[Bioperl-l] Alignment from blast report

Chris Fields cjfields at illinois.edu
Mon Mar 1 19:30:43 EST 2010


Paolo,

You can get a Bio::SimpleAlign from the HSP object.  The first code example in this section in the HOWTO demonstrates this:

http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_the_methods

chris

On Mar 1, 2010, at 5:07 PM, Paolo Pavan wrote:

> Dear all,
> Sorry for pushing up my post but, please does anyone have an hint for me?
> Maybe have I to send attached the report to the mailing list? I don't
> know attachment policies of the list, if it is allowed and is needed I
> can do that.
> 
> Thank you,
> Paolo
> 
> 2010/2/26 Paolo Pavan <paolo.pavan at gmail.com>:
>> Sorry,
>> Maybe I forgot to add this is the megablast -m 5 output.
>> 
>> Thank you again,
>> Paolo
>> 
>> 2010/2/26 Paolo Pavan <paolo.pavan at gmail.com>:
>>> Hi all,
>>> I have just a brief question: I've got some megablast reports such the
>>> one I've pasted below.
>>> I'm aware of the existence of the Bio::Search::IO::megablast and the
>>> Bio::Search::HSP::BlastHSP::get_aln but, is there a way to get the
>>> entire alignment represented as a Bio::SimpleAlign object or
>>> Bio::Align::AlignI implementing one?
>>> 
>>> Thank you all,
>>> Paolo
>>> 
>>> 
>>> MEGABLAST 2.2.16 [Mar-25-2007]
>>> 
>>> 
>>> Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000),
>>> "A greedy algorithm for aligning DNA sequences",
>>> J Comput Biol 2000; 7(1-2):203-14.
>>> 
>>> Database: 00038-00053.fasta
>>>            2 sequences; 2001 total letters
>>> 
>>> Searching..................................................done
>>> 
>>> Query= 00038-00053
>>>          (802 letters)
>>> 
>>> 
>>> 
>>>                                                                  Score    E
>>> Sequences producing significant alignments:                      (bits) Value
>>> 
>>> ______00038
>>> 226   1e-62
>>> ______00053
>>> 115   3e-29
>>> 
>>> 1_0         472
>>> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 531
>>> ______00038 883
>>> ccgacaataattcttgttggaatcttcggcagttttttgtacaggagccagtagttcaaa 942
>>> ______00053      ------------------------------------------------------------
>>> 
>>> 1_0         532
>>> aagaaagcgatcaataaaa-taaaaatcacaaaaaaattaccaaaaacatatttataaat 590
>>> ______00038 943
>>> aagaaagcgatcaataaaaataaaaatcacaaaaaaattaccaaaaacatatttataaa- 1001
>>> ______00053      ------------------------------------------------------------
>>> 
>>> 1_0         591
>>> attggcaaaaaaattgccaacaattcccaaacggaaaattcccaaaacaaagagagcgtc 650
>>> ______00038 1000
>>> ------------------------------------------------------------ 1001
>>> ______00053      ------------------------------------------------------------
>>> 
>>> 1_0         651
>>> gataaccaatatcaaaatagtttttgaatttattttttgtgtttttttagtttttcttct 710
>>> ______00038 1000
>>> ------------------------------------------------------------ 1001
>>> ______00053      ------------------------------------------------------------
>>> 
>>> 1_0         711
>>> acgtcgtgttgccatttatccagcattaagtctataaaaaaaaacggtcagataaaaatg 770
>>> ______00038 1000
>>> ------------------------------------------------------------ 1001
>>> ______00053 1    -------------------------ttaagtctataaaaaaaa-cggtcagataaaaatg 34
>>> 
>>> 1_0         771  ccttaagtatttactttaacttgtcttgatca 802
>>> ______00038 1000 -------------------------------- 1001
>>> ______00053 35   ccttaagtatt-actttaacttgtcttgatca 65
>>>   Database: 00038-00053.fasta
>>>     Posted date:  Feb 25, 2010  4:47 PM
>>>   Number of letters in database: 2001
>>>   Number of sequences in database:  2
>>> 
>>> Lambda     K      H
>>>     1.37    0.711     1.31
>>> 
>>> Gapped
>>> Lambda     K      H
>>>     1.37    0.711     1.31
>>> 
>>> 
>>> Matrix: blastn matrix:1 -3
>>> Gap Penalties: Existence: 0, Extension: 0
>>> Number of Sequences: 2
>>> Number of Hits to DB: 17
>>> Number of extensions: 3
>>> Number of successful extensions: 3
>>> Number of sequences better than 10.0: 2
>>> Number of HSP's gapped: 2
>>> Number of HSP's successfully gapped: 2
>>> Length of query: 802
>>> Length of database: 2001
>>> Length adjustment: 10
>>> Effective length of query: 792
>>> Effective length of database: 1981
>>> Effective search space:  1568952
>>> Effective search space used:  1568952
>>> X1: 9 (17.8 bits)
>>> X2: 20 (39.6 bits)
>>> X3: 51 (101.1 bits)
>>> S1: 9 (18.3 bits)
>>> S2: 9 (18.3 bits)
>>> 
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




More information about the Bioperl-l mailing list