[Bioperl-l] standaloneblastplus

Smithies, Russell Russell.Smithies at agresearch.co.nz
Thu Sep 9 18:54:43 EDT 2010


Is that a typo in your email or are some of your fasta headers in your db incorrect?
Eg.
>301333052|GU725063|Xiphinema adenohystherum  internal transcribed
>301333052|GU725063|spacer 1
AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCGCTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGATCTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGT

Shouldn't that be:
>301333052|GU725063|Xiphinema adenohystherum  internal transcribed spacer 1
AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCGCTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGATCTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGT

Maybe the invalid fasta headers are breaking the db formatter?


Russell Smithies

Technical Support
T +64 3 489 9085
E  russell.smithies at agresearch.co.nz
Invermay  Research Centre
Puddle Alley,
Mosgiel,
New Zealand
T  +64 3 489 3809
F  +64 3 489 9174
www.agresearch.co.nz

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> bounces at lists.open-bio.org] On Behalf Of sally roberts
> Sent: Friday, 10 September 2010 4:10 a.m.
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] standaloneblastplus
>
> I am running a test for standaloneblastplus but getting data back that
> does not exist in my query or my local database. Below is a outline of my
> script small database, query list, and erroneous results. As you will
> notice the query list is comprised of the first four sequences found in
> the database. The results say it can not find the first two and then the
> mathces for the last two do not exist!
>
> Thanks for any help!
>
>
>
> Program
>
>
> #!/usr/bin/perl
>
> use Bio::Tools::Run::StandAloneBlastPlus;
>
>
> $fac = Bio::Tools::Run::StandAloneBlastPlus->new(
>   -db_name => 'ITS',
>   -db_data => 'smallDB.fas',
>   -create => 1
> );
>
> $result = $fac->blastn( -query => , 'sequences.fasta',
>                         -outfile => 'ITStest2.bls');
>
>
> smallDB.fas Data
>
> >302585252|HM807352|Waitea circinata  internal transcribed spacer 1
> ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGC
> ACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGT
> TTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA
>
> >302585252|HM807352|Waitea circinata  internal transcribed spacer 2
> GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTT
> CTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTA
> GACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA
>
> >302585250|HM802273|Fusarium oxysporum  contains 18S ribosomal RNA,
> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
> spacer 2, and 28S ribosomal RNA"
> CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCT
> CCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATA
> AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTA
> ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCAT
> GCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGC
> CGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC
>
> >302585249|HM802272|Fusarium oxysporum  contains 18S ribosomal RNA,
> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
> spacer 2, and 28S ribosomal RNA"
> GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCG
> GTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATA
> AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGT
> GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCT
> GTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGAT
> TGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTA
> AACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAG
> GAA
>
> >302585248|HM802271|Fusarium oxysporum  contains 18S ribosomal RNA,
> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
> spacer 2, and 28S ribosomal RNA"
> CCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCC
> CGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAA
> TAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAAT
> GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGC
> CTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCG
> GCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGC
> GCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGC
> ATATCATTAAAGCGGAGGAA
>
> >301333053|GU725064|Xiphinema turcicum  internal transcribed spacer 1
> GGAGAGATTATATCTTTCTCGAAAAGAGAAAAAATATCCGAGCCGAGCGAACCGACCGAAAAACGCGGTGAGGC
> GCCTTTTGCGCAAAGTCCGTACGTCGGTTCTTAGCGAATATAGCCTCGGCCTGGGACCCGAAAGATGTTTCCTA
> TATGTATCTCGAGACCGACCGTTTAAGACGGTAGCCGGAAAAAAGATTATACCGTGGGTGAAGGTGTCGAAAAG
> AATAATGTAGGTAAAAAAGAAAGACAGACAGAGGAGAGAAAGAACGAAAGTAGAACTCGAACGTAGTTTGAGCT
> ACGCAGTAACGGTATCCGTCGTGGGACATCGCGGTGCGTCGGTTGTAGGGAGTTAAGATTACCTACCCGACACC
> TCGATATTAATCCCGCGCGAATAAATGCGGATTACCGTGAATGTACGCTCTGCTTCGATATCGGGCTTCTTTTG
> ACACCGAAAATATATATATGAATAAAAATAAAGTCACCCTCGTTGCAACGGTATATATCAAAGCGGTTTTCCGT
> GAAAAGAAAGAAGGCGGCTTCGGTTCTCGTTATATTAGGAATAATCTAAGTAATTTCAGACGTCCCGGGAATCG
> TTACTATAGATAGAGAGCGATAGTAACGGTTTCTCCTTCGGGTACTTATCGAACGTTAACACTGCGGTAATCCG
> TCTGGCCGCAAGGAGAGAGGTGTTACGTTCGGCAGCCCTAAATTTCGACCCGTTCGACTAATGCGACGGCCCTA
> CCGAGAAAATGTAGGGCCTATGTACATAGTCCGAAAGAAATACGATCGGAATATTAAGGGTTAGGTTTAAAGAG
> TCATCGGTTCCGAGTACGCGTTCGTTCGGCACGATGCGTGTGTGTATATATCGTAGAGGAGTATTGACGATATA
> TATGTATGCGTATTCGCCCTTACGATAAGAGAATATCGCGTAATTCGGAGCGGCCGTTCTTCGCGAGAGAGAGA
> ACGCA
> CGCGTTAGAAGCTTACGAGTCGGTGTTAAGTTCGAAGGAGAGAGGTTCGAACCGAAGCCGGCGAGTACGCGTTA
> AGTCGTTTCGCGAGAGACGGTCCGGGACGAAAAGGAGAGAGTATCGTCCGGGTGTCCGCCCGAAATAGATATCT
> TATCGAGAATATTTTTATATAGTTCGTTAGAAAGAATGCGAACTTTAAA
>
> >301333052|GU725063|Xiphinema adenohystherum  internal transcribed spacer
> 1
> AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCG
> CTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGAT
> CTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGTCGAGTTTCTTTCCGGGGTTCTTTGAGTTTATTG
> GGACAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAGTCTCGTGAACACGAGCCCGGGA
> ATAGAAGAGACTCGGCTGATAACGACCGACTATATCTCGTTATATACTCAGAGTTGAATAACTGAGTGGCTCGA
> AACGGCGACATTGTACTTACTATTTTATGTAGACTCTGGAAATATCAGACGTCCCGGGGAATCGTTACAGAGGA
> AATATAGGGTACCTGGAAAAAGAATGGTACCCGTTCCTGTAATGATTCCTTATTCGGGTACCTATCGAATACTA
> ACGGCGCGGATCCCCCGTCTGGCCGCGACGGAATAAGCGTTAGATTCGGTATCCCTATATTCGCGAGTATTCGA
> CTAGTCATGAAATAGAGCCCTTATCGGGGTATCGACTGTCGATCGGATAGAAAGCGAATTAGGGTTAGGTTTAA
> AGAGTCATTGGTTCCGTATATATGGGTGGAACGTACCCGTAAAGGAACAGCCGTAGACGCGAGTTCGGAAATAA
> GTATATTCTCGCGAGAAAGAGGGTCCGTGTACCTTCAAGGTACTTGAATTTAGACCCAGTCTCGTGAATATACG
> TAACTCGTCGAATGGCTCGGGACATGTAGAATACTATGTCCGGGTGACCGCCCGAAATAAGAATATTCATCAGA
> AACTTTTATATATAGTTCGCCGAATAATAGCGAAC
>
> >301333051|GU725062|Xiphinema sphaerocephalum  internal transcribed spacer
> 1
> AAAGTCGAAAAAATATACTTTCTCGCGGAGAAATAATACGGACCGTTCAGTCCGACTCTATACGCGGTAAGGCG
> CTCTTGCGCGAGAGCCCGCTGTCGGTTCTGACGGTCCGGACCCCGAAAAGTAGTAAGTACGACTACGATATATC
> GTGGTCGAGTATCGGTTAGTAATAGTATATCGGGACTGACCGATCGGTCGGTCGAGTTTCTACCGGCTTCTTTG
> AGTCTATTCGGGCAGCGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTGTAGAACTCGTGAATTC
> GAGCTCGGTAACCGGGAACTCGGCTGAGAACGACCGATTACTTCTCGATACGCTCGAACGTATATATCTAACCG
> AGAAAAGGCGACGTTGTACTTACTATTTATATCAGACGTCCCGAGAGTCGTTACGGTCGGAAATATTGGGTACC
> GGTATCGGACCCGTTTCCGTATCGGCTCTTTATTCGGGTACCTATCGAATACTAACGCCGCGGTTCACCGTCTG
> GCCGCGACGGAATACGCGTTAGATTCGGCACCCCCTATATTCGTATATATATCGACTAGTCTCGAAATAGAGCC
> CTTACTAGGGTGAAGACTATGTCGATCGGAAAGAATCGGATTAGGGGTAGGTTTAAAGAGTCATCGGTTCCGTG
> TATCCGGGCGAAATATATACCCGTAACGGAACGACCGTTGACGCGAGTTTGAAGATATATACATGTACGTATAT
> GAGACAAAAAAACGAGGGTCTGTACCGTGAATTTTTTAGGTACCGAAAAGAGGACCCCCGGTCTCGTGAATATG
> TATTACTCGCCGAACGGTTCGGGACATGGAGAATATTATGTCCGGGTGACCGCCCGAAATAGAAATTTTTTTCT
> ATAAAGTTTTGATATACGTATAGTTCGTCGAATAAAAGC
>
> >301333050|GU725061|Xiphinema hispanum  internal transcribed spacer 1
> AAAGCCGAAAAATATATACTTTCTCAGAGAAATACTAGACTAGTCGATTCCGACTTGATTCGCGGTAAGGCGCT
> TTCGCGCGATAGCCCGCTGTCGGTTCCGACCGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGATC
> TCGGTTAGAAATTGTATATATGTCGGGACGGATCGGTCGGTCGAGTTCCTTTCGGTGTTCTTAGAGTTTATTCG
> GGCAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTTAGAACCCGGAA
> TAGAGGGAACTCGGCTGATAACGACCGACTTATGTCTCGCCGTATACCGTGAGTTATTTGACCGAGTGGCTCGA
> AACGGCGGTATTGTACTTACTATTTATCTAGTCTCTGGAAATATCAGACGTCCCGGGAATCGTTACAGCGGAAA
> TATAGGGTACCCGAAAAACTGGTACCCGTTTCTGAAACGACTCCTTATTCGGGTACCTATCGAATACTAACGCC
> GCAGTTTCCCGTCTGGCTGCGATGGAAAAAGCGTTAGATTCGGGATCTCTATATTCGCGGGTGTTCGATTAGTC
> GTGAAATACAGCCCTTACGCGGGTGACGACGGTCGATCGGAAAGAAAGCGAATTAGGGTTAGGTTTAAAGAGTC
> ATTGGTTCCGTGTACGGGCGAAAAAGTACCCGTTACGGAACGGCCGTCGACGCGAGTGTGGAAATAAGTATATA
> GTTACGAGAAAGAGGGTCTGTACCTCGGAGTTTTTTGAAGGTACCGTAATCAGGACCCTGTCTCGTGAATATAC
> AAGTTACTCGCCGAACGGTTCGGCCAATGTAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTTCAT
> AAAAAGCTTTTATATATAGTTTGCCGAATAATAGCAAACG
>
> >301333049|GU725060|Xiphinema pyrenaicum  internal transcribed spacer 1
> AAAGCGGAAAAATTACTTTCTCACCCGGAAAAAACAGACCGTTTATCGGTCCGACTTGAAACGCGGTAAGGCGC
> TCTTGCGCGATAGCCCGCCGTCGGTTCCGATGGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGAT
> TCTCGGTTAGTAGTATATCCGGTCGGATCGATATATATCGGTCGGTCGAGTTTCTATCGGGTTCTTTGAGTTTC
> TTCGGACAGCGTCGGTTGTAGTGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTCTAGCCCG
> ATAATAATACGGAACTCGGCTGAGAACGACCGACTTAGGTCTGAGTAGATATACTGAGAATATTACCTAGCCGA
> GATGAACGAAACGGCGACATTGGAGTTTTACTATTTACTCGTATCAGACGTCCCGGGAATCGTTGCAGTTGAAT
> TACATATATACGGGTACCTGTAATTGGACTCGTTTCTGTAACGGTTCTTTAGTCGGGTACCTATCGAATACTAA
> CGCCGCGGTTATCCGTCTGGCCGCGATGGAATAAGCGTTAGATTCGGCATCCCTTTATTCGTATACGTTCGAGT
> AGTCGTGAATTAGAACCCTTTAACCGGGGTGAAGACTATCGACGGGAGATAAGCGAATTAGGGGTAGGTTTAAA
> GAGTCATCGGTTCCGGATACGGAGAGAAAAATGCCCGTAATGGAACGACCATTGAAGCGGGATCTATATATATA
> TATATATGATTCGCCCGATGGTTCGGGACATGGAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTT
> ACTTCAAAGTTATTTATATATAGTTCGCCTTATAAGAGCGAACG
>
>
>
> sequences.fasta data
>
> >Test1
> ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGC
> ACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGT
> TTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA
>
> >Test2
> GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTT
> CTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTA
> GACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA
>
> >Test3
> CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCT
> CCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATA
> AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTA
> ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCAT
> GCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGC
> CGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC
>
> >Test4
> GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCG
> GTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATA
> AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGT
> GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCT
> GTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGAT
> TGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTA
> AACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAG
> GAA
>
>
>
>
> Results
>
> BLASTN 2.2.24+
>
>
> Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
> Miller (2000), "A greedy algorithm for aligning DNA sequences", J
> Comput Biol 2000; 7(1-2):203-14.
>
>
>
> Database: ITS
>            5 sequences; 1,102 total letters
>
>
>
> Query=  Test1
> Length=204
>
>
> ***** No hits found *****
>
>
>
> Lambda     K      H
>     1.33    0.621     1.12
>
> Gapped
> Lambda     K      H
>     1.28    0.460    0.850
>
> Effective search space used: 202071
>
>
> Query=  Test2
> Length=192
>
>
> ***** No hits found *****
>
>
>
> Lambda     K      H
>     1.33    0.621     1.12
>
> Gapped
> Lambda     K      H
>     1.28    0.460    0.850
>
> Effective search space used: 189507
>
>
> Query=  Test3
> Length=437
>
> Score     E
> Sequences producing significant alignments:
> (Bits)  Value
>
> dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 300    2e-085
> dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 69.4    6e-016
> dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 58.4    1e-012
> dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 56.5    4e-012
>
>
> >dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G59F
> Length=203
>
>  Score =  300 bits (162),  Expect = 2e-085
>  Identities = 176/182 (96%), Gaps = 4/182 (2%)
>  Strand=Plus/Plus
>
> Query  10   TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATC
> 66
>             ||||||||||| | |||||| |||||| |||||||| |||| ||||||||||||||||||
> Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACAT-ACCACTTGTTGCCTCGGCGGATC
> 81
>
> Query  67   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT
> 126
>             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct  82   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT
> 141
>
> Query  127  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
> 186
>             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct  142  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
> 201
>
> Query  187  GG  188
>             ||
> Sbjct  202  GG  203
>
>
> >dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G64F
> Length=217
>
>  Score = 69.4 bits (37),  Expect = 6e-016
>  Identities = 39/40 (97%), Gaps = 0/40 (0%)
>  Strand=Plus/Plus
>
> Query  149  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  188
>             ||||| ||||||||||||||||||||||||||||||||||
> Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217
>
>
> >dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G60F
> Length=206
>
>  Score = 58.4 bits (31),  Expect = 1e-012
>  Identities = 39/42 (92%), Gaps = 3/42 (7%)
>  Strand=Plus/Plus
>
> Query  146  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  186
>             |||| || ||| ||||||||||||||||||||||||||||||
> Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204
>
>
> >dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G65F
> Length=256
>
>  Score = 56.5 bits (30),  Expect = 4e-012
>  Identities = 30/30 (100%), Gaps = 0/30 (0%)
>  Strand=Plus/Plus
>
> Query  157  AAAACTTTCAACAACGGATCTCTTGGTTCT  186
>             ||||||||||||||||||||||||||||||
> Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254
>
>
>
> Lambda     K      H
>     1.33    0.621     1.12
>
> Gapped
> Lambda     K      H
>     1.28    0.460    0.850
>
> Effective search space used: 442850
>
>
> Query=  Test4
> Length=521
>
> Score     E
> Sequences producing significant alignments:
> (Bits)  Value
>
> dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 309    4e-088
> dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 69.4    7e-016
> dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 58.4    1e-012
> dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
> 56.5    5e-012
>
>
> >dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G59F
> Length=203
>
>  Score =  309 bits (167),  Expect = 4e-088
>  Identities = 177/181 (97%), Gaps = 3/181 (1%)
>  Strand=Plus/Plus
>
> Query  7    TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCA
> 63
>             ||||||||||| | |||||| |||||| ||||||||||||||||||||||||||||||||
> Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACATACCACTTGTTGCCTCGGCGGATCA
> 82
>
> Query  64   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG
> 123
>             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct  83   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG
> 142
>
> Query  124  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG
> 183
>             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct  143  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG
> 202
>
> Query  184  G  184
>             |
> Sbjct  203  G  203
>
>
> >dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G64F
> Length=217
>
>  Score = 69.4 bits (37),  Expect = 7e-016
>  Identities = 39/40 (97%), Gaps = 0/40 (0%)
>  Strand=Plus/Plus
>
> Query  145  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  184
>             ||||| ||||||||||||||||||||||||||||||||||
> Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217
>
>
> >dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G60F
> Length=206
>
>  Score = 58.4 bits (31),  Expect = 1e-012
>  Identities = 39/42 (92%), Gaps = 3/42 (7%)
>  Strand=Plus/Plus
>
> Query  142  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  182
>             |||| || ||| ||||||||||||||||||||||||||||||
> Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204
>
>
> >dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
> partial
> sequence, clone: G65F
> Length=256
>
>  Score = 56.5 bits (30),  Expect = 5e-012
>  Identities = 30/30 (100%), Gaps = 0/30 (0%)
>  Strand=Plus/Plus
>
> Query  153  AAAACTTTCAACAACGGATCTCTTGGTTCT  182
>             ||||||||||||||||||||||||||||||
> Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254
>
>
>
> Lambda     K      H
>     1.33    0.621     1.12
>
> Gapped
> Lambda     K      H
>     1.28    0.460    0.850
>
> Effective search space used: 530378
>
>
>   Database: ITS
>     Posted date:  Aug 27, 2010  9:43 AM
>   Number of letters in database: 1,102
>   Number of sequences in database:  5
>
>
>
> Matrix: blastn matrix 1 -2
> Gap Penalties: Existence: 0, Extension: 2.5
>
>
>
>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
=======================================================================
Attention: The information contained in this message and/or attachments
from AgResearch Limited is intended only for the persons or entities
to which it is addressed and may contain confidential and/or privileged
material. Any review, retransmission, dissemination or other use of, or
taking of any action in reliance upon, this information by persons or
entities other than the intended recipients is prohibited by AgResearch
Limited. If you have received this message in error, please notify the
sender immediately.
=======================================================================



More information about the Bioperl-l mailing list