[Bioperl-l] standaloneblastplus

sally roberts elanorbust2 at yahoo.com
Thu Sep 9 12:10:06 EDT 2010


I am running a test for standaloneblastplus but getting data back that does not exist in my query or my local database. Below is a outline of my script small database, query list, and erroneous results. As you will notice the query list is comprised of the first four sequences found in the database. The results say it can not find the first two and then the mathces for the last two do not exist!

Thanks for any help! 



Program 


#!/usr/bin/perl

use Bio::Tools::Run::StandAloneBlastPlus;


$fac = Bio::Tools::Run::StandAloneBlastPlus->new(
  -db_name => 'ITS',
  -db_data => 'smallDB.fas',
  -create => 1
);

$result = $fac->blastn( -query => , 'sequences.fasta',
                        -outfile => 'ITStest2.bls');


smallDB.fas Data

>302585252|HM807352|Waitea circinata  internal transcribed spacer 1
ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGCACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGTTTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA

>302585252|HM807352|Waitea circinata  internal transcribed spacer 2
GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTTCTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTAGACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA

>302585250|HM802273|Fusarium oxysporum  contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"
CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC

>302585249|HM802272|Fusarium oxysporum  contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"
GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAGGAA

>302585248|HM802271|Fusarium oxysporum  contains 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, and 28S ribosomal RNA"
CCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCATTAAAGCGGAGGAA

>301333053|GU725064|Xiphinema turcicum  internal transcribed spacer 1
GGAGAGATTATATCTTTCTCGAAAAGAGAAAAAATATCCGAGCCGAGCGAACCGACCGAAAAACGCGGTGAGGCGCCTTTTGCGCAAAGTCCGTACGTCGGTTCTTAGCGAATATAGCCTCGGCCTGGGACCCGAAAGATGTTTCCTATATGTATCTCGAGACCGACCGTTTAAGACGGTAGCCGGAAAAAAGATTATACCGTGGGTGAAGGTGTCGAAAAGAATAATGTAGGTAAAAAAGAAAGACAGACAGAGGAGAGAAAGAACGAAAGTAGAACTCGAACGTAGTTTGAGCTACGCAGTAACGGTATCCGTCGTGGGACATCGCGGTGCGTCGGTTGTAGGGAGTTAAGATTACCTACCCGACACCTCGATATTAATCCCGCGCGAATAAATGCGGATTACCGTGAATGTACGCTCTGCTTCGATATCGGGCTTCTTTTGACACCGAAAATATATATATGAATAAAAATAAAGTCACCCTCGTTGCAACGGTATATATCAAAGCGGTTTTCCGTGAAAAGAAAGAAGGCGGCTTCGGTTCTCGTTATATTAGGAATAATCTAAGTAATTTCAGACGTCCCGGGAATCGTTACTATAGATAGAGAGCGATAGTAACGGTTTCTCCTTCGGGTACTTATCGAACGTTAACACTGCGGTAATCCGTCTGGCCGCAAGGAGAGAGGTGTTACGTTCGGCAGCCCTAAATTTCGACCCGTTCGACTAATGCGACGGCCCTACCGAGAAAATGTAGGGCCTATGTACATAGTCCGAAAGAAATACGATCGGAATATTAAGGGTTAGGTTTAAAGAGTCATCGGTTCCGAGTACGCGTTCGTTCGGCACGATGCGTGTGTGTATATATCGTAGAGGAGTATTGACGATATATATGTATGCGTATTCGCCCTTACGATAAGAGAATATCGCGTAATTCGGAGCGGCCGTTCTTCGCGAGAGAGAGAACGCA
CGCGTTAGAAGCTTACGAGTCGGTGTTAAGTTCGAAGGAGAGAGGTTCGAACCGAAGCCGGCGAGTACGCGTTAAGTCGTTTCGCGAGAGACGGTCCGGGACGAAAAGGAGAGAGTATCGTCCGGGTGTCCGCCCGAAATAGATATCTTATCGAGAATATTTTTATATAGTTCGTTAGAAAGAATGCGAACTTTAAA

>301333052|GU725063|Xiphinema adenohystherum  internal transcribed spacer 1
AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCGCTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGATCTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGTCGAGTTTCTTTCCGGGGTTCTTTGAGTTTATTGGGACAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAGTCTCGTGAACACGAGCCCGGGAATAGAAGAGACTCGGCTGATAACGACCGACTATATCTCGTTATATACTCAGAGTTGAATAACTGAGTGGCTCGAAACGGCGACATTGTACTTACTATTTTATGTAGACTCTGGAAATATCAGACGTCCCGGGGAATCGTTACAGAGGAAATATAGGGTACCTGGAAAAAGAATGGTACCCGTTCCTGTAATGATTCCTTATTCGGGTACCTATCGAATACTAACGGCGCGGATCCCCCGTCTGGCCGCGACGGAATAAGCGTTAGATTCGGTATCCCTATATTCGCGAGTATTCGACTAGTCATGAAATAGAGCCCTTATCGGGGTATCGACTGTCGATCGGATAGAAAGCGAATTAGGGTTAGGTTTAAAGAGTCATTGGTTCCGTATATATGGGTGGAACGTACCCGTAAAGGAACAGCCGTAGACGCGAGTTCGGAAATAAGTATATTCTCGCGAGAAAGAGGGTCCGTGTACCTTCAAGGTACTTGAATTTAGACCCAGTCTCGTGAATATACGTAACTCGTCGAATGGCTCGGGACATGTAGAATACTATGTCCGGGTGACCGCCCGAAATAAGAATATTCATCAGAAACTTTTATATATAGTTCGCCGAATAATAGCGAAC

>301333051|GU725062|Xiphinema sphaerocephalum  internal transcribed spacer 1
AAAGTCGAAAAAATATACTTTCTCGCGGAGAAATAATACGGACCGTTCAGTCCGACTCTATACGCGGTAAGGCGCTCTTGCGCGAGAGCCCGCTGTCGGTTCTGACGGTCCGGACCCCGAAAAGTAGTAAGTACGACTACGATATATCGTGGTCGAGTATCGGTTAGTAATAGTATATCGGGACTGACCGATCGGTCGGTCGAGTTTCTACCGGCTTCTTTGAGTCTATTCGGGCAGCGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTGTAGAACTCGTGAATTCGAGCTCGGTAACCGGGAACTCGGCTGAGAACGACCGATTACTTCTCGATACGCTCGAACGTATATATCTAACCGAGAAAAGGCGACGTTGTACTTACTATTTATATCAGACGTCCCGAGAGTCGTTACGGTCGGAAATATTGGGTACCGGTATCGGACCCGTTTCCGTATCGGCTCTTTATTCGGGTACCTATCGAATACTAACGCCGCGGTTCACCGTCTGGCCGCGACGGAATACGCGTTAGATTCGGCACCCCCTATATTCGTATATATATCGACTAGTCTCGAAATAGAGCCCTTACTAGGGTGAAGACTATGTCGATCGGAAAGAATCGGATTAGGGGTAGGTTTAAAGAGTCATCGGTTCCGTGTATCCGGGCGAAATATATACCCGTAACGGAACGACCGTTGACGCGAGTTTGAAGATATATACATGTACGTATATGAGACAAAAAAACGAGGGTCTGTACCGTGAATTTTTTAGGTACCGAAAAGAGGACCCCCGGTCTCGTGAATATGTATTACTCGCCGAACGGTTCGGGACATGGAGAATATTATGTCCGGGTGACCGCCCGAAATAGAAATTTTTTTCTATAAAGTTTTGATATACGTATAGTTCGTCGAATAAAAGC

>301333050|GU725061|Xiphinema hispanum  internal transcribed spacer 1
AAAGCCGAAAAATATATACTTTCTCAGAGAAATACTAGACTAGTCGATTCCGACTTGATTCGCGGTAAGGCGCTTTCGCGCGATAGCCCGCTGTCGGTTCCGACCGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGATCTCGGTTAGAAATTGTATATATGTCGGGACGGATCGGTCGGTCGAGTTCCTTTCGGTGTTCTTAGAGTTTATTCGGGCAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTTAGAACCCGGAATAGAGGGAACTCGGCTGATAACGACCGACTTATGTCTCGCCGTATACCGTGAGTTATTTGACCGAGTGGCTCGAAACGGCGGTATTGTACTTACTATTTATCTAGTCTCTGGAAATATCAGACGTCCCGGGAATCGTTACAGCGGAAATATAGGGTACCCGAAAAACTGGTACCCGTTTCTGAAACGACTCCTTATTCGGGTACCTATCGAATACTAACGCCGCAGTTTCCCGTCTGGCTGCGATGGAAAAAGCGTTAGATTCGGGATCTCTATATTCGCGGGTGTTCGATTAGTCGTGAAATACAGCCCTTACGCGGGTGACGACGGTCGATCGGAAAGAAAGCGAATTAGGGTTAGGTTTAAAGAGTCATTGGTTCCGTGTACGGGCGAAAAAGTACCCGTTACGGAACGGCCGTCGACGCGAGTGTGGAAATAAGTATATAGTTACGAGAAAGAGGGTCTGTACCTCGGAGTTTTTTGAAGGTACCGTAATCAGGACCCTGTCTCGTGAATATACAAGTTACTCGCCGAACGGTTCGGCCAATGTAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTTCATAAAAAGCTTTTATATATAGTTTGCCGAATAATAGCAAACG

>301333049|GU725060|Xiphinema pyrenaicum  internal transcribed spacer 1
AAAGCGGAAAAATTACTTTCTCACCCGGAAAAAACAGACCGTTTATCGGTCCGACTTGAAACGCGGTAAGGCGCTCTTGCGCGATAGCCCGCCGTCGGTTCCGATGGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGATTCTCGGTTAGTAGTATATCCGGTCGGATCGATATATATCGGTCGGTCGAGTTTCTATCGGGTTCTTTGAGTTTCTTCGGACAGCGTCGGTTGTAGTGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTCTAGCCCGATAATAATACGGAACTCGGCTGAGAACGACCGACTTAGGTCTGAGTAGATATACTGAGAATATTACCTAGCCGAGATGAACGAAACGGCGACATTGGAGTTTTACTATTTACTCGTATCAGACGTCCCGGGAATCGTTGCAGTTGAATTACATATATACGGGTACCTGTAATTGGACTCGTTTCTGTAACGGTTCTTTAGTCGGGTACCTATCGAATACTAACGCCGCGGTTATCCGTCTGGCCGCGATGGAATAAGCGTTAGATTCGGCATCCCTTTATTCGTATACGTTCGAGTAGTCGTGAATTAGAACCCTTTAACCGGGGTGAAGACTATCGACGGGAGATAAGCGAATTAGGGGTAGGTTTAAAGAGTCATCGGTTCCGGATACGGAGAGAAAAATGCCCGTAATGGAACGACCATTGAAGCGGGATCTATATATATATATATATGATTCGCCCGATGGTTCGGGACATGGAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTTACTTCAAAGTTATTTATATATAGTTCGCCTTATAAGAGCGAACG



sequences.fasta data

>Test1
ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGCACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGTTTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA

>Test2
GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTTCTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTAGACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA

>Test3
CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC

>Test4
GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAGGAA




Results

BLASTN 2.2.24+


Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
Miller (2000), "A greedy algorithm for aligning DNA sequences", J
Comput Biol 2000; 7(1-2):203-14.



Database: ITS
           5 sequences; 1,102 total letters



Query=  Test1
Length=204


***** No hits found *****



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 202071


Query=  Test2
Length=192


***** No hits found *****



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 189507


Query=  Test3
Length=437
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...   300    2e-085
dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  69.4    6e-016
dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  58.4    1e-012
dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  56.5    4e-012


>dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G59F
Length=203

 Score =  300 bits (162),  Expect = 2e-085
 Identities = 176/182 (96%), Gaps = 4/182 (2%)
 Strand=Plus/Plus

Query  10   TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATC  66
            ||||||||||| | |||||| |||||| |||||||| |||| ||||||||||||||||||
Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACAT-ACCACTTGTTGCCTCGGCGGATC  81

Query  67   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT  126
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  82   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT  141

Query  127  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  186
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  142  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  201

Query  187  GG  188
            ||
Sbjct  202  GG  203


>dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G64F
Length=217

 Score = 69.4 bits (37),  Expect = 6e-016
 Identities = 39/40 (97%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  149  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  188
            ||||| ||||||||||||||||||||||||||||||||||
Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217


>dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G60F
Length=206

 Score = 58.4 bits (31),  Expect = 1e-012
 Identities = 39/42 (92%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  146  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  186
            |||| || ||| ||||||||||||||||||||||||||||||
Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204


>dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G65F
Length=256

 Score = 56.5 bits (30),  Expect = 4e-012
 Identities = 30/30 (100%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  157  AAAACTTTCAACAACGGATCTCTTGGTTCT  186
            ||||||||||||||||||||||||||||||
Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 442850


Query=  Test4
Length=521
                                                                      Score     E
Sequences producing significant alignments:                          (Bits)  Value

dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...   309    4e-088
dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  69.4    7e-016
dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  58.4    1e-012
dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...  56.5    5e-012


>dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G59F
Length=203

 Score =  309 bits (167),  Expect = 4e-088
 Identities = 177/181 (97%), Gaps = 3/181 (1%)
 Strand=Plus/Plus

Query  7    TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCA  63
            ||||||||||| | |||||| |||||| ||||||||||||||||||||||||||||||||
Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACATACCACTTGTTGCCTCGGCGGATCA  82

Query  64   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG  123
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  83   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG  142

Query  124  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG  183
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  143  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG  202

Query  184  G  184
            |
Sbjct  203  G  203


>dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G64F
Length=217

 Score = 69.4 bits (37),  Expect = 7e-016
 Identities = 39/40 (97%), Gaps = 0/40 (0%)
 Strand=Plus/Plus

Query  145  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  184
            ||||| ||||||||||||||||||||||||||||||||||
Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217


>dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G60F
Length=206

 Score = 58.4 bits (31),  Expect = 1e-012
 Identities = 39/42 (92%), Gaps = 3/42 (7%)
 Strand=Plus/Plus

Query  142  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  182
            |||| || ||| ||||||||||||||||||||||||||||||
Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204


>dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA, partial 
sequence, clone: G65F
Length=256

 Score = 56.5 bits (30),  Expect = 5e-012
 Identities = 30/30 (100%), Gaps = 0/30 (0%)
 Strand=Plus/Plus

Query  153  AAAACTTTCAACAACGGATCTCTTGGTTCT  182
            ||||||||||||||||||||||||||||||
Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254



Lambda     K      H
    1.33    0.621     1.12 

Gapped
Lambda     K      H
    1.28    0.460    0.850 

Effective search space used: 530378


  Database: ITS
    Posted date:  Aug 27, 2010  9:43 AM
  Number of letters in database: 1,102
  Number of sequences in database:  5



Matrix: blastn matrix 1 -2
Gap Penalties: Existence: 0, Extension: 2.5






      


More information about the Bioperl-l mailing list