[Bioperl-l] standaloneblastplus

Dave Messina David.Messina at sbc.su.se
Fri Sep 10 12:23:26 EDT 2010


Hi Sally,

Did you run the same search on the command line, outside of BioPerl?

The issue you're having may be with Blast+ and not BioPerl. For example, it's possible that the low-complexity and compositional matrix adjustment filtering (which are turned on by default) are excluding the expected matches.


Dave





On Sep 10, 2010, at 17:13 , sally roberts wrote:

> I think that is just a email error. Thanks for looking though!
> 
> --- On Thu, 9/9/10, Smithies, Russell <Russell.Smithies at agresearch.co.nz> wrote:
> 
> From: Smithies, Russell <Russell.Smithies at agresearch.co.nz>
> Subject: RE: [Bioperl-l] standaloneblastplus
> To: "'sally roberts'" <elanorbust2 at yahoo.com>, "'bioperl-l at lists.open-bio.org'" <bioperl-l at lists.open-bio.org>
> Date: Thursday, September 9, 2010, 6:54 PM
> 
> Is that a typo in your email or are some of your fasta headers in your db incorrect?
> Eg.
>> 301333052|GU725063|Xiphinema adenohystherum  internal transcribed
>> 301333052|GU725063|spacer 1
> AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCGCTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGATCTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGT
> 
> Shouldn't that be:
>> 301333052|GU725063|Xiphinema adenohystherum  internal transcribed spacer 1
> AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCGCTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGATCTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGT
> 
> Maybe the invalid fasta headers are breaking the db formatter?
> 
> 
> Russell Smithies
> 
> Technical Support
> T +64 3 489 9085
> E  russell.smithies at agresearch.co.nz
> Invermay  Research Centre
> Puddle Alley,
> Mosgiel,
> New Zealand
> T  +64 3 489 3809
> F  +64 3 489 9174
> www.agresearch.co.nz
> 
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>> bounces at lists.open-bio.org] On Behalf Of sally roberts
>> Sent: Friday, 10 September 2010 4:10 a.m.
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] standaloneblastplus
>> 
>> I am running a test for standaloneblastplus but getting data back that
>> does not exist in my query or my local database. Below is a outline of my
>> script small database, query list, and erroneous results. As you will
>> notice the query list is comprised of the first four sequences found in
>> the database. The results say it can not find the first two and then the
>> mathces for the last two do not exist!
>> 
>> Thanks for any help!
>> 
>> 
>> 
>> Program
>> 
>> 
>> #!/usr/bin/perl
>> 
>> use Bio::Tools::Run::StandAloneBlastPlus;
>> 
>> 
>> $fac = Bio::Tools::Run::StandAloneBlastPlus->new(
>>    -db_name => 'ITS',
>>    -db_data => 'smallDB.fas',
>>    -create => 1
>> );
>> 
>> $result = $fac->blastn( -query => , 'sequences.fasta',
>>                          -outfile => 'ITStest2.bls');
>> 
>> 
>> smallDB.fas Data
>> 
>>> 302585252|HM807352|Waitea circinata  internal transcribed spacer 1
>> ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGC
>> ACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGT
>> TTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA
>> 
>>> 302585252|HM807352|Waitea circinata  internal transcribed spacer 2
>> GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTT
>> CTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTA
>> GACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA
>> 
>>> 302585250|HM802273|Fusarium oxysporum  contains 18S ribosomal RNA,
>> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
>> spacer 2, and 28S ribosomal RNA"
>> CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCT
>> CCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATA
>> AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTA
>> ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCAT
>> GCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGC
>> CGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC
>> 
>>> 302585249|HM802272|Fusarium oxysporum  contains 18S ribosomal RNA,
>> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
>> spacer 2, and 28S ribosomal RNA"
>> GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCG
>> GTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATA
>> AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGT
>> GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCT
>> GTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGAT
>> TGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTA
>> AACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAG
>> GAA
>> 
>>> 302585248|HM802271|Fusarium oxysporum  contains 18S ribosomal RNA,
>> internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed
>> spacer 2, and 28S ribosomal RNA"
>> CCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCC
>> CGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAA
>> TAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAAT
>> GTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGC
>> CTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCG
>> GCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGC
>> GCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGC
>> ATATCATTAAAGCGGAGGAA
>> 
>>> 301333053|GU725064|Xiphinema turcicum  internal transcribed spacer 1
>> GGAGAGATTATATCTTTCTCGAAAAGAGAAAAAATATCCGAGCCGAGCGAACCGACCGAAAAACGCGGTGAGGC
>> GCCTTTTGCGCAAAGTCCGTACGTCGGTTCTTAGCGAATATAGCCTCGGCCTGGGACCCGAAAGATGTTTCCTA
>> TATGTATCTCGAGACCGACCGTTTAAGACGGTAGCCGGAAAAAAGATTATACCGTGGGTGAAGGTGTCGAAAAG
>> AATAATGTAGGTAAAAAAGAAAGACAGACAGAGGAGAGAAAGAACGAAAGTAGAACTCGAACGTAGTTTGAGCT
>> ACGCAGTAACGGTATCCGTCGTGGGACATCGCGGTGCGTCGGTTGTAGGGAGTTAAGATTACCTACCCGACACC
>> TCGATATTAATCCCGCGCGAATAAATGCGGATTACCGTGAATGTACGCTCTGCTTCGATATCGGGCTTCTTTTG
>> ACACCGAAAATATATATATGAATAAAAATAAAGTCACCCTCGTTGCAACGGTATATATCAAAGCGGTTTTCCGT
>> GAAAAGAAAGAAGGCGGCTTCGGTTCTCGTTATATTAGGAATAATCTAAGTAATTTCAGACGTCCCGGGAATCG
>> TTACTATAGATAGAGAGCGATAGTAACGGTTTCTCCTTCGGGTACTTATCGAACGTTAACACTGCGGTAATCCG
>> TCTGGCCGCAAGGAGAGAGGTGTTACGTTCGGCAGCCCTAAATTTCGACCCGTTCGACTAATGCGACGGCCCTA
>> CCGAGAAAATGTAGGGCCTATGTACATAGTCCGAAAGAAATACGATCGGAATATTAAGGGTTAGGTTTAAAGAG
>> TCATCGGTTCCGAGTACGCGTTCGTTCGGCACGATGCGTGTGTGTATATATCGTAGAGGAGTATTGACGATATA
>> TATGTATGCGTATTCGCCCTTACGATAAGAGAATATCGCGTAATTCGGAGCGGCCGTTCTTCGCGAGAGAGAGA
>> ACGCA
>> CGCGTTAGAAGCTTACGAGTCGGTGTTAAGTTCGAAGGAGAGAGGTTCGAACCGAAGCCGGCGAGTACGCGTTA
>> AGTCGTTTCGCGAGAGACGGTCCGGGACGAAAAGGAGAGAGTATCGTCCGGGTGTCCGCCCGAAATAGATATCT
>> TATCGAGAATATTTTTATATAGTTCGTTAGAAAGAATGCGAACTTTAAA
>> 
>>> 301333052|GU725063|Xiphinema adenohystherum  internal transcribed spacer
>> 1
>> AAAGACGAAAAATATATACTTTCTCACCGAAATATCAGACTATTCGGTTCCGATTTGATTCGCGGTAAGGCGCG
>> CTAGCGCGGTAGCCCGCTATCGGTTCTGACTGTCTGGACCCCGAAAAATAGTAAGAAAGACGGTGTCGTCGGAT
>> CTCGGGTTAGTATTGTATATATCGGGGACTTATCGGTCTGTCGAGTTTCTTTCCGGGGTTCTTTGAGTTTATTG
>> GGACAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAGTCTCGTGAACACGAGCCCGGGA
>> ATAGAAGAGACTCGGCTGATAACGACCGACTATATCTCGTTATATACTCAGAGTTGAATAACTGAGTGGCTCGA
>> AACGGCGACATTGTACTTACTATTTTATGTAGACTCTGGAAATATCAGACGTCCCGGGGAATCGTTACAGAGGA
>> AATATAGGGTACCTGGAAAAAGAATGGTACCCGTTCCTGTAATGATTCCTTATTCGGGTACCTATCGAATACTA
>> ACGGCGCGGATCCCCCGTCTGGCCGCGACGGAATAAGCGTTAGATTCGGTATCCCTATATTCGCGAGTATTCGA
>> CTAGTCATGAAATAGAGCCCTTATCGGGGTATCGACTGTCGATCGGATAGAAAGCGAATTAGGGTTAGGTTTAA
>> AGAGTCATTGGTTCCGTATATATGGGTGGAACGTACCCGTAAAGGAACAGCCGTAGACGCGAGTTCGGAAATAA
>> GTATATTCTCGCGAGAAAGAGGGTCCGTGTACCTTCAAGGTACTTGAATTTAGACCCAGTCTCGTGAATATACG
>> TAACTCGTCGAATGGCTCGGGACATGTAGAATACTATGTCCGGGTGACCGCCCGAAATAAGAATATTCATCAGA
>> AACTTTTATATATAGTTCGCCGAATAATAGCGAAC
>> 
>>> 301333051|GU725062|Xiphinema sphaerocephalum  internal transcribed spacer
>> 1
>> AAAGTCGAAAAAATATACTTTCTCGCGGAGAAATAATACGGACCGTTCAGTCCGACTCTATACGCGGTAAGGCG
>> CTCTTGCGCGAGAGCCCGCTGTCGGTTCTGACGGTCCGGACCCCGAAAAGTAGTAAGTACGACTACGATATATC
>> GTGGTCGAGTATCGGTTAGTAATAGTATATCGGGACTGACCGATCGGTCGGTCGAGTTTCTACCGGCTTCTTTG
>> AGTCTATTCGGGCAGCGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTGTAGAACTCGTGAATTC
>> GAGCTCGGTAACCGGGAACTCGGCTGAGAACGACCGATTACTTCTCGATACGCTCGAACGTATATATCTAACCG
>> AGAAAAGGCGACGTTGTACTTACTATTTATATCAGACGTCCCGAGAGTCGTTACGGTCGGAAATATTGGGTACC
>> GGTATCGGACCCGTTTCCGTATCGGCTCTTTATTCGGGTACCTATCGAATACTAACGCCGCGGTTCACCGTCTG
>> GCCGCGACGGAATACGCGTTAGATTCGGCACCCCCTATATTCGTATATATATCGACTAGTCTCGAAATAGAGCC
>> CTTACTAGGGTGAAGACTATGTCGATCGGAAAGAATCGGATTAGGGGTAGGTTTAAAGAGTCATCGGTTCCGTG
>> TATCCGGGCGAAATATATACCCGTAACGGAACGACCGTTGACGCGAGTTTGAAGATATATACATGTACGTATAT
>> GAGACAAAAAAACGAGGGTCTGTACCGTGAATTTTTTAGGTACCGAAAAGAGGACCCCCGGTCTCGTGAATATG
>> TATTACTCGCCGAACGGTTCGGGACATGGAGAATATTATGTCCGGGTGACCGCCCGAAATAGAAATTTTTTTCT
>> ATAAAGTTTTGATATACGTATAGTTCGTCGAATAAAAGC
>> 
>>> 301333050|GU725061|Xiphinema hispanum  internal transcribed spacer 1
>> AAAGCCGAAAAATATATACTTTCTCAGAGAAATACTAGACTAGTCGATTCCGACTTGATTCGCGGTAAGGCGCT
>> TTCGCGCGATAGCCCGCTGTCGGTTCCGACCGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGATC
>> TCGGTTAGAAATTGTATATATGTCGGGACGGATCGGTCGGTCGAGTTCCTTTCGGTGTTCTTAGAGTTTATTCG
>> GGCAGTGTCGGTTGTAGCGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTTAGAACCCGGAA
>> TAGAGGGAACTCGGCTGATAACGACCGACTTATGTCTCGCCGTATACCGTGAGTTATTTGACCGAGTGGCTCGA
>> AACGGCGGTATTGTACTTACTATTTATCTAGTCTCTGGAAATATCAGACGTCCCGGGAATCGTTACAGCGGAAA
>> TATAGGGTACCCGAAAAACTGGTACCCGTTTCTGAAACGACTCCTTATTCGGGTACCTATCGAATACTAACGCC
>> GCAGTTTCCCGTCTGGCTGCGATGGAAAAAGCGTTAGATTCGGGATCTCTATATTCGCGGGTGTTCGATTAGTC
>> GTGAAATACAGCCCTTACGCGGGTGACGACGGTCGATCGGAAAGAAAGCGAATTAGGGTTAGGTTTAAAGAGTC
>> ATTGGTTCCGTGTACGGGCGAAAAAGTACCCGTTACGGAACGGCCGTCGACGCGAGTGTGGAAATAAGTATATA
>> GTTACGAGAAAGAGGGTCTGTACCTCGGAGTTTTTTGAAGGTACCGTAATCAGGACCCTGTCTCGTGAATATAC
>> AAGTTACTCGCCGAACGGTTCGGCCAATGTAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTTCAT
>> AAAAAGCTTTTATATATAGTTTGCCGAATAATAGCAAACG
>> 
>>> 301333049|GU725060|Xiphinema pyrenaicum  internal transcribed spacer 1
>> AAAGCGGAAAAATTACTTTCTCACCCGGAAAAAACAGACCGTTTATCGGTCCGACTTGAAACGCGGTAAGGCGC
>> TCTTGCGCGATAGCCCGCCGTCGGTTCCGATGGTCTGGACCCCGAAAAATAGTAAGAACGACGGTGTCGTCGAT
>> TCTCGGTTAGTAGTATATCCGGTCGGATCGATATATATCGGTCGGTCGAGTTTCTATCGGGTTCTTTGAGTTTC
>> TTCGGACAGCGTCGGTTGTAGTGGAGTTTGGATACCTACCCGACTGTCCTTATAATCTCGTGAACTCTAGCCCG
>> ATAATAATACGGAACTCGGCTGAGAACGACCGACTTAGGTCTGAGTAGATATACTGAGAATATTACCTAGCCGA
>> GATGAACGAAACGGCGACATTGGAGTTTTACTATTTACTCGTATCAGACGTCCCGGGAATCGTTGCAGTTGAAT
>> TACATATATACGGGTACCTGTAATTGGACTCGTTTCTGTAACGGTTCTTTAGTCGGGTACCTATCGAATACTAA
>> CGCCGCGGTTATCCGTCTGGCCGCGATGGAATAAGCGTTAGATTCGGCATCCCTTTATTCGTATACGTTCGAGT
>> AGTCGTGAATTAGAACCCTTTAACCGGGGTGAAGACTATCGACGGGAGATAAGCGAATTAGGGGTAGGTTTAAA
>> GAGTCATCGGTTCCGGATACGGAGAGAAAAATGCCCGTAATGGAACGACCATTGAAGCGGGATCTATATATATA
>> TATATATGATTCGCCCGATGGTTCGGGACATGGAGAATTTTATGTCCGGGTGACCGCCCGAAATAGAAATATTT
>> ACTTCAAAGTTATTTATATATAGTTCGCCTTATAAGAGCGAACG
>> 
>> 
>> 
>> sequences.fasta data
>> 
>>> Test1
>> ATGATTGGTGGCTGTTGCTGGCTAGTGTTTCTAGTATGTGCACGCCACACCTTCAATCCCACTTACACCTGTGC
>> ACCTTTTGTAGTATTACTTGTGGATATCGAGAGAAAGTTTAGTCTTTCACTCTGTTGAAACCGGTTTACTACGT
>> TTTTTTATACACACACAATAGTCATTGAATGTATTTTTTATTTCTTATGATAAAAA
>> 
>>> Test2
>> GAATCTCTCAAATACAATAATTTTTTTTGATTGTTGTATTTGGACTTGGAAGCTGTTGGCGCAAGTCGACTCTT
>> CTCAAATGTATTAGCTGGGGTTTATATAGTTGGATCCTTGGTGTGATAATTATCTACGCCTTGAAGTCCCTGTA
>> GACTCTGCTTCAAATCGTCTCTTCATGAGACAATATTTGAATCA
>> 
>>> Test3
>> CTCGAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATCAGCCCGCT
>> CCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATA
>> AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTA
>> ATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCAT
>> GCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGC
>> CGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCCCTGCATAGAAAACCCGCGGGGGGGGGAC
>> 
>>> Test4
>> GAGGTCTTACCGAGTTTCACTCCCAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCG
>> GTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATA
>> AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCCAAATGCGATAAGTAATGT
>> GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCT
>> GTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGAT
>> TGTCGTTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTA
>> AACCCCAACTTCTGAATGTTGACCTCGGATCAGTAAGGAATACCCGCTGAACTTAAGCATATCATTAAGCGGAG
>> GAA
>> 
>> 
>> 
>> 
>> Results
>> 
>> BLASTN 2.2.24+
>> 
>> 
>> Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb
>> Miller (2000), "A greedy algorithm for aligning DNA sequences", J
>> Comput Biol 2000; 7(1-2):203-14.
>> 
>> 
>> 
>> Database: ITS
>>             5 sequences; 1,102 total letters
>> 
>> 
>> 
>> Query=  Test1
>> Length=204
>> 
>> 
>> ***** No hits found *****
>> 
>> 
>> 
>> Lambda     K      H
>>      1.33    0.621     1.12
>> 
>> Gapped
>> Lambda     K      H
>>      1.28    0.460    0.850
>> 
>> Effective search space used: 202071
>> 
>> 
>> Query=  Test2
>> Length=192
>> 
>> 
>> ***** No hits found *****
>> 
>> 
>> 
>> Lambda     K      H
>>      1.33    0.621     1.12
>> 
>> Gapped
>> Lambda     K      H
>>      1.28    0.460    0.850
>> 
>> Effective search space used: 189507
>> 
>> 
>> Query=  Test3
>> Length=437
>> 
>> Score     E
>> Sequences producing significant alignments:
>> (Bits)  Value
>> 
>> dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 300    2e-085
>> dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 69.4    6e-016
>> dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 58.4    1e-012
>> dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 56.5    4e-012
>> 
>> 
>>> dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G59F
>> Length=203
>> 
>>   Score =  300 bits (162),  Expect = 2e-085
>>   Identities = 176/182 (96%), Gaps = 4/182 (2%)
>>   Strand=Plus/Plus
>> 
>> Query  10   TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATCACCAATTGTTGCCTCGGCGGATC
>> 66
>>              ||||||||||| | |||||| |||||| |||||||| |||| ||||||||||||||||||
>> Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACAT-ACCACTTGTTGCCTCGGCGGATC
>> 81
>> 
>> Query  67   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT
>> 126
>>              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct  82   AGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATAT
>> 141
>> 
>> Query  127  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
>> 186
>>              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct  142  GTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
>> 201
>> 
>> Query  187  GG  188
>>              ||
>> Sbjct  202  GG  203
>> 
>> 
>>> dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G64F
>> Length=217
>> 
>>   Score = 69.4 bits (37),  Expect = 6e-016
>>   Identities = 39/40 (97%), Gaps = 0/40 (0%)
>>   Strand=Plus/Plus
>> 
>> Query  149  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  188
>>              ||||| ||||||||||||||||||||||||||||||||||
>> Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217
>> 
>> 
>>> dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G60F
>> Length=206
>> 
>>   Score = 58.4 bits (31),  Expect = 1e-012
>>   Identities = 39/42 (92%), Gaps = 3/42 (7%)
>>   Strand=Plus/Plus
>> 
>> Query  146  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  186
>>              |||| || ||| ||||||||||||||||||||||||||||||
>> Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204
>> 
>> 
>>> dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G65F
>> Length=256
>> 
>>   Score = 56.5 bits (30),  Expect = 4e-012
>>   Identities = 30/30 (100%), Gaps = 0/30 (0%)
>>   Strand=Plus/Plus
>> 
>> Query  157  AAAACTTTCAACAACGGATCTCTTGGTTCT  186
>>              ||||||||||||||||||||||||||||||
>> Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254
>> 
>> 
>> 
>> Lambda     K      H
>>      1.33    0.621     1.12
>> 
>> Gapped
>> Lambda     K      H
>>      1.28    0.460    0.850
>> 
>> Effective search space used: 442850
>> 
>> 
>> Query=  Test4
>> Length=521
>> 
>> Score     E
>> Sequences producing significant alignments:
>> (Bits)  Value
>> 
>> dbj|AB581518.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 309    4e-088
>> dbj|AB581521.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 69.4    7e-016
>> dbj|AB581519.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 58.4    1e-012
>> dbj|AB581522.1|  Uncultured fungus genes for 18S rRNA, ITS1 and 5...
>> 56.5    5e-012
>> 
>> 
>>> dbj|AB581518.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G59F
>> Length=203
>> 
>>   Score =  309 bits (167),  Expect = 4e-088
>>   Identities = 177/181 (97%), Gaps = 3/181 (1%)
>>   Strand=Plus/Plus
>> 
>> Query  7    TTACCGAGTTT-C-ACTCCC-AACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCA
>> 63
>>              ||||||||||| | |||||| |||||| ||||||||||||||||||||||||||||||||
>> Sbjct  23   TTACCGAGTTTACAACTCCCAAACCCCAGTGAACATACCACTTGTTGCCTCGGCGGATCA
>> 82
>> 
>> Query  64   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG
>> 123
>>              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct  83   GCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATG
>> 142
>> 
>> Query  124  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG
>> 183
>>              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
>> Sbjct  143  TAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG
>> 202
>> 
>> Query  184  G  184
>>              |
>> Sbjct  203  G  203
>> 
>> 
>>> dbj|AB581521.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G64F
>> Length=217
>> 
>>   Score = 69.4 bits (37),  Expect = 7e-016
>>   Identities = 39/40 (97%), Gaps = 0/40 (0%)
>>   Strand=Plus/Plus
>> 
>> Query  145  AATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  184
>>              ||||| ||||||||||||||||||||||||||||||||||
>> Sbjct  178  AATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGG  217
>> 
>> 
>>> dbj|AB581519.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G60F
>> Length=206
>> 
>>   Score = 58.4 bits (31),  Expect = 1e-012
>>   Identities = 39/42 (92%), Gaps = 3/42 (7%)
>>   Strand=Plus/Plus
>> 
>> Query  142  ATAA-ATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCT  182
>>              |||| || ||| ||||||||||||||||||||||||||||||
>> Sbjct  165  ATAACAT-AAT-AAAACTTTCAACAACGGATCTCTTGGTTCT  204
>> 
>> 
>>> dbj|AB581522.1| Uncultured fungus genes for 18S rRNA, ITS1 and 5.8S rRNA,
>> partial
>> sequence, clone: G65F
>> Length=256
>> 
>>   Score = 56.5 bits (30),  Expect = 5e-012
>>   Identities = 30/30 (100%), Gaps = 0/30 (0%)
>>   Strand=Plus/Plus
>> 
>> Query  153  AAAACTTTCAACAACGGATCTCTTGGTTCT  182
>>              ||||||||||||||||||||||||||||||
>> Sbjct  225  AAAACTTTCAACAACGGATCTCTTGGTTCT  254
>> 
>> 
>> 
>> Lambda     K      H
>>      1.33    0.621     1.12
>> 
>> Gapped
>> Lambda     K      H
>>      1.28    0.460    0.850
>> 
>> Effective search space used: 530378
>> 
>> 
>>    Database: ITS
>>      Posted date:  Aug 27, 2010  9:43 AM
>>    Number of letters in database: 1,102
>>    Number of sequences in database:  5
>> 
>> 
>> 
>> Matrix: blastn matrix 1 -2
>> Gap Penalties: Existence: 0, Extension: 2.5
>> 
>> 
>> 
>> 
>> 
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> =======================================================================
> Attention: The information contained in this message and/or attachments
> from AgResearch Limited is intended only for the persons or entities
> to which it is addressed and may contain confidential and/or privileged
> material. Any review, retransmission, dissemination or other use of, or
> taking of any action in reliance upon, this information by persons or
> entities other than the intended recipients is prohibited by AgResearch
> Limited. If you have received this message in error, please notify the
> sender immediately.
> =======================================================================
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l




More information about the Bioperl-l mailing list