'p0')

Each element of the map is a ref to a pair [$int, $hsp], where $int is
itself a reference to a two-elt array containing the coordinates of the
hsp in context and $hsp is the hsp object itself. You can use these to
filter the @map array.

For your example, you can just get rid of the first @map elt:

 shift @map;

Replace the internal map for this type and context, so that
the methods work on the modified map:

 $tiling->{'coverage_map_hit_p0'} = \@map;

Then $tiling->identities('hit', 'exact', 'p0'), etc. give you the
new values.

HTH-
MAJ
----- Original Message ----- 
From: <Frederic.SAPET at biogemma.com>
To: <bioperl-l at bioperl.org>
Sent: Friday, April 23, 2010 11:16 AM
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast has)in 
Bio::Search::Tiling::MapTiling


> Hello
>
> Based on bp_search2gff.pl script and Bio::Search::Tiling::MapTiling
> documentation (http://www.bioperl.org/wiki/HOWTO:Tiling), I'm trying to
> write a generic blast to gff3 parser.
>
> My idea is to filter hits on frac_aligned and percent_identity values.
>
> I'm facing a problem with a BlastX result and the corresponding TBlastN.
>
> Please find my script and the two example files attached.
>
> The example is a piece of Maize Chromosome where a protein seems to be
> duplicated.
>
> When I launch the parsing of BlastX file and I want to retrieve data from
> a Query View ( >tiling.pl BlastX query), I have :
>
> Chr6:159690000-159718000        BLASTX  match_set       23971   25620
> 121.6   +       .
> ID=Os03g17980.2:1.1.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
> Chr6:159690000-159718000        BLASTX  match_part      23971   24186 331
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> Chr6:159690000-159718000        BLASTX  match_part      24820   24915 100
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        BLASTX  match_part      25195   25308   89
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        BLASTX  match_part      25390   25620 192
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
>
> Chr6:159690000-159718000        BLASTX  match_set       918     2567 121.6
>  +       .
> ID=Os03g17980.2:1.2.1;alignLength=576;eValue=4.6e-137;fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;percentageIdentity=69.1552062868369
> Chr6:159690000-159718000        BLASTX  match_part      918     1148 192
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 395 472
> Chr6:159690000-159718000        BLASTX  match_part      1230    1343    89
>     -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        BLASTX  match_part      1623    1718 100
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        BLASTX  match_part      2352    2567 331
> -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 120 191
>
> this is perfect, I retrieve two nice hits, with perfectly tiled HSP.
>
> But, with the TBlastN report (using a Hit View :  >tiling.pl TBlastN hit),
> I have :
> Chr6:159690000-159718000        TBLASTN match_set       7666    25620
> 121.6   +       .
> ID=Os03g17980.2:1.1.1;alignLength=303;eValue=4.9e-137;fractionAligned=98.8212180746562;gapNumber=18;Name=Os03g17980.2;percentageIdentity=66.0052390307793
> Chr6:159690000-159718000        TBLASTN match_part      7666    7917    44
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 332 416
> Chr6:159690000-159718000        TBLASTN match_part      23971   24186 331
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> Chr6:159690000-159718000        TBLASTN match_part      24820   24915 100
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> Chr6:159690000-159718000        TBLASTN match_part      25195   25308   89
>     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 395
> Chr6:159690000-159718000        TBLASTN match_part      25390   25620 192
>  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
>
> I lose one of my hit, because another HSP is tiled to my hit, so I trash
> it when I filter the context using identitie values (line 42 to 54 of my
> script).
> This HSP is far away in 5', so I would like to know if it could be
> possible to add (or help me to develop this) a sort of
> hspsepQmax/hspsepSmax (maximum allowed separation along the query(or
> subject) sequence between two HSPs ) as a new parameter during the tiling
> phase ?
>
>
>
> Thank you.
>
> Fred
>
>
>


--------------------------------------------------------------------------------


> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l 


From cseligman at earthlink.net  Mon Apr 26 02:12:58 2010
From: cseligman at earthlink.net (Chet Seligman)
Date: Sun, 25 Apr 2010 23:12:58 -0700
Subject: [Bioperl-l] Bio::SeqIO question
Message-ID: <000301cae507$866f8df0$934ea9d0$@net>

Hi there. 
I'm a student and brand new to this.
I want to get a file (filename = protein.fa), which is a list of fasta
sequences, starting with:
>gi|255572219|ref|XP_002527049| retinoblastoma-binding protein, putative

Into a sequence object so I can BLAST the sequences
According to  perldoc Bio::Perl, I should be able to:
# reads an array of sequences
@seq_object_array = read_all_sequences($filename, 'fasta');

But I get an exception:

------------ EXCEPTION: Bio::Root::Exception -------------
MSG: Could not open >gi|255572219|ref|XP_002527049| retinoblastoma-binding
protein, putative
: Invalid argument
STACK: Error::throw
STACK: Bio::Root::Root::throw C:/Perl/site/lib/Bio/Root/Root.pm:368
STACK: Bio::Root::IO::_initialize_io C:/Perl/site/lib/Bio/Root/IO.pm:341
STACK: Bio::SeqIO::_initialize C:/Perl/site/lib/Bio/SeqIO.pm:467
STACK: Bio::SeqIO::fasta::_initialize C:/Perl/site/lib/Bio\SeqIO\fasta.pm:94
STACK: Bio::SeqIO::new C:/Perl/site/lib/Bio/SeqIO.pm:360
STACK: Bio::SeqIO::new C:/Perl/site/lib/Bio/SeqIO.pm:390


STACK: C:/Perl/site/lib/Bio/Perl.pm:

Here's my program snippet:
use strict;
my @seq_object_array = ();
my $blast_report = '';
use Bio::Perl;
use Bio::SeqIO;
use Bio::Tools::Run::RemoteBlast;
use Bio::SearchIO;
use Bio::SearchIO::Writer::HTMLResultWriter;
use Bio::AlignIO;
use Data::Dumper;
my $filename ='';
open (INFILE, "protein.fa");
$filename =<INFILE>;

#reads an array of sequences
@seq_object_array = read_all_sequences($filename, 'fasta');

So what should I do differently?
Thanks,
Chet

From rmb32 at cornell.edu  Mon Apr 26 18:02:11 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Mon, 26 Apr 2010 15:02:11 -0700
Subject: [Bioperl-l] Google Summer of Code - accepted students
Message-ID: <4BD60D63.1040400@cornell.edu>

Hi all,

I'm pleased to announce the acceptance of OBF's 2010 Google Summer of 
Code students, listed in alphabetical order with their project titles 
and primary mentors:

Mark Chapman (PM Andreas Prlic) - Improvements to BioJava including 
Implementation of Multiple Sequence Alignment Algorithms

Jianjiong Gao (PM Peter Rose) - BioJava Packages for Identification, 
Classification, and Visualization of Posttranslational Modification of 
Proteins

Kazuhiro Hayashi (PM Naohisa Goto) - Ruby 1.9.2 support of BioRuby

Sara Rayburn (PM Christian Zmasek) - Implementing Speciation & 
Duplication Inference Algorithm for Binary and Non-binary Species Tree

Joao Pedro Garcia Lopes Maia Rodrigues (PM Eric Talevich) - Extending 
Bio.PDB: broadening the usefulness of BioPython's Structural Biology module

Jun Yin (PM Chris Fields) - BioPerl Alignment Subsystem Refactoring

Congratulations to our accepted students!

All told, we had 52 applications submitted for the 6 slots (5 originally 
assigned, plus 1 extra) allotted to us by Google.  Proposals were 
extremely competitive: 6 out of 52 translates to an 11.5% acceptance 
rate.  We received a lot of really excellent proposals, the decisions 
were not easy.

Thanks very much to all the students who applied, we very much 
appreciate your hard work.

Here's to a great 2010 Summer of Code, I'm sure these students will do 
some wonderful work.

Rob Buels
OBF GSoC 2010 Administrator


From cjfields at illinois.edu  Mon Apr 26 18:20:24 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 26 Apr 2010 17:20:24 -0500
Subject: [Bioperl-l] Bio::SeqIO question
In-Reply-To: <000301cae507$866f8df0$934ea9d0$@net>
References: <000301cae507$866f8df0$934ea9d0$@net>
Message-ID: <4395B18E-82BF-4BFF-8F32-4E2FDAE06626@illinois.edu>


On Apr 26, 2010, at 1:12 AM, Chet Seligman wrote:

> Hi there. 
> I'm a student and brand new to this.
> I want to get a file (filename = protein.fa), which is a list of fasta
> sequences, starting with:
>> gi|255572219|ref|XP_002527049| retinoblastoma-binding protein, putative
> 
> Into a sequence object so I can BLAST the sequences
> According to  perldoc Bio::Perl, I should be able to:
> # reads an array of sequences
> @seq_object_array = read_all_sequences($filename, 'fasta');
> 
> But I get an exception:
> 
> ------------ EXCEPTION: Bio::Root::Exception -------------
> MSG: Could not open >gi|255572219|ref|XP_002527049| retinoblastoma-binding
> protein, putative
> : Invalid argument
> STACK: Error::throw
> STACK: Bio::Root::Root::throw C:/Perl/site/lib/Bio/Root/Root.pm:368
> STACK: Bio::Root::IO::_initialize_io C:/Perl/site/lib/Bio/Root/IO.pm:341
> STACK: Bio::SeqIO::_initialize C:/Perl/site/lib/Bio/SeqIO.pm:467
> STACK: Bio::SeqIO::fasta::_initialize C:/Perl/site/lib/Bio\SeqIO\fasta.pm:94
> STACK: Bio::SeqIO::new C:/Perl/site/lib/Bio/SeqIO.pm:360
> STACK: Bio::SeqIO::new C:/Perl/site/lib/Bio/SeqIO.pm:390
> 
> 
> STACK: C:/Perl/site/lib/Bio/Perl.pm:
> 
> Here's my program snippet:
> use strict;
> my @seq_object_array = ();
> my $blast_report = '';
> use Bio::Perl;
> use Bio::SeqIO;
> use Bio::Tools::Run::RemoteBlast;
> use Bio::SearchIO;
> use Bio::SearchIO::Writer::HTMLResultWriter;
> use Bio::AlignIO;
> use Data::Dumper;
> my $filename ='';
> open (INFILE, "protein.fa");
> $filename =<INFILE>;
> 
> #reads an array of sequences
> @seq_object_array = read_all_sequences($filename, 'fasta');
> 
> So what should I do differently?
> Thanks,
> Chet


Chet, 

You are passing in the first line of the file itself, via the readline off the filehandle here: '$filename =<INFILE>;'.  You just need to pass in the name of the file (aka the 'file name').  Do this:

@seq_object_array = read_all_sequences('protein.fa', 'fasta');

chris

From jay at jays.net  Mon Apr 26 19:52:18 2010
From: jay at jays.net (Jay Hannah)
Date: Mon, 26 Apr 2010 18:52:18 -0500
Subject: [Bioperl-l] wiki citations page broken: "Biblio" Mediawiki
	extension?
Message-ID: <ADCAEB79-34DD-4E34-8825-90CFC29B756C@jays.net>

It appears our citations page is broken:

   http://www.bioperl.org/wiki/BioPerl_publications

I assume this is the Mediawiki "Biblio" extension:

   http://openwetware.org/wiki/Wikiomics:Biblio#Installation

The wiki doesn't report what version we're running:

   http://www.bioperl.org/wiki/Special:Version

So I don't know if we're on old and broken software or the latest and greatest broken software or...   :)

Jay Hannah
http://biodoc.ist.unomaha.edu/wiki/User:Jhannah



From cseligman at earthlink.net  Mon Apr 26 20:56:01 2010
From: cseligman at earthlink.net (Chet Seligman)
Date: Mon, 26 Apr 2010 17:56:01 -0700
Subject: [Bioperl-l] Blasting multiple protein sequences.
Message-ID: <000001cae5a4$69c250a0$3d46f1e0$@net>

I am a student and new to BioPerl.
I have a fasta formatted file with 17 protein sequences in it and I would
like to blast them all.
My problem is that only the first one gets blasted.
Can anyone make a suggestion?
Thanks in advance - Chet
Here's my code:
#!/usr/bin/perl
use Bio::Perl;
use strict;

my $fastafilename = 'protein.fa';
# reads an array of sequences
my @seq_object_array = read_all_sequences($fastafilename,'fasta');
 
# BLAST a sequence (assumes an internet connection)

my  $blast_report = blast_sequence(@seq_object_array);

write_blast(">blast.out",$blast_report);
  
exit;  

From maizemu at gmail.com  Mon Apr 26 21:20:10 2010
From: maizemu at gmail.com (Christopher Bottoms)
Date: Mon, 26 Apr 2010 20:20:10 -0500
Subject: [Bioperl-l] Blasting multiple protein sequences.
In-Reply-To: <000001cae5a4$69c250a0$3d46f1e0$@net>
References: <000001cae5a4$69c250a0$3d46f1e0$@net>
Message-ID: <l2g755a9cd91004261820x77354cb6w37f4dcbf438e04db@mail.gmail.com>

The function blast_sequence only acts on a single sequence. You've passed it
an array of sequence objects. Try something more like the following. It's
not tested, but the principles should be correct, even if there is an error
or two:

my $fastafilename = 'protein.fa';

# reads an array of sequences
my @seq_object_array = read_all_sequences($fastafilename,'fasta');

#Number to allow outputting separate files for each sequence
my $report_number = 0;

#Iterate over each sequence object
for my $seq_object( @seq_object_array){

     #Get the blast report for this sequence object
     my $blast_report = blast_sequence($seq_object);

     #create a unique name for the output file (prepended with an '>')
     my $blast_out = '>blast_report_' . $report_number++ . '.out';

     #output the blast report
     write_blast($blast_out, $blast_report);
}

exit;


On Mon, Apr 26, 2010 at 7:56 PM, Chet Seligman <cseligman at earthlink.net>wrote:

> I am a student and new to BioPerl.
> I have a fasta formatted file with 17 protein sequences in it and I would
> like to blast them all.
> My problem is that only the first one gets blasted.
> Can anyone make a suggestion?
> Thanks in advance - Chet
> Here's my code:
> #!/usr/bin/perl
> use Bio::Perl;
> use strict;
>
> my $fastafilename = 'protein.fa';
> # reads an array of sequences
> my @seq_object_array = read_all_sequences($fastafilename,'fasta');
>
> # BLAST a sequence (assumes an internet connection)
>
> my  $blast_report = blast_sequence(@seq_object_array);
>
> write_blast(">blast.out",$blast_report);
>
> exit;
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From cseligman at earthlink.net  Mon Apr 26 22:04:07 2010
From: cseligman at earthlink.net (Chet Seligman)
Date: Mon, 26 Apr 2010 19:04:07 -0700
Subject: [Bioperl-l] Blasting multiple protein sequences.
In-Reply-To: <l2g755a9cd91004261820x77354cb6w37f4dcbf438e04db@mail.gmail.com>
References: <000001cae5a4$69c250a0$3d46f1e0$@net>
	<l2g755a9cd91004261820x77354cb6w37f4dcbf438e04db@mail.gmail.com>
Message-ID: <002501cae5ad$ec865550$c592fff0$@net>

Thanks Christopher.
Your model made no errors.
You make it look easy!

Chet

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Christopher
Bottoms
Sent: Monday, April 26, 2010 6:20 PM
To: Chet Seligman
Cc: bioperl-l at lists.open-bio.org
Subject: Re: [Bioperl-l] Blasting multiple protein sequences.

The function blast_sequence only acts on a single sequence. You've passed it
an array of sequence objects. Try something more like the following. It's
not tested, but the principles should be correct, even if there is an error
or two:

my $fastafilename = 'protein.fa';

# reads an array of sequences
my @seq_object_array = read_all_sequences($fastafilename,'fasta');

#Number to allow outputting separate files for each sequence
my $report_number = 0;

#Iterate over each sequence object
for my $seq_object( @seq_object_array){

     #Get the blast report for this sequence object
     my $blast_report = blast_sequence($seq_object);

     #create a unique name for the output file (prepended with an '>')
     my $blast_out = '>blast_report_' . $report_number++ . '.out';

     #output the blast report
     write_blast($blast_out, $blast_report);
}

exit;


On Mon, Apr 26, 2010 at 7:56 PM, Chet Seligman
<cseligman at earthlink.net>wrote:

> I am a student and new to BioPerl.
> I have a fasta formatted file with 17 protein sequences in it and I would
> like to blast them all.
> My problem is that only the first one gets blasted.
> Can anyone make a suggestion?
> Thanks in advance - Chet
> Here's my code:
> #!/usr/bin/perl
> use Bio::Perl;
> use strict;
>
> my $fastafilename = 'protein.fa';
> # reads an array of sequences
> my @seq_object_array = read_all_sequences($fastafilename,'fasta');
>
> # BLAST a sequence (assumes an internet connection)
>
> my  $blast_report = blast_sequence(@seq_object_array);
>
> write_blast(">blast.out",$blast_report);
>
> exit;
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


From rmb32 at cornell.edu  Tue Apr 27 01:52:57 2010
From: rmb32 at cornell.edu (Robert Buels)
Date: Mon, 26 Apr 2010 22:52:57 -0700
Subject: [Bioperl-l] Google Summer of Code - accepted students
Message-ID: <4BD67BB9.3000804@cornell.edu>

Hi all,

I'm pleased to announce the acceptance of OBF's 2010 Google Summer of
Code students, listed in alphabetical order with their project titles
and primary mentors:

Mark Chapman (PM Andreas Prlic) - Improvements to BioJava including
Implementation of Multiple Sequence Alignment Algorithms

Jianjiong Gao (PM Peter Rose) - BioJava Packages for Identification,
Classification, and Visualization of Posttranslational Modification of
Proteins

Kazuhiro Hayashi (PM Naohisa Goto) - Ruby 1.9.2 support of BioRuby

Sara Rayburn (PM Christian Zmasek) - Implementing Speciation &
Duplication Inference Algorithm for Binary and Non-binary Species Tree

Joao Pedro Garcia Lopes Maia Rodrigues (PM Eric Talevich) - Extending
Bio.PDB: broadening the usefulness of BioPython's Structural Biology module

Jun Yin (PM Chris Fields) - BioPerl Alignment Subsystem Refactoring

Congratulations to our accepted students!

All told, we had 52 applications submitted for the 6 slots (5 originally
assigned, plus 1 extra) allotted to us by Google.  Proposals were
extremely competitive: 6 out of 52 translates to an 11.5% acceptance
rate.  We received a lot of really excellent proposals, the decisions
were not easy.

Thanks very much to all the students who applied, we very much
appreciate your hard work.

Here's to a great 2010 Summer of Code, I'm sure these students will do
some wonderful work.

Rob Buels
OBF GSoC 2010 Administrator



From biopython at maubp.freeserve.co.uk  Tue Apr 27 05:40:09 2010
From: biopython at maubp.freeserve.co.uk (Peter)
Date: Tue, 27 Apr 2010 10:40:09 +0100
Subject: [Bioperl-l] wiki citations page broken: "Biblio" Mediawiki
	extension?
In-Reply-To: <ADCAEB79-34DD-4E34-8825-90CFC29B756C@jays.net>
References: <ADCAEB79-34DD-4E34-8825-90CFC29B756C@jays.net>
Message-ID: <h2k320fb6e01004270240hf7d42fdr1f95d6c00749d215@mail.gmail.com>

On Tue, Apr 27, 2010 at 12:52 AM, Jay Hannah <jay at jays.net> wrote:
> It appears our citations page is broken:
>
> ? http://www.bioperl.org/wiki/BioPerl_publications
>
> I assume this is the Mediawiki "Biblio" extension:
>
> ? http://openwetware.org/wiki/Wikiomics:Biblio#Installation
>
> The wiki doesn't report what version we're running:
>
> ? http://www.bioperl.org/wiki/Special:Version
>
> So I don't know if we're on old and broken software or the latest and greatest broken software or... ? :)
>
> Jay Hannah

It could be related to the recent email/tool changes in the Entrez
interface (assuming that's what the mediawiki extension uses
to get the PubMed data).

This also affects Biopython and BioJava e.g.
http://biopython.org/wiki/Publications
http://biojava.org/wiki/BioJava:BioJavaInside

Peter


From dimitark at bii.a-star.edu.sg  Wed Apr 28 09:17:47 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Wed, 28 Apr 2010 21:17:47 +0800
Subject: [Bioperl-l] about gene "boundaries"
Message-ID: <4BD8357B.5030804@bii.a-star.edu.sg>

Hello guys,
i have a question about gene "boundaries". Is there some module in 
BioPerl which can help me extract the DNA sequence from a genomic DB 
(from specific chromosome). I have my human genome in a local DB and 
some "from-to" data sets corresponding to different chromosomes. So i 
want to get the DNA seqs for these from-to's. I know i can do that the 
normal way but if there is a way to do it with BioPerl it will be more 
consistent with the rest of the code.

Thanks for any tips :)

Cheers
Dimitar

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From shalabh.sharma7 at gmail.com  Wed Apr 28 10:13:11 2010
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 28 Apr 2010 10:13:11 -0400
Subject: [Bioperl-l] out of memory issue
Message-ID: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>

Hi All,
       I am trying to make a hash of 38 Million ids but every time i get the
following message :

perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
*** error: can't allocate region
*** set a breakpoint in malloc_error_break to debug
Out of memory!

I am working on MacOX 10.5.8 with 4GB of memory.

I would really appreciate if anyone can help me out.

Thanks
Shalabh

From scott at scottcain.net  Wed Apr 28 10:19:27 2010
From: scott at scottcain.net (Scott Cain)
Date: Wed, 28 Apr 2010 10:19:27 -0400
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <4BD8357B.5030804@bii.a-star.edu.sg>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
Message-ID: <h2s4536f7701004280719u240a45f4i8a69a57e939b7c47@mail.gmail.com>

Hi Dimitar,

It would be easy if your local database is one that bioperl talks to:
Bio::DB::GFF, Bio::DB::SeqFeature::Store, and with slightly more work,
BioSQL or Chado.  If not, you'd have to write your own adaptor for
your database that would issue the queries and package the results up
as Bio::Seq or Bio::SeqFeature objects (whichever is appropriate for
your use).

Scott


On Wed, Apr 28, 2010 at 9:17 AM, Dimitar Kenanov
<dimitark at bii.a-star.edu.sg> wrote:
> Hello guys,
> i have a question about gene "boundaries". Is there some module in BioPerl
> which can help me extract the DNA sequence from a genomic DB (from specific
> chromosome). I have my human genome in a local DB and some "from-to" data
> sets corresponding to different chromosomes. So i want to get the DNA seqs
> for these from-to's. I know i can do that the normal way but if there is a
> way to do it with BioPerl it will be more consistent with the rest of the
> code.
>
> Thanks for any tips :)
>
> Cheers
> Dimitar
>
> --
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research

From hrh at fmi.ch  Wed Apr 28 10:13:37 2010
From: hrh at fmi.ch (Hans-Rudolf Hotz)
Date: Wed, 28 Apr 2010 16:13:37 +0200
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <4BD8357B.5030804@bii.a-star.edu.sg>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
Message-ID: <4BD84291.6060400@fmi.ch>



On 04/28/2010 03:17 PM, Dimitar Kenanov wrote:
> Hello guys,
> i have a question about gene "boundaries". Is there some module in
> BioPerl which can help me extract the DNA sequence from a genomic DB
> (from specific chromosome). I have my human genome in a local DB and
> some "from-to" data sets corresponding to different chromosomes. So i
> want to get the DNA seqs for these from-to's. I know i can do that the
> normal way but if there is a way to do it with BioPerl it will be more
> consistent with the rest of the code.


Dimitar

I don't know, what you call "the normal way"....although you apparently 
have the genome sequences locally already, I recommend to use the 
ensembl API to fetch genomic sequences (ie "from-to's").

see: http://www.ensembl.org/info/docs/api/core/core_tutorial.html

it is not BioPerl but a distant relative of it


Regards, Hans


> Thanks for any tips :)
>
> Cheers
> Dimitar
>

From cjfields at illinois.edu  Wed Apr 28 11:10:40 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 28 Apr 2010 10:10:40 -0500
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <4BD8357B.5030804@bii.a-star.edu.sg>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
Message-ID: <24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>

By local DB, do you mean a BioPerl-based local DB?  Or is it something else?  This is a bit vague.

On the BioPerl side I suggest looking into Bio::DB::SeqFeature::Store for storing and querying genome information (it does exactly what you want if the proper information is loaded), or maybe the Ensembl Perl API, which can be used with a local or remote Ensembl setup.  Beyond that you'll need to be more specific.

chris

On Apr 28, 2010, at 8:17 AM, Dimitar Kenanov wrote:

> Hello guys,
> i have a question about gene "boundaries". Is there some module in BioPerl which can help me extract the DNA sequence from a genomic DB (from specific chromosome). I have my human genome in a local DB and some "from-to" data sets corresponding to different chromosomes. So i want to get the DNA seqs for these from-to's. I know i can do that the normal way but if there is a way to do it with BioPerl it will be more consistent with the rest of the code.
> 
> Thanks for any tips :)
> 
> Cheers
> Dimitar
> 
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From David.Messina at sbc.su.se  Wed Apr 28 11:23:56 2010
From: David.Messina at sbc.su.se (Dave Messina)
Date: Wed, 28 Apr 2010 17:23:56 +0200
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
Message-ID: <CC51F648-3267-4BA3-AEF5-49413932113C@sbc.su.se>

Hi Shalabh,

The problem is quite clear, that you're running out of memory, so you need to find out why.

A lot depends on how big your IDs are and the associated values you're storing. And Perl also has some overhead of its own that might taking a lot more space than expected.

Try installing the Devel::Size module and using its total_size function.

Look at how many bytes a hash of, say 10,000 or 100,000 of your records instead of all 38 million.

something like

#!/usr/bin/perl
use Devel::Size qw(total_size);

my %hash;
print "Empty: ", total_size (\%hash), " bytes\n";

# fill %hash here

print "Full: ", total_size (\%hash), " bytes\n";




Dave



From maj at fortinbras.us  Wed Apr 28 11:30:12 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Wed, 28 Apr 2010 11:30:12 -0400
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
Message-ID: <882315339A8C4C389E84C23136EAB91B@NewLife>

could try a tied hash to an on-disk db
see
perldoc perltie

----- Original Message ----- 
From: "shalabh sharma" <shalabh.sharma7 at gmail.com>
To: "bioperl-l" <Bioperl-l at lists.open-bio.org>
Sent: Wednesday, April 28, 2010 10:13 AM
Subject: [Bioperl-l] out of memory issue


> Hi All,
>       I am trying to make a hash of 38 Million ids but every time i get the
> following message :
> 
> perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
> *** error: can't allocate region
> *** set a breakpoint in malloc_error_break to debug
> Out of memory!
> 
> I am working on MacOX 10.5.8 with 4GB of memory.
> 
> I would really appreciate if anyone can help me out.
> 
> Thanks
> Shalabh
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
>

From ak at ebi.ac.uk  Wed Apr 28 11:49:50 2010
From: ak at ebi.ac.uk (Andreas Kahari)
Date: Wed, 28 Apr 2010 16:49:50 +0100
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
Message-ID: <20100428154949.GG12150@quux.windows.ebi.ac.uk>

On Wed, Apr 28, 2010 at 10:13:11AM -0400, shalabh sharma wrote:
> Hi All,
>        I am trying to make a hash of 38 Million ids but every time i get the
> following message :

Why would you want to do that?  What is the application and would you
be able to solve it by either re-ordering the things you doing or doing
things in batches?


Andreas

> 
> perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
> *** error: can't allocate region
> *** set a breakpoint in malloc_error_break to debug
> Out of memory!
> 
> I am working on MacOX 10.5.8 with 4GB of memory.
> 
> I would really appreciate if anyone can help me out.
> 
> Thanks
> Shalabh
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

-- 
Andreas K?h?ri, Ensembl Software Developer
European Bioinformatics Institute (EMBL-EBI)
Wellcome Trust Genome Campus, Hinxton
Cambridge CB10 1SD, United Kingdom

From shalabh.sharma7 at gmail.com  Wed Apr 28 11:55:55 2010
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 28 Apr 2010 11:55:55 -0400
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <20100428154949.GG12150@quux.windows.ebi.ac.uk>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
	<20100428154949.GG12150@quux.windows.ebi.ac.uk>
Message-ID: <r2w9fcc48c71004280855v3000f548p9751f59a1dce1431@mail.gmail.com>

Hi,
@ Andreas: Actually that is kind of search thing, i am making that hash so i
can search values out of it.
I will try to look what Dave and Mark has suggested , if it doesn't work
then i will use some other alternative like batches.

Thanks
Shalabh


On Wed, Apr 28, 2010 at 11:49 AM, Andreas Kahari <ak at ebi.ac.uk> wrote:

> On Wed, Apr 28, 2010 at 10:13:11AM -0400, shalabh sharma wrote:
> > Hi All,
> >        I am trying to make a hash of 38 Million ids but every time i get
> the
> > following message :
>
> Why would you want to do that?  What is the application and would you
> be able to solve it by either re-ordering the things you doing or doing
> things in batches?
>
>
> Andreas
>
> >
> > perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
> > *** error: can't allocate region
> > *** set a breakpoint in malloc_error_break to debug
> > Out of memory!
> >
> > I am working on MacOX 10.5.8 with 4GB of memory.
> >
> > I would really appreciate if anyone can help me out.
> >
> > Thanks
> > Shalabh
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
> Andreas K?h?ri, Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> Wellcome Trust Genome Campus, Hinxton
> Cambridge CB10 1SD, United Kingdom
>


From maj at fortinbras.us  Wed Apr 28 12:24:51 2010
From: maj at fortinbras.us (Mark A. Jensen)
Date: Wed, 28 Apr 2010 12:24:51 -0400
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <r2w9fcc48c71004280855v3000f548p9751f59a1dce1431@mail.gmail.com>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com><20100428154949.GG12150@quux.windows.ebi.ac.uk>
	<r2w9fcc48c71004280855v3000f548p9751f59a1dce1431@mail.gmail.com>
Message-ID: <9EB1705A864F40558C7976C3E2F77CE7@NewLife>

You might look then in particular at a DB_File tie, with BTREE, check out the 
docs on Cpan
----- Original Message ----- 
From: "shalabh sharma" <shalabh.sharma7 at gmail.com>
To: "shalabh sharma" <shalabh.sharma7 at gmail.com>; "bioperl-l" 
<Bioperl-l at lists.open-bio.org>
Sent: Wednesday, April 28, 2010 11:55 AM
Subject: Re: [Bioperl-l] out of memory issue


Hi,
@ Andreas: Actually that is kind of search thing, i am making that hash so i
can search values out of it.
I will try to look what Dave and Mark has suggested , if it doesn't work
then i will use some other alternative like batches.

Thanks
Shalabh


On Wed, Apr 28, 2010 at 11:49 AM, Andreas Kahari <ak at ebi.ac.uk> wrote:

> On Wed, Apr 28, 2010 at 10:13:11AM -0400, shalabh sharma wrote:
> > Hi All,
> >        I am trying to make a hash of 38 Million ids but every time i get
> the
> > following message :
>
> Why would you want to do that?  What is the application and would you
> be able to solve it by either re-ordering the things you doing or doing
> things in batches?
>
>
> Andreas
>
> >
> > perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
> > *** error: can't allocate region
> > *** set a breakpoint in malloc_error_break to debug
> > Out of memory!
> >
> > I am working on MacOX 10.5.8 with 4GB of memory.
> >
> > I would really appreciate if anyone can help me out.
> >
> > Thanks
> > Shalabh
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
> --
> Andreas K?h?ri, Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> Wellcome Trust Genome Campus, Hinxton
> Cambridge CB10 1SD, United Kingdom
>

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l



From Russell.Smithies at agresearch.co.nz  Wed Apr 28 17:02:15 2010
From: Russell.Smithies at agresearch.co.nz (Smithies, Russell)
Date: Thu, 29 Apr 2010 09:02:15 +1200
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <20100428154949.GG12150@quux.windows.ebi.ac.uk>
References: <r2m9fcc48c71004280713jf699c87dwdc5629c283a7b363@mail.gmail.com>
	<20100428154949.GG12150@quux.windows.ebi.ac.uk>
Message-ID: <18DF7D20DFEC044098A1062202F5FFF32C6F1435B0@exchsth.agresearch.co.nz>

You mean why would you want to do that on a Mac?

;-)

--Russell

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of Andreas Kahari
> Sent: Thursday, 29 April 2010 3:50 a.m.
> To: shalabh sharma
> Cc: bioperl-l
> Subject: Re: [Bioperl-l] out of memory issue
> 
> On Wed, Apr 28, 2010 at 10:13:11AM -0400, shalabh sharma wrote:
> > Hi All,
> >        I am trying to make a hash of 38 Million ids but every time i get
> the
> > following message :
> 
> Why would you want to do that?  What is the application and would you
> be able to solve it by either re-ordering the things you doing or doing
> things in batches?
> 
> 
> Andreas
> 
> >
> > perl(191) malloc: *** mmap(size=16777216) failed (error code=12)
> > *** error: can't allocate region
> > *** set a breakpoint in malloc_error_break to debug
> > Out of memory!
> >
> > I am working on MacOX 10.5.8 with 4GB of memory.
> >
> > I would really appreciate if anyone can help me out.
> >
> > Thanks
> > Shalabh
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 
> --
> Andreas K?h?ri, Ensembl Software Developer
> European Bioinformatics Institute (EMBL-EBI)
> Wellcome Trust Genome Campus, Hinxton
> Cambridge CB10 1SD, United Kingdom
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================


From dan.kortschak at adelaide.edu.au  Wed Apr 28 18:05:13 2010
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Thu, 29 Apr 2010 07:35:13 +0930
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <mailman.19.1272470406.8855.bioperl-l@lists.open-bio.org>
References: <mailman.19.1272470406.8855.bioperl-l@lists.open-bio.org>
Message-ID: <1272492313.13215.2.camel@epistle>

Have you considered using a backend database for this? It will scale
better if you want to generalise the problem.

Dan

On Wed, 2010-04-28 at 12:00 -0400, shalabh.sharma7 at gmail.com wrote:
> Hi,
> @ Andreas: Actually that is kind of search thing, i am making that
> hash so i
> can search values out of it.
> I will try to look what Dave and Mark has suggested , if it doesn't
> work
> then i will use some other alternative like batches.
> 
> Thanks
> Shalabh


From cjfields at illinois.edu  Wed Apr 28 18:16:34 2010
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 28 Apr 2010 17:16:34 -0500
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <1272492313.13215.2.camel@epistle>
References: <mailman.19.1272470406.8855.bioperl-l@lists.open-bio.org>
	<1272492313.13215.2.camel@epistle>
Message-ID: <9FF27BD3-EA00-4971-9082-9475301F707E@illinois.edu>

Agreed.  I use SQLite quite frequently for bits like this. In fact, Mark wrote up a DB_File-like interface for SQLite along those lines, with a tied interface:

http://search.cpan.org/perldoc?SQLite_File

chris

On Apr 28, 2010, at 5:05 PM, Dan Kortschak wrote:

> Have you considered using a backend database for this? It will scale
> better if you want to generalise the problem.
> 
> Dan
> 
> On Wed, 2010-04-28 at 12:00 -0400, shalabh.sharma7 at gmail.com wrote:
>> Hi,
>> @ Andreas: Actually that is kind of search thing, i am making that
>> hash so i
>> can search values out of it.
>> I will try to look what Dave and Mark has suggested , if it doesn't
>> work
>> then i will use some other alternative like batches.
>> 
>> Thanks
>> Shalabh
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From shalabh.sharma7 at gmail.com  Wed Apr 28 19:05:22 2010
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 28 Apr 2010 19:05:22 -0400
Subject: [Bioperl-l] out of memory issue
In-Reply-To: <9FF27BD3-EA00-4971-9082-9475301F707E@illinois.edu>
References: <mailman.19.1272470406.8855.bioperl-l@lists.open-bio.org>
	<1272492313.13215.2.camel@epistle>
	<9FF27BD3-EA00-4971-9082-9475301F707E@illinois.edu>
Message-ID: <y2u9fcc48c71004281605x7d1f26e9n3f8c3b933769f63c@mail.gmail.com>

Thanks for all the valuable suggestions.
I solved the problem by using DB file and BTREE as suggested by Mark . I
will also give a try using SQLite.

Thanks
SHalabh


On Wed, Apr 28, 2010 at 6:16 PM, Chris Fields <cjfields at illinois.edu> wrote:

> Agreed.  I use SQLite quite frequently for bits like this. In fact, Mark
> wrote up a DB_File-like interface for SQLite along those lines, with a tied
> interface:
>
> http://search.cpan.org/perldoc?SQLite_File
>
> chris
>
> On Apr 28, 2010, at 5:05 PM, Dan Kortschak wrote:
>
> > Have you considered using a backend database for this? It will scale
> > better if you want to generalise the problem.
> >
> > Dan
> >
> > On Wed, 2010-04-28 at 12:00 -0400, shalabh.sharma7 at gmail.com wrote:
> >> Hi,
> >> @ Andreas: Actually that is kind of search thing, i am making that
> >> hash so i
> >> can search values out of it.
> >> I will try to look what Dave and Mark has suggested , if it doesn't
> >> work
> >> then i will use some other alternative like batches.
> >>
> >> Thanks
> >> Shalabh
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>

From dimitark at bii.a-star.edu.sg  Wed Apr 28 22:04:15 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Thu, 29 Apr 2010 10:04:15 +0800
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
	<24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
Message-ID: <4BD8E91F.6040709@bii.a-star.edu.sg>

Hi guys,
thank you for your help. Im sorry i missed to give the information about 
the DB i have. Ok, i have DB of human genome which is only the reference 
genome organized in chromosomes in fasta format. Then formatted with the 
makeblastdb provided with blast+.
I will now go and read about the suggestions you provided and hopefully 
i solve the problem. Otherwise i suppose i have to parse the DB and 
search for the appropriate positions 'manually'.

Cheers
Dimitar

On 04/28/2010 11:10 PM, Chris Fields wrote:
> By local DB, do you mean a BioPerl-based local DB?  Or is it something else?  This is a bit vague.
>
> On the BioPerl side I suggest looking into Bio::DB::SeqFeature::Store for storing and querying genome information (it does exactly what you want if the proper information is loaded), or maybe the Ensembl Perl API, which can be used with a local or remote Ensembl setup.  Beyond that you'll need to be more specific.
>
> chris
>
> On Apr 28, 2010, at 8:17 AM, Dimitar Kenanov wrote:
>
>    
>> Hello guys,
>> i have a question about gene "boundaries". Is there some module in BioPerl which can help me extract the DNA sequence from a genomic DB (from specific chromosome). I have my human genome in a local DB and some "from-to" data sets corresponding to different chromosomes. So i want to get the DNA seqs for these from-to's. I know i can do that the normal way but if there is a way to do it with BioPerl it will be more consistent with the rest of the code.
>>
>> Thanks for any tips :)
>>
>> Cheers
>> Dimitar
>>
>> -- 
>> Dimitar Kenanov
>> Postdoctoral research fellow
>> Protein Sequence Analysis Group
>> Bioinformatics Institute
>> A*STAR, Singapore
>> email: dimitark at bii.a-star.edu.sg
>> tel: +65 6478 8514
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>      
>    


-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From skastu01 at students.poly.edu  Thu Apr 29 00:19:57 2010
From: skastu01 at students.poly.edu (Lakshmi Kastury)
Date: Thu, 29 Apr 2010 04:19:57 +0000
Subject: [Bioperl-l] Setting Parameters when Using Remote Blast
Message-ID: <BLU106-W2F7D8A61EECD2029BFADA94010@phx.gbl>







Hi,
I am currently learning Bioperl and need a little help with how to specify parameters when using Remote Blast on a set of protein sequences. I need to have the output sort and display by the highest hsp (lowest e-value) for each sequence.

The previous example I am following specifies each parameter like this:
my $prog = 'blastp';
  my $db   = 'nr';
  my $e_val= '1e-10';
  **my $hit = '682';
  

  my @params = ( '-prog' => $prog,
         '-data' => $db,
         '-expect' => $e_val,
        ** '-hit' => $hit,
         '-readmethod' => 'SearchIO' );

I specified a values at the ** and it gave me an exact match for the sequences. I want it to sort based on the highest score (hsp).

Thanks,
Lakshmi Kastury
 		 	   		  

From dimitark at bii.a-star.edu.sg  Thu Apr 29 00:48:20 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Thu, 29 Apr 2010 12:48:20 +0800
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
	<24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
Message-ID: <4BD90F94.4040608@bii.a-star.edu.sg>

Hi guys,
today with rested head and after some reading i found the solution to my 
problem in BioPerl. Its Bio::DB::Fasta. It does what i want sufficiently 
well.
Thank you again for the help and im sorry for the trouble caused.

Cheers
Dimitar

On 04/28/2010 11:10 PM, Chris Fields wrote:
> By local DB, do you mean a BioPerl-based local DB?  Or is it something else?  This is a bit vague.
>
> On the BioPerl side I suggest looking into Bio::DB::SeqFeature::Store for storing and querying genome information (it does exactly what you want if the proper information is loaded), or maybe the Ensembl Perl API, which can be used with a local or remote Ensembl setup.  Beyond that you'll need to be more specific.
>
> chris
>
> On Apr 28, 2010, at 8:17 AM, Dimitar Kenanov wrote:
>
>    
>> Hello guys,
>> i have a question about gene "boundaries". Is there some module in BioPerl which can help me extract the DNA sequence from a genomic DB (from specific chromosome). I have my human genome in a local DB and some "from-to" data sets corresponding to different chromosomes. So i want to get the DNA seqs for these from-to's. I know i can do that the normal way but if there is a way to do it with BioPerl it will be more consistent with the rest of the code.
>>
>> Thanks for any tips :)
>>
>> Cheers
>> Dimitar
>>
>> -- 
>> Dimitar Kenanov
>> Postdoctoral research fellow
>> Protein Sequence Analysis Group
>> Bioinformatics Institute
>> A*STAR, Singapore
>> email: dimitark at bii.a-star.edu.sg
>> tel: +65 6478 8514
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>      
>    


-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From Frederic.SAPET at biogemma.com  Thu Apr 29 11:54:29 2010
From: Frederic.SAPET at biogemma.com (Frederic.SAPET at biogemma.com)
Date: Thu, 29 Apr 2010 17:54:29 +0200
Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast
 has)in Bio::Search::Tiling::MapTiling
In-Reply-To: <4EF812C0949F4FEA8AA188BEC2B6EFDC@NewLife>
Message-ID: <OF9B607834.3201D708-ONC1257714.0055CFCB-C1257714.005765D5@LGLimagrain.com>

Hi Mark

The kludge works.

I have just had to set undef the previously calculalted value of 
identities.

my $identString = "identities_".$type."_exact_".$context;
$tiling->{$identString} = undef;

But I think that what I would like to do is more deeper than that.

Sometime, I can have such results :
Chr1    TBLASTN match_set       2164104 56772932        544     +       .  
 
ID=Sample2;alignLength=1105;eValue=0.0;fractionAligned=95.959595959596;gapNumber=67;Name=Sample2;percentageIdentity=60.0476992143659
Chr1    TBLASTN match_part      2164104 2174973 630     +       1 
Parent=Sample2;Target=Sample2 71 358
Chr1    TBLASTN match_part      2216917 2218191 1014    +       1 
Parent=Sample2;Target=Sample2 70 502
Chr1    TBLASTN match_part      2218504 2218665 181     +       1 
Parent=Sample2;Target=Sample2 533 585
Chr1    TBLASTN match_part      56771229        56771357        230     +  
    1       Parent=Sample2;Target=Sample2 25 67
Chr1    TBLASTN match_part      56772054        56772932        1401    +  
    1       Parent=Sample2;Target=Sample2 71 364

I would like to see the HSP separated in two distinct groups.
I tried to have a look inside the source code.
Is the method interval_tiling in MapTileUtils.pm a good start ?
Can I add here a new param (the kind of hspsepQmax/hspsepSmax) ?

thank you.

Fred


"Mark A. Jensen" <maj at fortinbras.us> a ?crit sur 26/04/2010 15:17:51 :

> Hi Fred,
> 
> I'll tell you how you can write a kludge; maybe you can expand it into
> a more general method.
> 
> For your tblastn data, get the coverage map array
> 
>  @map = $tiling->coverage_map('hit', 'p0')
> 
> Each element of the map is a ref to a pair [$int, $hsp], where $int is
> itself a reference to a two-elt array containing the coordinates of the
> hsp in context and $hsp is the hsp object itself. You can use these to
> filter the @map array.
> 
> For your example, you can just get rid of the first @map elt:
> 
>  shift @map;
> 
> Replace the internal map for this type and context, so that
> the methods work on the modified map:
> 
>  $tiling->{'coverage_map_hit_p0'} = \@map;
> 
> Then $tiling->identities('hit', 'exact', 'p0'), etc. give you the
> new values.
> 
> HTH-
> MAJ
> ----- Original Message ----- 
> From: <Frederic.SAPET at biogemma.com>
> To: <bioperl-l at bioperl.org>
> Sent: Friday, April 23, 2010 11:16 AM
> Subject: [Bioperl-l] Add a kind of hspsepQmax/hspsepSmax (like WuBlast 
has)in 
> Bio::Search::Tiling::MapTiling
> 
> 
> > Hello
> >
> > Based on bp_search2gff.pl script and Bio::Search::Tiling::MapTiling
> > documentation (http://www.bioperl.org/wiki/HOWTO:Tiling), I'm trying 
to
> > write a generic blast to gff3 parser.
> >
> > My idea is to filter hits on frac_aligned and percent_identity values.
> >
> > I'm facing a problem with a BlastX result and the corresponding 
TBlastN.
> >
> > Please find my script and the two example files attached.
> >
> > The example is a piece of Maize Chromosome where a protein seems to be
> > duplicated.
> >
> > When I launch the parsing of BlastX file and I want to retrieve data 
from
> > a Query View ( >tiling.pl BlastX query), I have :
> >
> > Chr6:159690000-159718000        BLASTX  match_set       23971   25620
> > 121.6   +       .
> > ID=Os03g17980.2:1.1.1;alignLength=576;eValue=4.6e-137;
> fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;
> percentageIdentity=69.1552062868369
> > Chr6:159690000-159718000        BLASTX  match_part      23971   24186 
331
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> > Chr6:159690000-159718000        BLASTX  match_part      24820   24915 
100
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> > Chr6:159690000-159718000        BLASTX  match_part      25195   25308  
89
> >     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 
395
> > Chr6:159690000-159718000        BLASTX  match_part      25390   25620 
192
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
> >
> > Chr6:159690000-159718000        BLASTX  match_set       918     2567 
121.6
> >  +       .
> > ID=Os03g17980.2:1.2.1;alignLength=576;eValue=4.6e-137;
> fractionAligned=97.0530451866405;gapNumber=16;Name=Os03g17980.2;
> percentageIdentity=69.1552062868369
> > Chr6:159690000-159718000        BLASTX  match_part      918     1148 
192
> > -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 395 472
> > Chr6:159690000-159718000        BLASTX  match_part      1230    1343  
89
> >     -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 358 
395
> > Chr6:159690000-159718000        BLASTX  match_part      1623    1718 
100
> > -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 291 322
> > Chr6:159690000-159718000        BLASTX  match_part      2352    2567 
331
> > -       0       Parent=Os03g17980.2:1.2.1;Target=Os03g17980.2 120 191
> >
> > this is perfect, I retrieve two nice hits, with perfectly tiled HSP.
> >
> > But, with the TBlastN report (using a Hit View :  >tiling.pl TBlastN 
hit),
> > I have :
> > Chr6:159690000-159718000        TBLASTN match_set       7666    25620
> > 121.6   +       .
> > ID=Os03g17980.2:1.1.1;alignLength=303;eValue=4.9e-137;
> fractionAligned=98.8212180746562;gapNumber=18;Name=Os03g17980.2;
> percentageIdentity=66.0052390307793
> > Chr6:159690000-159718000        TBLASTN match_part      7666    7917  
44
> >     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 332 
416
> > Chr6:159690000-159718000        TBLASTN match_part      23971   24186 
331
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 120 191
> > Chr6:159690000-159718000        TBLASTN match_part      24820   24915 
100
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 291 322
> > Chr6:159690000-159718000        TBLASTN match_part      25195   25308  
89
> >     +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 358 
395
> > Chr6:159690000-159718000        TBLASTN match_part      25390   25620 
192
> >  +       0       Parent=Os03g17980.2:1.1.1;Target=Os03g17980.2 395 472
> >
> > I lose one of my hit, because another HSP is tiled to my hit, so I 
trash
> > it when I filter the context using identitie values (line 42 to 54 of 
my
> > script).
> > This HSP is far away in 5', so I would like to know if it could be
> > possible to add (or help me to develop this) a sort of
> > hspsepQmax/hspsepSmax (maximum allowed separation along the query(or
> > subject) sequence between two HSPs ) as a new parameter during the 
tiling
> > phase ?
> >
> >
> >
> > Thank you.
> >
> > Fred
> >
> >
> >
> 
> 
> 
--------------------------------------------------------------------------------
> 
> 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l 
> 


From maizemu at gmail.com  Thu Apr 29 16:26:23 2010
From: maizemu at gmail.com (Christopher Bottoms)
Date: Thu, 29 Apr 2010 15:26:23 -0500
Subject: [Bioperl-l] RFC: SNP::Inherit
Message-ID: <r2x755a9cd91004291326k299140dcq3716e4822095fec4@mail.gmail.com>

Dear Bioperl community,

I was thinking of uploading a module to CPAN that converts SNP genotype data
to parental allele designations. Below is the perldoc. This is not a
"BioPerl" module per se, so I'm  not sure what namespace to put it under.

I would be glad to send anyone the source if they are interested in checking
it out more. I just did not want to send everyone an unsolicited attachment.

Thank you for your time,
Christopher Bottoms (molecules)


NAME
    SNP::Inherit - Module for determining the parental origin of specific
    SNPs based on genotype data.

VERSION
    Version 0.0010_0001

SYNOPSIS
        my $foo = SNP::Inherit->new(
            manifest_filename => 'manifest.tab',
            data_filename     => 'data.tab'
        );

        #Upon object construction, this outputs a summary file
        #   'data.tab_summary.tab' and a detailed file 'data.tab_abh.tab'
        #   containing parental allele designations for each sample that has

        #   parents defined for it in the manifest file

DESCRIPTION
    This is a module for converting Single Nucleotide Polymorphism (SNP)
    genotype data to parental allele designations. This helps with creating
    files suitable for mapping, identifying and characterizing crossovers,
    and also helps with quality control.

SUBROUTINES/METHODS
  BUILD
        Since the integrity of the data in the manifest file is absolutely
vital,
        building an object fails if there are duplicate sample ids in the
        manifest file.

ATTRIBUTES
  manifest_filename
        Name of the file containing information for each sample id

        Required in the constructor

        The first line contains headers and the remaining lines contain
            tab-delimited fields in the following order:

            sample id     or "Institute Sample Label"    (e.g.
"WG0096796-DNAA05" )
            sample name   or "Sample name"               (e.g.
"B73xB97"          )
            group name    or "Group"                     (e.g. "NAM
F1"           )
            parentA       or "Mother"                    (e.g.
"WG0096795-DNAA01" )
            parentB       or "Father"                    (e.g.
"WG0096796-DNAF01" )
            replicate of  or "Replicate(s)"    (id of sample that this
replicates
                                                  e.g.
"WG0096796-DNAA05"         )
            AxB F1        or "F1 of parentA and parentB" (e.g.
"WG0096795-DNAA02" )

        The last four fields can be blank, if they are not applicable.
However,
            being blank when they are applicable will result in failure of
the
            program to analyze the data properly

  data_filename
        Name of the tab-delimited file containing the data to be processed.

        Required in the constructor.

        The text '[Data]' in a line indicates that remaining lines are all
data.
        The next line contains column headers, which are in fact the sample
ids.
            Sample ids missing from the manifest file will not be processed.
        The next line contains the name of the SNP in the first field and
data in
            the remaining fields.

        Data must be in the format of SNP_name{tab}AA{tab}GG{tab}.

OUTPUT FILES
        Upon object construction, two files are produced: one that
summarizes the
        input and another that that describes the genotypes of samples in
terms of
        their "parents". For example, a sample with a genotype of "CG" whose
        'parentA' has a genotype of "CC" and whose 'parentB' has a genotype
of
        "GG" would have a heterozygous genotype, labeled as 'H'.

        Here are the possible allele designations that result:

            Allele designations for informative genotypes:
                A = parentA genotype
                B = parentB genotype
                H = heterozygous genotype

            Allele designations for noninformative genotypes:
                ~ = nonpolymorphic parents (i.e. both parents have same
genotype)
                - = missing data
                -- = missing data for at least one parental
                % = polymorphic parent

            Error codes:
                # = conflict of nonpolymorphic expectation, meaning both
parents
                        have the same genotype, but the sample has a
different
                        genotype. For example, parentA and parentB both have
the
                        genotype 'CC', but the sample has a genotype of
'TT'.

                ! = nonparental genotype, meaning each parent has a
different
                        genotype, but the sample has at least one allele not
seen
                        in either parent. For example, getting 'AG' for the
                        offspring when the parents have 'GG' and 'TT'.
                        (This should not even be seen when the data was
obtained
                        from a biallelic assay.)

                !! = genotype of the F1 for parentA x parentB is incongruent
with
                        the genotype for parentA

        See the bundled tests for examples.

TODO
        Output report detailing which samples have been processed and in
what way.
        Also give descendents and ancestor relationships.

        Document ability to process files using F1 and parentA info (i.e. in
the
        absence of parentB info).

        Add simple means of adding map info so that distances and
chromosomes are
        output along with the marker names.

        Give crossover info?

        Give introgressions/regions attributable to specific ancestor(s).

        Use benchmarking to find out which (if any) to memoize:
        _nonredundant_chars
        _trim
        _is_comprised_from
        _sorted_characters
        _sort_and_join
        _chars_from
        _sorted_first_two_char

        Test bad file names

DIAGNOSTICS
        TODO

CONFIGURATION AND ENVIRONMENT
       TODO

DEPENDENCIES
       TODO

INCOMPATIBILITIES
       TODO

BUGS
    Please report any you find. None have been reported as of the current
    release.

LIMITATIONS
    Be consciencious with the preparation of your input files (i.e. manifest
    file and data file). Correct results depend on correct input files.

AUTHOR
    Christopher Bottoms, "<molecules at cpan.org>"

SUPPORT
    You can find documentation for this module with the perldoc command.

        perldoc SNP::Inherit

ACKNOWLEDGEMENTS
LICENSE AND COPYRIGHT
    This program is free software; you can redistribute it and/or modify it
    under the terms of either: the GNU General Public License as published
    by the Free Software Foundation; or the Artistic License.

    See http://dev.perl.org/licenses/ for more information.

    Copyright 2010 Christopher Bottoms.

From hsa_rim at yahoo.co.in  Thu Apr 29 02:57:13 2010
From: hsa_rim at yahoo.co.in (shafeeq rim)
Date: Thu, 29 Apr 2010 12:27:13 +0530 (IST)
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
	<24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
Message-ID: <813028.90570.qm@web94608.mail.in2.yahoo.com>

Hi Dimitar,

Attached is a C++ program to do your job. It is extremely faster than perl. Can do your job in less than a second even for full chromosome 1.

Steps:-
1- Download FASTA file and then remove the header. (>asdasfdasfassa)
2- Use RemoveNewline.pl program like this   
     RemoveNewline.pl inputfile > outputfile
3- You have to compile the C++ program using this command.
    
g++ ExtractSequence.cpp -o ExtractSequence
4- Then you can use the C++  program like this in linux:-
   
./ExtractSequence inputfilename start stop 
 or  
In Windows
    
ExtractSequence inputfilename start stop
 
e.g:- ExtractSequence chr1.fasta 10000  20000

Hope this helps.

Thanks
Ashfaq
            
  
 






________________________________
From: Chris Fields <cjfields at illinois.edu>
To: Dimitar Kenanov <dimitark at bii.a-star.edu.sg>
Cc: bioperl-l at bioperl.org
Sent: Wed, 28 April, 2010 11:10:40 PM
Subject: Re: [Bioperl-l] about gene "boundaries"

By local DB, do you mean a BioPerl-based local DB?  Or is it something else?  This is a bit vague.

On the BioPerl side I suggest looking into Bio::DB::SeqFeature::Store for storing and querying genome information (it does exactly what you want if the proper information is loaded), or maybe the Ensembl Perl API, which can be used with a local or remote Ensembl setup.  Beyond that you'll need to be more specific.

chris
On Apr 28, 2010, at 8:17 AM, Dimitar Kenanov wrote:

> Hello guys,
> i have a question about gene "boundaries". Is there some module in BioPerl which can help me extract the DNA sequence from a genomic DB (from specific chromosome). I have my human genome in a local DB and some "from-to" data sets corresponding to different chromosomes. So i want to get the DNA seqs for these from-to's. I know i can do that the normal way but if there is a way to do it with BioPerl it will be more consistent with the rest of the code.
> 
> Thanks for any tips :)
> 
> Cheers
> Dimitar
> 
> -- 
> Dimitar Kenanov
> Postdoctoral research fellow
> Protein Sequence Analysis Group
> Bioinformatics Institute
> A*STAR, Singapore
> email: dimitark at bii.a-star.edu.sg
> tel: +65 6478 8514
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l


-------------- next part --------------
A non-text attachment was scrubbed...
Name: ExtractSequence.cpp
Type: application/octet-stream
Size: 777 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100429/1edf4c04/attachment.obj>
-------------- next part --------------
A non-text attachment was scrubbed...
Name: RemoveNewline.pl
Type: application/octet-stream
Size: 137 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100429/1edf4c04/attachment-0001.obj>

From dimitark at bii.a-star.edu.sg  Thu Apr 29 21:04:09 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Fri, 30 Apr 2010 09:04:09 +0800
Subject: [Bioperl-l] about exonerate
Message-ID: <4BDA2C89.4020902@bii.a-star.edu.sg>

Hi guys,
im sorry for bothering you so much but i found some strange thing for 
exonerate. I wrote to Guy Slater about it as well.

So, i downloaded Exonerate 2.2.0 and built it myself on Slackware 
13(64). It went without problem and is working.

Now i am trying to use exonerate through Perl but i got a problem. I 
first used BioPerl's modules to try and run it but no luck. I only get 
three lines of output:
----------------
Command line: [exonerate --model protein2genome --showalignment FALSE 
--showvulgar FALSE --showcigar FALSE --showquerygff TRUE --showtargetgff 
TRUE wdr5_human.fa tmp_fa.out]
Hostname: [darkstar]
-- completed exonerate analysis
----------------

Then i tried to run it myself with the lines  below. It ran with no 
complain but again i got only the three lines above :)
---------------
my @ex_args=("$prog --model protein2genome --showalignment FALSE 
--showvulgar FALSE --showcigar FALSE --showquerygff TRUE --showtargetgff 
TRUE $prot_fa $tmp_fa > $outf");
system(@ex_args) == 0 or die "system @ex_args failed: $!";
---------------

Now when i use exactly the same code but on the terminal everything is 
working just fine. But i need it automatic. Could you please help me? Am 
i missing something?

Thank you for your time.

Best wishes
Dimitar

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From dimitark at bii.a-star.edu.sg  Fri Apr 30 04:44:29 2010
From: dimitark at bii.a-star.edu.sg (Dimitar Kenanov)
Date: Fri, 30 Apr 2010 16:44:29 +0800
Subject: [Bioperl-l] question about Bio::Tools::Run::Genewise
Message-ID: <4BDA986D.3020302@bii.a-star.edu.sg>

Hi guys,
one stupid question. How can i pass arguments to the factory of that 
module 'Bio::Tools::Run::Genewise'?
In the man page is not documented. I tried to pass 'quiet' as a string 
to the new method but is not working so, then i tried and like array and 
other things but to no success. I wouldnt like to see all the output on 
the screen.

Please can someone help? Thank you.

Dimitar

-- 
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514


From MEC at stowers.org  Fri Apr 30 10:16:59 2010
From: MEC at stowers.org (Cook, Malcolm)
Date: Fri, 30 Apr 2010 09:16:59 -0500
Subject: [Bioperl-l] about gene "boundaries"
In-Reply-To: <4BD90F94.4040608@bii.a-star.edu.sg>
References: <4BD8357B.5030804@bii.a-star.edu.sg>
	<24714E9B-B3E5-4703-92F8-64483FA59AFC@illinois.edu>
	<4BD90F94.4040608@bii.a-star.edu.sg>
Message-ID: <BD62CBAC4395B94096109020651BE2EC1302CB10E7@EXCHMB-02.stowers-institute.org>

Dimitar,

Since you have indexed your database with makeblastdb, you might simply use `blastdbcmd` to extract, in fasta format, sub-sequences from the indexed database using identifiers and integer ranges 

blastdbcmd is included in the blast+ suite of programs, which also included makeblastdb which you report you have running.
  
see: ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/user_maual.pdf

I've not (yet) used the blast+ suite (still using the old blast) so I've not tested this myself yet, but I think something like the following will work for you:

blastdbcmd -db yourBlastDatabase -entry  chr2 -range 100-300 -outformat fasta

will extract chr2:100-300 from yourBlastDatabase 

Good Luck

 

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Dimitar Kenanov
Sent: Wednesday, April 28, 2010 11:48 PM
To: Chris Fields; bioperl-l at bioperl.org; scott at scottcain.net; hrh at fmi.ch
Subject: Re: [Bioperl-l] about gene "boundaries"

Hi guys,
today with rested head and after some reading i found the solution to my problem in BioPerl. Its Bio::DB::Fasta. It does what i want sufficiently well.
Thank you again for the help and im sorry for the trouble caused.

Cheers
Dimitar

On 04/28/2010 11:10 PM, Chris Fields wrote:
> By local DB, do you mean a BioPerl-based local DB?  Or is it something else?  This is a bit vague.
>
> On the BioPerl side I suggest looking into Bio::DB::SeqFeature::Store for storing and querying genome information (it does exactly what you want if the proper information is loaded), or maybe the Ensembl Perl API, which can be used with a local or remote Ensembl setup.  Beyond that you'll need to be more specific.
>
> chris
>
> On Apr 28, 2010, at 8:17 AM, Dimitar Kenanov wrote:
>
>    
>> Hello guys,
>> i have a question about gene "boundaries". Is there some module in BioPerl which can help me extract the DNA sequence from a genomic DB (from specific chromosome). I have my human genome in a local DB and some "from-to" data sets corresponding to different chromosomes. So i want to get the DNA seqs for these from-to's. I know i can do that the normal way but if there is a way to do it with BioPerl it will be more consistent with the rest of the code.
>>
>> Thanks for any tips :)
>>
>> Cheers
>> Dimitar
>>
>> --
>> Dimitar Kenanov
>> Postdoctoral research fellow
>> Protein Sequence Analysis Group
>> Bioinformatics Institute
>> A*STAR, Singapore
>> email: dimitark at bii.a-star.edu.sg
>> tel: +65 6478 8514
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>      
>    


--
Dimitar Kenanov
Postdoctoral research fellow
Protein Sequence Analysis Group
Bioinformatics Institute
A*STAR, Singapore
email: dimitark at bii.a-star.edu.sg
tel: +65 6478 8514

_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l