[Bioperl-l] Regarding RemoteBlast: Getting error "Cannot accept request, error code: -103"

Chris Fields cjfields at illinois.edu
Fri Jul 23 13:36:40 EDT 2010


I've attached the code and example data that worked.  This is using the
latest bioperl on github, so maybe it's the version you have installed?

chris

On Fri, 2010-07-23 at 10:04 -0700, sheetal gosrani wrote:
> I did remove that line but doesn't help. I still keep getting this
> error:
> MSG: <hr><p id="blastErr"><font color="red">An error has occurred on
> the server, The server is unable to format right now, please try again
> in a few minutes.  If the problem  (Informational Message: No alias or
> index file found for protein database [nr/nt] in search path
> [/export/home/splitd/blastdb/blast0:/blast/db/disk.blast/blast1::])
> persists -  Contact Blast-help at ncbi.nlm.nih.gov and include your RID:
> 4KJE1YJ601N</font></p><hr>
> 
> Any pointers ??
> 
> - Sheetal
> 
> On Thu, Jul 22, 2010 at 6:52 PM, Chris Fields <cjfields at illinois.edu>
> wrote:
>         Removing this line from your original script worked for me:
>         
>         $Bio::Tools::Run::RemoteBlast::HEADER{'SERVICE'} = 'blastx';
>         
>         
>         This is set via '-prog' parameter.
>         
>         chris
>         
>         
>         On Jul 22, 2010, at 7:30 PM, sheetal gosrani wrote:
>         
>         > Yes the error is still occurring. I have emailed to
>         Blast-help as well and they have to say that "there is
>         something wrong with the URL, didn't give any specifics".
>         >
>         > Also changing the parameter SERVICE to 'plain' (by default
>         it is set to plain, I guess this value is for standard blast
>         pgm. like blastp, blastx, etc) gives me this error :
>         > An error has occurred on the server, The server is unable to
>         format right now, please try again in a few minutes. If the
>         problem (Informational Message: No alias or index file found
>         for protein database [nr/nt] in search path
>         [/export/home/splitd/blastdb/blast1:/blast/db/disk.blast/blast1::]) persists - Contact Blast-help at ncbi.nlm.nih.gov and include your RID: 4H2Y96KZ012 I have sent an email today to blast-help for this error.
>         >
>         > Adding below the email conversation with blast-help for
>         debugging further :
>         > On Thu, Jul 22, 2010 at 6:20 AM, Wayne Matten
>         <mattenw at mail.nih.gov> wrote:
>         > Sheetal,
>         >
>         > You are right about the query syntax, but your URL has some
>         errors. The URL below works; note that order of parameters
>         does not matter.
>         >
>         > Best regards,
>         > Wayne
>         >
>         > http://www.ncbi.nlm.nih.gov/blast/Blast.cgi?QUERY=%
>         3EContig_236+%0A%
>         0DAATCTGTTCCTGTTTTTTGAGCCCCTGGCGGGCAAACGGCATGCCAGGTCAGCGAGCGGCGCACGAAGGTGGATTGGGCCCACGCCATGCGTCATCTGGCCGATGAACTGTACCCAGAGGCAGACGTGATCGTTGTGGTGATGGACAATCTGAACCCGCACAGCCCGGCTTCCTTCTCCGAGGCATTCGAGCCCGCCGAGGCGCAACGGCTCCGAGCACGCTTCGCGTTCCACTCCACGCCCAAGCACGGCAGTTGGCTGAATATGGCCGAGATTGAATTGCGTGCCTTGGTGAGAAGCTGCCTGAATCGCCGGATTCCAGACCAGGCCACCCTGCATCGGGAGGTCCAGGCATGGGTGGAGGAGCGGAACCAAAAAGCCGTCCGAGTAGACTGGCGTTTCACCACCGCCAATGCCCGCATGAAACTGAAACATTTGTATCCAAAGATTCATGCTTGACAGAGTACTAGaCCTGACCAAACTGGaKCWWCaSCWTTCCATATCCGAGGGCTTCAGTCCGACGGCTCGCGCGGGATAGCGGATTTAATGCTCAATCTCCATCGAGCCCGACGGCTCGTGCGGGATAGCGGATTATAGCGGTTCTCAGATACGTTGACTCCTGTCCGGGTCTGCCGTGTCGTGCGAGGCGCCCGTTTCCGCCACGCGCTCAGGGAGGGCTTATGGTCTTTGAGTAAATAATCCGCCATAGCCCGCGCAGGCGGGCTTTGCATTCCATAGCCGCGGGCTTATGGTCTTTGAATAAATAATCCGCTACAGCCCGCGCAGGCGGGCTTCGCCTTGGCTAGCCGAGGGCTTCAGCCCCACGGCTAGCGCGGGATAGCAGAATAAATTCTCAATCTCCATTAGCCCCACGGCAAGGGCGTATACCGGATTTATTTCTCAATCTCCATCAGCCCGCACGCGCGGAGTCGCGCCCGCAGTTCTCAGATGCGTTGACCCTTGTCCGGGTCTGCTGTGTCGCACAAGGCGCCCGCTTCCGCTGCGCTCCCCATCTCCGCGCCTCCTCGCCTCCGCGTGAGCCGGTCTGATGCATGCGGAGACGCAGAGCACACGGAGAGATGGCGCACAAGGCGTCTGCTTTCGCTGGCGTGTTCaAcCCTGTCCAACAAGACCAATATTTAGTGAGAACTGCTATATTTCTCACATATATCGGCAGCGTCAGCGAAGCGGTGATTGTGCAGACGGACGCTGCCGGACGACCGCAGGCGCTGGTAACGATGAGCCGGTCGGGTATTGCGCCTGGGTTTGTAACGCGCGGCGAACCCGGTCTGCTTCTTGCGGCAACAGYGTGTCCACCTGTGTCTGCAAAGCTCGACGAACGCTGTCACTCCCTTCACGCAGCCaatAAtcgTATATCTGTTTCTTCAACGCTTGACGAACTTTATCCTCTTCTTGAGACAGGAACTCGTTCACCCGGCTTTGCAACGCATGGCGAACGTCGCTTTCCGCCTGACTCAGCTGACTCTTTACCCGATCTTGCAACGCCGCGCGGAATTGGCTTTCCGTTTGACGCATCAAATCATTCATCTTTGCCTGGAACGCCTGGAGCCATTCACTCTTTACTTGATCCAACAGCTCTGCAGCGTGATTCTGCAATGTCTCGTGAACCCGGTCTTGCTCTTGCTCCAGTAGCGCTGCAACCTGGGTCTGTAATGCGCTGCGGACGTCACCCTTCTCTTGACGTACCAGTTCTGT&DATABASE=nr&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&CMD=Put&FILTER=L&PROGRAM=blastx&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&DESCRIPTIONS=100&FORMAT_TYPE=Text
>         >
>         > On Jul 21, 2010, at 2:57 PM, sheetal gosrani wrote:
>         >
>         > Thank you Wayne. I tried with the sequence beginning
>         immediately after "QUERY=", (called as bare sequence) but
>         still I get the same error.
>         >
>         > The documentation on your URLAPI says that Query can have
>         Accession(s), gi(S) or FASTA sequence. The format of the query
>         for FASTA sequence is as shown:
>         > http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml Thus
>         for FASTA sequence, the query has description/definition
>         followed by actual sequence. In that case, the format of my
>         POST request match the requirement.
>         >
>         > Can you help me figure out why am I still getting error :
>         "Cannot accept request, error code: -103" ? Attaching the log
>         file having Query as bare sequence and FASTA sequence for your
>         reference. Your help is much appreciated.
>         >
>         > Thanks,
>         > Sheetal
>         >
>         > On Wed, Jul 21, 2010 at 7:45 AM, Wayne Matten
>         <mattenw at mail.nih.gov> wrote:
>         > Hello,
>         >
>         > Our URLAPI, which your script should, but may or may not
>         use, requires that the sequence begin immediately after
>         "QUERY=". Your example shows a definition line preceding the
>         sequence. You can get documentation on our URLAPI on this page
>         (Web service interface):
>         >
>         >
>         http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=DeveloperInfo
>         >
>         > Best regards,
>         > Wayne
>         >
>         > _~___~___~__~__~_~
>         > Wayne Matten, PhD
>         > NCBI Public Services
>         > mattenw at mail.nih.gov
>         >
>         >
>         > On Jul 20, 2010, at 4:49 PM, sheetal gosrani wrote:
>         >
>         > Hello,
>         >
>         > I am trying to use blastx program with 'nr' database in my
>         Bioperl script remotely. While I do so, I get this error :
>         > Cannot accept request, error code: -103
>         >
>         > The request that I send is :
>         > POST http://blast.ncbi.nlm.nih.gov/Blast.cgi User-Agent:
>         bioperl-Bio_Tools_Run_
>         >> RemoteBlast/1.006001 Content-Length: 1945 Content-Type:
>         application/x-www-form-urlencoded DATABASE=nr%2Fnt&QUERY=%
>         3EContig_236+%
>         0AAATCTGTTCCTGTTTTTTGAGCCCCTGGCGGGCAAACGGCATGTCCAGGTCAGCGAGCGGCGCACGAAGGTGGATTGGGCCCACGCCATGCGTCATCTGGCCGATGAACTGTACCCAGAGGCAGACGTGATCGTTGTGGTGATGGACAATCTGAACCCGCACAGCCCGGCTTCCTTCTCCGAGGCATTCGAGCCCGCCGAGGCGCAACGGCTCCGAGCACGCTTCGCGTTCCACTCCACGCCCAAGCACGGCAGTTGGCTGAATATGGCCGAGATTGAATTGCGTGCCTTGGTGAGAAGCTGCCTGAATCGCCGGATTCCAGACCAGGCCACCCTGCATCGGGAGGTCCAGGCATGGGTGGAGGAGCGGAACCAAAAAGCCGTCCGAGTAGACTGGCGTTTCACCACCGCCAATGCCCGCATGAAACTGAAACATTTGTATCCAAAGATTCATGCTTGACAGAGTACTAGaCCTGACCAAACTGGaKCWWCaSCWTTCCATATCCGAGGGCTTCAGTCCGACGGCTCGCGCGGGATAGCGGATTTAATGCTCAATCTCCATCGAGCCCGACGGCTCGTGCGGGATAGCGGATTATAGCGGTTCTCAGATACGTTGACTCCTGTCCGGGTCTGCCGTGTCGTGCGAGGCGCCCGTTTCCGCCACGCGCTCAGGGAGGGCTTATGGTCTTTGAGTAAATAATCCGCCATAGCCCGCGCAGGCGGGCTTTGCATTCCATAGCCGCGGGCTTATGGTCTTTGAATAAATAATCCGCTACAGCCCGCGCAGGCGGGCTTCGCCTTGGCTAGCCGAGGGCTTCAGCCCCACGGCTAGCGCGGGATAGCAGAATAAATTCTCAATCTCCATTAGCCCCACGGCAAGGGCGTATACCGGATTTATTTCTCAATCTCCATCAGCCCGCACGCGCGGAGTCGCGCCCGCAGTTCTCAGATGCGTTGACCCTTGTCCGGGTCTGCTGTGTCGCACAAGGCGCCCGCTTCCGCTGCGCTCCCCATCTCCGCGCCTCCTCGCCTCCGCGTGAGCCGGTCTGATGCATGCGGAGACGCAGAGCACACGGAGAGATGGCGCACAAGGCGTCTGCTTTCGCTGGCGTGTTCaAcCCTGTCCAACAAGACCAATATTTAGTGAGAACTGCTATATTTCTCACATATATCGGCAGCGTCAGCGAAGCGGTGATTGTGCAGACGGACGCTGCCGGACGACCGCAGGCGCTGGTAACGATGAGCCGGTCGGGTATTGCGCCTGGGTTTGTAACGCGCGGCGAACCCGGTCTGCTTCTTGCGGCAACAGYGTGTCCACCTGTGTCTGCAAAGCTCGACGAACGCTGTCACTCCCTTCACGCAGCCaatAAtcgTATATCTGTTTCTTCAACGCTTGACGAACTTTATCCTCTTCTTGAGACAGGAACTCGTTCACCCGGCTTTGCAACGCATGGCGAACGTCGCTTTCCGCCTGACTCAGCTGACTCTTTACCCGATCTTGCAACGCCGCGCGGAATTGGCTTTCCGTTTGACGCATCAAATCATTCATCTTTGCCTGGAACGCCTGGAGCCATTCACTCTTTACTTGATCCAACAGCTCTGCAGCGTGATTCTGCAATGTCTCGTGAACCCGGTCTTGCTCTTGCTCCAGTAGCGCTGCAACCTGGGTCTGTAATGCGCTGCGGACGTCACCCTTCTCTTGACGTACCAGTTCTGT&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&SERVICE=blastx&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&PROGRAM=blastx
>         >>
>         >> Can you please help me debug it.
>         >>
>         >> Thanks and Regards,
>         >> Sheetal
>         >
>         > Thanks
>         > Sheetal
>         >
>         > On Thu, Jul 22, 2010 at 4:54 PM, Chris Fields
>         <cjfields at illinois.edu> wrote:
>         > The errors reported seem to indicate problems on the NCBI
>         server, not problems with the script.  Is this still
>         occurring?
>         >
>         > chris
>         >
>         > On Jul 21, 2010, at 4:49 PM, sheetal gosrani wrote:
>         >
>         > > Adding some more details on OS and BioPerl version
>         > >
>         > > OS:
>         > > sheetal at sheetal-ubuntu:~/Setups/BioPerl-1.6.1$ uname -a
>         > > Linux sheetal-ubuntu 2.6.32-23-generic #37-Ubuntu SMP Fri
>         Jun 11 07:54:58
>         > > UTC 2010 i686 GNU/Linux
>         > >
>         > > Perl :  v5.10.1 (*) built for i486-linux-gnu-thread-multi
>         > >
>         > > BioPerl Version :
>         > > sheetal at sheetal-ubuntu:~/Setups/BioPerl-1.6.1$ perl
>         -MBio::Root::Version -e
>         > > 'print $Bio::Root::Version::VERSION,"\n"'
>         > > 1.006001
>         > >
>         > > Attached is the error that I get while running the
>         RemoteBlast.
>         > >
>         > > Thanks,
>         > > Sheetal
>         > >
>         > > On Tue, Jul 20, 2010 at 5:30 PM, sheetal gosrani
>         > > <sheetu.piscean at gmail.com>wrote:
>         > >
>         > >> Hi,
>         > >>
>         > >> I am trying to run RemoteBlast to blastx sequences on
>         'nr' database. Here
>         > >> is the complete script :
>         > >> #Remote-blast "factory object" creation and
>         blast-parameter
>         > >> initialization
>         > >>
>         > >> use Bio::Tools::Run::RemoteBlast;
>         > >> use strict;
>         > >> my $prog = 'blastx';
>         > >> my $db   = 'nr/nt';
>         > >> my $e_val= '1e-10';
>         > >>
>         > >> my @params = ( '-prog' => $prog,
>         > >>        '-data' => $db,
>         > >>        '-expect' => $e_val,
>         > >>        '-readmethod' => 'SearchIO' );
>         > >>
>         > >> my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
>         > >>
>         > >> $Bio::Tools::Run::RemoteBlast::HEADER{'SERVICE'} =
>         'blastx';
>         > >>
>         > >> #$v is just to turn on and off the messages
>         > >> my $v = 0;
>         > >>
>         > >> my $str = Bio::SeqIO->new(-file=>'davcg_small.fasta' ,
>         -format => 'fasta'
>         > >> );
>         > >>
>         > >> while (my $input = $str->next_seq()){
>         > >>   #Blast a sequence against a database:
>         > >>
>         > >>   #Alternatively, you could  pass in a file with many
>         > >>   #sequences rather than loop through sequence one at a
>         time
>         > >>   #Remove the loop starting 'while (my $input =
>         $str->next_seq())'
>         > >>   #and swap the two lines below for an example of that.
>         > >>   my $r = $factory->submit_blast($input);
>         > >>   #my $r = $factory->submit_blast('amino.fa');
>         > >>
>         > >>   print STDERR "waiting..." if( $v > 0 );
>         > >>   while ( my @rids = $factory->each_rid ) {
>         > >>     foreach my $rid ( @rids ) {
>         > >>       my $rc = $factory->retrieve_blast($rid);
>         > >>       if( !ref($rc) ) {
>         > >>         if( $rc < 0 ) {
>         > >>           print "removing rid as rc is < 0";
>         > >>           $factory->remove_rid($rid);
>         > >>         }
>         > >>         print STDERR "." if ( $v > 0 );
>         > >>         sleep 5;
>         > >>       } else {
>         > >>         my $result = $rc->next_result();
>         > >>         #save the output
>         > >>         print "saving to file";
>         > >>         my $filename = "contig_236.out"; #
>         $result->query_name()."\.out";
>         > >>         $factory->save_output($filename);
>         > >>         $factory->remove_rid($rid);
>         > >>         print "\nQuery Name: ", $result->query_name(),
>         "\n";
>         > >>         while ( my $hit = $result->next_hit ) {
>         > >>           next unless ( $v > 0);
>         > >>           print "\thit name is ", $hit->name, "\n";
>         > >>           while( my $hsp = $hit->next_hsp ) {
>         > >>             print "\t\tscore is ", $hsp->score, "\n";
>         > >>           }
>         > >>         }
>         > >>       }
>         > >>     }
>         > >>   }
>         > >> }
>         > >>
>         > >> But when I run this, I get an error in html format which
>         says "Cannot
>         > >> accept request, error code: -103". Attaching the error
>         file for reference.
>         > >> Can you please help me with debugging this error? Your
>         help is much
>         > >> appreciated.
>         > >>
>         > >> Also, informing about the previous error that I fixed by
>         adding this line:
>         > >> $Bio::Tools::Run::RemoteBlast::HEADER{'SERVICE'} =
>         'blastx'; The error that
>         > >> I was getting prior to adding this line was :
>         > >> --------------------- WARNING ---------------------
>         > >> MSG: <hr><p id="blastErr"><font color="red">An error has
>         occurred on the
>         > >> server, The server is unable to format right now, please
>         try again in a few
>         > >> minutes.  If the problem  (Informational Message: No
>         alias or index file
>         > >> found for protein database [nr/nt] in search path
>         > >>
>         [/export/home/splitd/blastdb/blast0:/blast/db/disk.blast/blast1::]) persists
>         > >> -  Contact Blast-help at ncbi.nlm.nih.gov and include your
>         RID:
>         > >> 4CF5MY9101P</font></p><hr>
>         > >>
>         > >> It kinda took me a while to find out the 2
>         requirements<http://www.bioperl.org/wiki/Module:Bio::Tools::Run::RemoteBlast>
>         > >>
>         > >> # 1) set your database like this:
>         > >> -database => 'cdsearch/cdd', # c.f.
>         http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html for other cdd database options
>         > >>
>         > >>
>         > >> # 2) add this line before submitting the job:
>         > >> $Bio::Tools::Run::RemoteBlast::HEADER{'SERVICE'} =
>         'rpsblast';
>         > >>
>         > >> I think it will be great if you can add this to the
>         synopsis section of
>         > >> RemoteBlast.pm
>         > >>
>         > >> Thanks,
>         > >> Sheetal
>         > >>
>         > > <log.html>_______________________________________________
>         > > Bioperl-l mailing list
>         > > Bioperl-l at lists.open-bio.org
>         > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>         >
>         >
>         
>         
> 

-------------- next part --------------
A non-text attachment was scrubbed...
Name: test.pl
Type: application/x-perl
Size: 2211 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20100723/322adab7/attachment-0001.bin>
-------------- next part --------------
>Foo My description here
AATCTGTTCCTGTTTTTTGAGCCCCTGGCGGGCAAACGGCATGCCAGGTCAGCGAGCGG
CGCACGAAGGTGGATTGGGCCCACGCCATGCGTCATCTGGCCGATGAACTGTACCCAGA
GGCAGACGTGATCGTTGTGGTGATGGACAATCTGAACCCGCACAGCCCGGCTTCCTTCT
CCGAGGCATTCGAGCCCGCCGAGGCGCAACGGCTCCGAGCACGCTTCGCGTTCCACTCC
ACGCCCAAGCACGGCAGTTGGCTGAATATGGCCGAGATTGAATTGCGTGCCTTGGTGAG
AAGCTGCCTGAATCGCCGGATTCCAGACCAGGCCACCCTGCATCGGGAGGTCCAGGCAT
GGGTGGAGGAGCGGAACCAAAAAGCCGTCCGAGTAGACTGGCGTTTCACCACCGCCAAT
GCCCGCATGAAACTGAAACATTTGTATCCAAAGATTCATGCTTGACAGAGTACTAGaCC
TGACCAAACTGGaKCWWCaSCWTTCCATATCCGAGGGCTTCAGTCCGACGGCTCGCGCG
GGATAGCGGATTTAATGCTCAATCTCCATCGAGCCCGACGGCTCGTGCGGGATAGCGGA
TTATAGCGGTTCTCAGATACGTTGACTCCTGTCCGGGTCTGCCGTGTCGTGCGAGGCGC
CCGTTTCCGCCACGCGCTCAGGGAGGGCTTATGGTCTTTGAGTAAATAATCCGCCATAG
CCCGCGCAGGCGGGCTTTGCATTCCATAGCCGCGGGCTTATGGTCTTTGAATAAATAAT
CCGCTACAGCCCGCGCAGGCGGGCTTCGCCTTGGCTAGCCGAGGGCTTCAGCCCCACGG
CTAGCGCGGGATAGCAGAATAAATTCTCAATCTCCATTAGCCCCACGGCAAGGGCGTAT
ACCGGATTTATTTCTCAATCTCCATCAGCCCGCACGCGCGGAGTCGCGCCCGCAGTTCT
CAGATGCGTTGACCCTTGTCCGGGTCTGCTGTGTCGCACAAGGCGCCCGCTTCCGCTGC
GCTCCCCATCTCCGCGCCTCCTCGCCTCCGCGTGAGCCGGTCTGATGCATGCGGAGACG
CAGAGCACACGGAGAGATGGCGCACAAGGCGTCTGCTTTCGCTGGCGTGTTCaAcCCTG
TCCAACAAGACCAATATTTAGTGAGAACTGCTATATTTCTCACATATATCGGCAGCGTC
AGCGAAGCGGTGATTGTGCAGACGGACGCTGCCGGACGACCGCAGGCGCTGGTAACGAT
GAGCCGGTCGGGTATTGCGCCTGGGTTTGTAACGCGCGGCGAACCCGGTCTGCTTCTTG
CGGCAACAGYGTGTCCACCTGTGTCTGCAAAGCTCGACGAACGCTGTCACTCCCTTCAC
GCAGCCaatAAtcgTATATCTGTTTCTTCAACGCTTGACGAACTTTATCCTCTTCTTGA
GACAGGAACTCGTTCACCCGGCTTTGCAACGCATGGCGAACGTCGCTTTCCGCCTGACT
CAGCTGACTCTTTACCCGATCTTGCAACGCCGCGCGGAATTGGCTTTCCGTTTGACGCA
TCAAATCATTCATCTTTGCCTGGAACGCCTGGAGCCATTCACTCTTTACTTGATCCAAC
AGCTCTGCAGCGTGATTCTGCAATGTCTCGTGAACCCGGTCTTGCTCTTGCTCCAGTAG
CGCTGCAACCTGGGTCTGTAATGCGCTGCGGACGTCACCCTTCTCTTGACGTACCAGTT
CTGT


More information about the Bioperl-l mailing list