From s.denaxas at gmail.com  Tue Feb  1 06:59:23 2011
From: s.denaxas at gmail.com (Spiros Denaxas)
Date: Tue, 1 Feb 2011 11:59:23 +0000
Subject: [Bioperl-l] medperl, something kinda like bioperl
In-Reply-To: <4D4749EE.3010901@cornell.edu>
References: <AANLkTim_Vr7RUtY5qurgQY=Kidd4NwFxxga4WOrrDE9a@mail.gmail.com>
	<4D4749EE.3010901@cornell.edu>
Message-ID: <AANLkTin=oCHnbb24W_ZCgFUzzo9dFBbTHRe0mHZmfrkF@mail.gmail.com>

On Mon, Jan 31, 2011 at 11:46 PM, Robert Buels <rmb32 at cornell.edu> wrote:

> Hi Spiros,
>
> This is a fine idea.  My most important piece of advice is to keep the code
> loosely coupled and flexible.
>
> Don't try to make big monolithic distributions like Bioperl.  Keep the code
> as loosely-coupled as possible: think carefully before making something be a
> subclass of something else, or have some other kind of direct dependency
> upon it.  Things change.  Coding practices change. Technology changes too,
> both on the bio/med side, *and* on the code side.
>
> For the project to stay healthy for the long haul, it needs to stay easy
> for people to wrap their minds around the codebase, and then work on it:
> developers need to be able to focus their efforts on the code that they are
> interested in without having to worry about huge amounts of other code.  For
> this to be possible, the various parts of the codebase need to stay
> organized and compartmentalized, with minimal, well-characterized dependency
> relationships between them.
>
> Good luck!
>
> Rob
>
>
>
Hello Rob,

thanks for the feedback. It will be definitely a learning experience for me
as well. I'm planing on setting up some sort of public resource for people
to have a look at and discuss / make a plan before actual coding gets done.
Will keep you posted.

thanks
Spiros


> Spiros Denaxas wrote:
>
>> Hello,
>>
>> I am sending this email here since I consider all people that contribute
>> and/or follow the bioperl project as the best starting point for advice on
>> a
>> new project I am currently planning ; my apologies if its considered
>> off-topic.
>>
>> While the bioinformatics community has greatly benefitted from the Perl
>> community, with the shining example of bioperl, the medical community is
>> sadly a bit behind. I am currently employed in a public health /
>> epidemiology environment and have under numerous occasions discovered
>> opportunities to contribute code to CPAN that has made my life easier. I
>> know I am not alone, but a very quick search on CPAN for related modules
>> form the medical / biomedical domain does not return much for now.
>>
>> I recently gave a presentation at the London Perl Workshop [1] and while
>> creating it, I thought, would it be useful to have something similar to
>> bioperl for modules which largely contribute to the medical /
>> epidemiological domain? I was thinking of creating something like medperl,
>> alas similar to bioperl, but in a very very simple form. It would serve as
>> a
>> reference point to the (albeit small) numbers of modules that are
>> currently
>> on CPAN and will also hopefully urge people to contribute some of their
>> code
>> along the way.
>>
>> So I would like to request your advice on:
>>
>> a) Can you think of any reasons for not doing this?
>> b) Does anybody know of something similar?
>> c) Does anybody feel like they could contribute?
>>
>> Regards,
>> Spiros Denaxas
>>
>> [1]
>>
>> http://www.slideshare.net/spirosd/perl-cures-coronary-heart-disease-lpw2010
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>

From clements at nescent.org  Tue Feb  1 00:57:52 2011
From: clements at nescent.org (Dave Clements)
Date: Mon, 31 Jan 2011 21:57:52 -0800
Subject: [Bioperl-l] March 2011 GMOD Meeting Registration is now open
In-Reply-To: <AANLkTinKpntVuMpyE39ApVJVN2+3KgmNJNJc7q3FVh1B@mail.gmail.com>
References: <AANLkTinHWU_2SRQDfrX7x_LALKJa8FKHBOQ6aYr+qrc5@mail.gmail.com>
	<AANLkTim=h7mFOKQL3uKtX5gd5NcZtqBwxCWLC0Q50j3Y@mail.gmail.com>
	<AANLkTikXDr76t6nvxBzkYZxoMOfJYcZ2D8=yJzNy97Ks@mail.gmail.com>
	<AANLkTi=BaTUpHqEGDGjikrz5wAPm53_9gfQNVe+6LN4T@mail.gmail.com>
	<AANLkTik5BPZJ8+FZk+fvC=PeJUyiaed5W8KjxK-KjxMk@mail.gmail.com>
	<AANLkTikoKU6-CTTGuGe_PURH-gSSGg7Jvnk0CyGw5qFv@mail.gmail.com>
	<AANLkTikhH81Y0zRGKqo=RHrC2SgcW473pFZAYmLigsUV@mail.gmail.com>
	<AANLkTimhCNbzGw6k2+ZyrVsCmaSc2uj6aLkwg5B8H+vG@mail.gmail.com>
	<AANLkTi=ZRHPo9mhQiq=soPee=rFWWOqSAuxBR3nMVGWt@mail.gmail.com>
	<AANLkTimP4wZJRW5SZSUQTKkC6VH0uBik5iO6Sd8Nc4tQ@mail.gmail.com>
	<AANLkTimmDJmB=GoSekY7Gtq_c-0THQ-0kMiLiA4jxrVq@mail.gmail.com>
	<AANLkTinKpntVuMpyE39ApVJVN2+3KgmNJNJc7q3FVh1B@mail.gmail.com>
Message-ID: <AANLkTinthoNC0TrrYVvdYTf3ouyRLVaiP2an83+ofusn@mail.gmail.com>

Hello all,

Registration is now open for the March 2011 GMOD Meeting (
http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting). This meeting will be
held March 5-6, as part of GMOD Americas 2011, which also includes a day of
Satellite Meetings, a GMOD Course (already full), and for the first time, an
"Introduction to GMOD" session the night before the meeting for GMOD
newcomers. GMOD Americas 2011 events are being held at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina, United
States.

As with previous GMOD meetings, this meeting will have a mixture of project
talks, component talks, and user talks. Our guest speaker is Dr. Eric Stone
of North Carolina State University.  Dr. Stone will talk about his
experience on the "Drosophila Genome Reference Panel," a project that is
sequencing 192 lines.  See
http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda for more.

The agenda is driven by attendee suggestions, and you are encouraged to add
your suggestions now (
http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting#Agenda_Proposals). For
examples of what happens at a GMOD meeting, see the writeup of the September
2010 GMOD Meeting (http://gmod.oicr.on.ca/wiki/September_2010_GMOD_Meeting),
or any previous meeting. GMOD meetings are an excellent way to meet GMOD
developers and users and to learn (and affect) what's coming in the project.

Registration for the March 2011 GMOD Meeting is
  $80 on or before February 18 <<<<=======
  $95 after February 18

Please register early, both to save money, and ensure a spot. You are also
strongly encouraged to sign up for (or propose) a Satellite Meeting (more
details to come). Details on transportation, suggested lodging, and other
logistics are on the GMOD Americas 2011 page.

This meeting, and all GMOD Americas 2011 events, are jointly sponsored by
NESCent and the Galaxy Project.


Dave Clements
Galaxy Project

--
http://gmod.org/wiki/GMOD_Americas_2011
http://gmod.org/wiki/GMOD_News
http://nescent.org
http://usegalaxy.org/

From greg at ebi.ac.uk  Tue Feb  1 09:21:58 2011
From: greg at ebi.ac.uk (Gregory Jordan)
Date: Tue, 1 Feb 2011 14:21:58 +0000
Subject: [Bioperl-l] nucleotide changes along tree
In-Reply-To: <9b7468ad-fe3a-4ace-8cd2-69b146fddd28@j11g2000yqh.googlegroups.com>
References: <9b7468ad-fe3a-4ace-8cd2-69b146fddd28@j11g2000yqh.googlegroups.com>
Message-ID: <AANLkTimTGH4r_F_Y46Hj0nrGvFmF6eSOCWy=2dfEwpPZ@mail.gmail.com>

Hi Nicholas,

PAML is the de facto standard for ancestral reconstruction of DNA
sequences. http://abacus.gene.ucl.ac.uk/software/paml.html

<http://abacus.gene.ucl.ac.uk/software/paml.html>BioPerl contains a
Bio::Tools::Phylo::PAML module for running PAML and parsing the output.
There's a how-to (http://www.bioperl.org/wiki/HOWTO:PAML) and documentation
on the specific methods to access ancestral state reconstructions (
http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/Tools/Phylo/PAML/Result.html#Synopsis)
.

If you're just doing a one-off run and don't need to automate things, you
may be better off running PAML on its own. Extensive documentation is
available from the PAML site (first link above).

Cheers,
 Greg

On Mon, Jan 31, 2011 at 4:30 PM, Nicholas Price <price4890 at gmail.com> wrote:

> Hi
>
> I have  three nucleotide sequences from human, chimp and Orangutan and
> the corresponding tree.I want align the sequences and for each column
> in the alignment where there are substitutions, I want to infer on
> which branches the changes occurred using a maximum likelihood method.
> Is there a way to do this in Bioperl??
>
> thank you
>
> Nicholas
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From fs5 at sanger.ac.uk  Tue Feb  1 09:22:41 2011
From: fs5 at sanger.ac.uk (Frank Schwach)
Date: Tue, 01 Feb 2011 14:22:41 +0000
Subject: [Bioperl-l] Proposed improvement to
	to	Bio::Tools::Run::Primer3Redux
In-Reply-To: <ED37140D-1526-4F03-AF03-5846E148282E@illinois.edu>
References: <344D48F6FA61134A9B17AE445882A195010C77@HC-MAILBOXC1-N5.healthcare.uiowa.edu>
	<ED37140D-1526-4F03-AF03-5846E148282E@illinois.edu>
Message-ID: <1296570161.19678.26.camel@deskpro15336.internal.sanger.ac.uk>

Hi John and Chris,

I was wondering about the state of affairs with this new
Bio-Tools-Primer3Redux module. I need to run and parse Primer3 v2.xx as
well and I also need the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST function. I
was about to put together a module for my own use when I saw your
messages. So, if there is anything I can do to help with this I would be
happy to do so (instead of re-inventing the wheel). 

Frank



On Mon, 2011-01-24 at 12:41 -0600, Chris Fields wrote:
> John,
> 
> This patch is made off an older version of Bio-Tools-Primer3Redux, which is now hosted in a separate repo on GitHub:
> 
> https://github.com/cjfields/Bio-Tools-Primer3Redux
> 
> I get one patch failure against the latest code which is easily added (the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST parameter), but tests now fail (see below).  Can you resubmit this against the latest code?
> 
> chris
> 
> 
> $ ./Build test --test-files t/Run/Primer3Redux.t --verbose
> t/Run/Primer3Redux.t .. Subroutine p3_settings_file redefined at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 620.
> 
> ok 1 - use Bio::Tools::Run::Primer3Redux;
> ok 2
> ok 3 - program_name
> SEQUENCE_ID=Test1
> 
> SEQUENCE_TEMPLATE=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
> 
> PRIMER_EXPLAIN_FLAG=1
> 
> PRIMER_PRODUCT_SIZE_RANGE=100-250
> 
> PRIMER_SALT_CORRECTIONS=1
> 
> PRIMER_TASK=pick_pcr_primers
> 
> PRIMER_TM_FORMULA=1
> 
> =
> Unknown open() mode '/Users/cjfields/bin/primer3_core  </var/folders/Nj/Njn+dA2IGey0Gxn+92zej++++TI/-Tmp-/NAGb_w_8Rs' at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 705.
> # Tests were run but no plan was declared and done_testing() was not seen.
> Dubious, test returned 255 (wstat 65280, 0xff00)
> All 3 subtests passed 
> 
> Test Summary Report
> -------------------
> t/Run/Primer3Redux.t (Wstat: 65280 Tests: 3 Failed: 0)
>   Non-zero exit status: 255
>   Parse errors: No plan found in TAP output
> Files=1, Tests=3,  1 wallclock secs ( 0.02 usr  0.01 sys +  0.20 cusr  0.04 csys =  0.27 CPU)
> Result: FAIL
> Failed 1/1 test programs. 0/3 subtests failed.
> 
> On Jan 24, 2011, at 11:44 AM, Ma, Man Chun John wrote:
> 
> > Hi,
> > 
> > Attached are my proposed diff for some changes for Bio::Tools::Run::Primer3Redux to more fully implement the new features of Primer3 version 2.x.x:
> > 
> > 1. Adding support for the commond-line argument p3_settings_file that has been available for all 2.x.x versions, and
> > 2. Adding support for the "Sequence" tag SEQUENCE_PRIMER_PAIR_OK_REGION_LIST, a new function in version 2.2.3
> > 
> > Although I have used this module quite heavily in my projects and it appeared to run well, I'm not sure if there are bugs--not to say I have yet understand how to write /t scripts, so I wonder if someone would like to test this up.
> > 
> > Cheers,
> > 
> > John MC Ma
> > Graduate Assistant
> > Kwitek Lab
> > Department of Internal Medicine
> > 3125E MERF
> > 375 Newton Road
> > Iowa City IA 52242<Primer3Redux.patch>_______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From cjfields at illinois.edu  Tue Feb  1 09:57:45 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 1 Feb 2011 08:57:45 -0600
Subject: [Bioperl-l] Proposed improvement to to
	Bio::Tools::Run::Primer3Redux
In-Reply-To: <1296570161.19678.26.camel@deskpro15336.internal.sanger.ac.uk>
References: <344D48F6FA61134A9B17AE445882A195010C77@HC-MAILBOXC1-N5.healthcare.uiowa.edu>
	<ED37140D-1526-4F03-AF03-5846E148282E@illinois.edu>
	<1296570161.19678.26.camel@deskpro15336.internal.sanger.ac.uk>
Message-ID: <C40CDDAA-491D-4E8E-84EE-A87FE8F29074@illinois.edu>

Frank,

You are more than welcome to look at the code on github and improve it.  In fact, let me know if you have a github account and I can add you as a collaborator (John, same for you).  I'll probably work on conversion to Dist::Zilla at some point for easier distribution building, but will keep a stub Build.PL for easy installation from github if needed.

Key thing I want to make sure we keep up is tests and test coverage.  Could probably improve the backend a bit more as well, but it works for now.

chris 

On Feb 1, 2011, at 8:22 AM, Frank Schwach wrote:

> Hi John and Chris,
> 
> I was wondering about the state of affairs with this new
> Bio-Tools-Primer3Redux module. I need to run and parse Primer3 v2.xx as
> well and I also need the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST function. I
> was about to put together a module for my own use when I saw your
> messages. So, if there is anything I can do to help with this I would be
> happy to do so (instead of re-inventing the wheel). 
> 
> Frank
> 
> 
> 
> On Mon, 2011-01-24 at 12:41 -0600, Chris Fields wrote:
>> John,
>> 
>> This patch is made off an older version of Bio-Tools-Primer3Redux, which is now hosted in a separate repo on GitHub:
>> 
>> https://github.com/cjfields/Bio-Tools-Primer3Redux
>> 
>> I get one patch failure against the latest code which is easily added (the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST parameter), but tests now fail (see below).  Can you resubmit this against the latest code?
>> 
>> chris
>> 
>> 
>> $ ./Build test --test-files t/Run/Primer3Redux.t --verbose
>> t/Run/Primer3Redux.t .. Subroutine p3_settings_file redefined at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 620.
>> 
>> ok 1 - use Bio::Tools::Run::Primer3Redux;
>> ok 2
>> ok 3 - program_name
>> SEQUENCE_ID=Test1
>> 
>> SEQUENCE_TEMPLATE=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC
>> 
>> PRIMER_EXPLAIN_FLAG=1
>> 
>> PRIMER_PRODUCT_SIZE_RANGE=100-250
>> 
>> PRIMER_SALT_CORRECTIONS=1
>> 
>> PRIMER_TASK=pick_pcr_primers
>> 
>> PRIMER_TM_FORMULA=1
>> 
>> =
>> Unknown open() mode '/Users/cjfields/bin/primer3_core  </var/folders/Nj/Njn+dA2IGey0Gxn+92zej++++TI/-Tmp-/NAGb_w_8Rs' at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 705.
>> # Tests were run but no plan was declared and done_testing() was not seen.
>> Dubious, test returned 255 (wstat 65280, 0xff00)
>> All 3 subtests passed 
>> 
>> Test Summary Report
>> -------------------
>> t/Run/Primer3Redux.t (Wstat: 65280 Tests: 3 Failed: 0)
>>  Non-zero exit status: 255
>>  Parse errors: No plan found in TAP output
>> Files=1, Tests=3,  1 wallclock secs ( 0.02 usr  0.01 sys +  0.20 cusr  0.04 csys =  0.27 CPU)
>> Result: FAIL
>> Failed 1/1 test programs. 0/3 subtests failed.
>> 
>> On Jan 24, 2011, at 11:44 AM, Ma, Man Chun John wrote:
>> 
>>> Hi,
>>> 
>>> Attached are my proposed diff for some changes for Bio::Tools::Run::Primer3Redux to more fully implement the new features of Primer3 version 2.x.x:
>>> 
>>> 1. Adding support for the commond-line argument p3_settings_file that has been available for all 2.x.x versions, and
>>> 2. Adding support for the "Sequence" tag SEQUENCE_PRIMER_PAIR_OK_REGION_LIST, a new function in version 2.2.3
>>> 
>>> Although I have used this module quite heavily in my projects and it appeared to run well, I'm not sure if there are bugs--not to say I have yet understand how to write /t scripts, so I wonder if someone would like to test this up.
>>> 
>>> Cheers,
>>> 
>>> John MC Ma
>>> Graduate Assistant
>>> Kwitek Lab
>>> Department of Internal Medicine
>>> 3125E MERF
>>> 375 Newton Road
>>> Iowa City IA 52242<Primer3Redux.patch>_______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> -- 
> The Wellcome Trust Sanger Institute is operated by Genome Research 
> Limited, a charity registered in England with number 1021457 and a 
> company registered in England with number 2742969, whose registered 
> office is 215 Euston Road, London, NW1 2BE. 



From cjfields at illinois.edu  Tue Feb  1 09:58:52 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 1 Feb 2011 08:58:52 -0600
Subject: [Bioperl-l] nucleotide changes along tree
In-Reply-To: <AANLkTimTGH4r_F_Y46Hj0nrGvFmF6eSOCWy=2dfEwpPZ@mail.gmail.com>
References: <9b7468ad-fe3a-4ace-8cd2-69b146fddd28@j11g2000yqh.googlegroups.com>
	<AANLkTimTGH4r_F_Y46Hj0nrGvFmF6eSOCWy=2dfEwpPZ@mail.gmail.com>
Message-ID: <6FC85CEA-1583-4D87-988B-A539AF2270FF@illinois.edu>

+1 on all this, just wish the output were easily parsable from version to version :P

chris

On Feb 1, 2011, at 8:21 AM, Gregory Jordan wrote:

> Hi Nicholas,
> 
> PAML is the de facto standard for ancestral reconstruction of DNA
> sequences. http://abacus.gene.ucl.ac.uk/software/paml.html
> 
> <http://abacus.gene.ucl.ac.uk/software/paml.html>BioPerl contains a
> Bio::Tools::Phylo::PAML module for running PAML and parsing the output.
> There's a how-to (http://www.bioperl.org/wiki/HOWTO:PAML) and documentation
> on the specific methods to access ancestral state reconstructions (
> http://doc.bioperl.org/releases/bioperl-current/bioperl-live/Bio/Tools/Phylo/PAML/Result.html#Synopsis)
> .
> 
> If you're just doing a one-off run and don't need to automate things, you
> may be better off running PAML on its own. Extensive documentation is
> available from the PAML site (first link above).
> 
> Cheers,
> Greg
> 
> On Mon, Jan 31, 2011 at 4:30 PM, Nicholas Price <price4890 at gmail.com> wrote:
> 
>> Hi
>> 
>> I have  three nucleotide sequences from human, chimp and Orangutan and
>> the corresponding tree.I want align the sequences and for each column
>> in the alignment where there are substitutions, I want to infer on
>> which branches the changes occurred using a maximum likelihood method.
>> Is there a way to do this in Bioperl??
>> 
>> thank you
>> 
>> Nicholas
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From zsuzjsl at gmail.com  Tue Feb  1 12:16:37 2011
From: zsuzjsl at gmail.com (Jinshun Zhong)
Date: Tue, 1 Feb 2011 11:16:37 -0600
Subject: [Bioperl-l] Fail to install DBD-mysql
Message-ID: <AANLkTikQ2tiSyw4=JGa6ng_bj=H98DMWASTG2+b=3mR=@mail.gmail.com>

Hi folks,

I followed the instruction to install the program, using GUI, command line
or cygwin. But every time I failed to find DBD-mysql, then I could not
proceed with "make" command. Is there anyone who knew how to deal with this?

Thanks.
Jinshun

From scott at scottcain.net  Tue Feb  1 12:37:06 2011
From: scott at scottcain.net (Scott Cain)
Date: Tue, 1 Feb 2011 12:37:06 -0500
Subject: [Bioperl-l] Fail to install DBD-mysql
In-Reply-To: <AANLkTikQ2tiSyw4=JGa6ng_bj=H98DMWASTG2+b=3mR=@mail.gmail.com>
References: <AANLkTikQ2tiSyw4=JGa6ng_bj=H98DMWASTG2+b=3mR=@mail.gmail.com>
Message-ID: <AANLkTi==Suzb-Qf5iwEHMRPwrGimNOjgYwLGoCSgEeBR@mail.gmail.com>

Hi Jinshun,

What version are you trying to install that involves make?  It must be
very old, so that is a problem to start with.

DBD::mysql is not a required prerequisite for BioPerl, so that
shouldn't be a problem.

Scott


On Tue, Feb 1, 2011 at 12:16 PM, Jinshun Zhong <zsuzjsl at gmail.com> wrote:
> Hi folks,
>
> I followed the instruction to install the program, using GUI, command line
> or cygwin. But every time I failed to find DBD-mysql, then I could not
> proceed with "make" command. Is there anyone who knew how to deal with this?
>
> Thanks.
> Jinshun
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From harpactocrates at googlemail.com  Tue Feb  1 13:10:22 2011
From: harpactocrates at googlemail.com (pablo marin-garcia)
Date: Tue, 1 Feb 2011 18:10:22 +0000
Subject: [Bioperl-l] medperl, something kinda like bioperl
Message-ID: <AANLkTimfWjTWf0kBud2ZKkNV_kG3FtCB5yiNLJxk2SDb@mail.gmail.com>

Hello Spiros,

I have been writing a set of modules and scripts called pmGWAS (perl
modules for genome wide association) and PMG (Perl for Medical
Genetics). They are based in bioperl and ensembl and I was going to
release in github and later in CPAN. They are modules for
visualization and creating report analysis for medical sequencing and
genotyping. Also I have been writing parsers for the common genotype
and SNPs file formats that at some point I would like to 'bioperlize'
following the SeqIO factory style.

Would be nice to use the bioperl wiki for organize and coordinate
these kind of modules. The current view on bioperl development,  I
think, today is more like the unix motto: do one thing, do it well and
interact well with others. As Rob said the trick is to keep things
simple and modular following the bioperl interfaces or defining new
ones and try to convince people to adhere.

Nice to see more people wanting to increase the perl contribution in this area.

  -Pablo

> >
> Hello Rob,
>
> thanks for the feedback. It will be definitely a learning experience for me
> as well. I'm planing on setting up some sort of public resource for people
> to have a look at and discuss / make a plan before actual coding gets done.
> Will keep you posted.
>
> thanks
> Spiros
>
>
> > Spiros Denaxas wrote:
> >
> >> Hello,
> >>
> >> I am sending this email here since I consider all people that contribute
> >> and/or follow the bioperl project as the best starting point for advice on
> >> a
> >> new project I am currently planning ; my apologies if its considered
> >> off-topic.
> >>
> >> While the bioinformatics community has greatly benefitted from the Perl
> >> community, with the shining example of bioperl, the medical community is
> >> sadly a bit behind. I am currently employed in a public health /
> >> epidemiology environment and have under numerous occasions discovered
> >> opportunities to contribute code to CPAN that has made my life easier. I
> >> know I am not alone, but a very quick search on CPAN for related modules
> >> form the medical / biomedical domain does not return much for now.
> >>
> >> I recently gave a presentation at the London Perl Workshop [1] and while
> >> creating it, I thought, would it be useful to have something similar to
> >> bioperl for modules which largely contribute to the medical /
> >> epidemiological domain? I was thinking of creating something like medperl,
> >> alas similar to bioperl, but in a very very simple form. It would serve as
> >> a
> >> reference point to the (albeit small) numbers of modules that are
> >> currently
> >> on CPAN and will also hopefully urge people to contribute some of their
> >> code
> >> along the way.
> >>
> >> So I would like to request your advice on:
> >>
> >> a) Can you think of any reasons for not doing this?
> >> b) Does anybody know of something similar?
> >> c) Does anybody feel like they could contribute?
> >>
> >> Regards,
> >> Spiros Denaxas


-- 
?? - Pablo Marin-Garcia


From clements at nescent.org  Wed Feb  2 01:25:39 2011
From: clements at nescent.org (Dave Clements)
Date: Tue, 1 Feb 2011 22:25:39 -0800
Subject: [Bioperl-l] GMOD Satellite Meetings, March 7, NESCent, Durham, NC
In-Reply-To: <AANLkTikekMJvPV1k+JiwtiUvZiOjqhimpwmancbch=AA@mail.gmail.com>
References: <AANLkTinMK0-ZcaVOJxPEt_WuwPKchsVHRJ8JPtkj5Bqr@mail.gmail.com>
	<AANLkTinyojUF0Zz_JpHbwhwS=-r4_ya5dSBtQoZS2_Cr@mail.gmail.com>
	<AANLkTik0p04EpYyvryWckSUyU+3mCz6+LXp3NJLJnb8j@mail.gmail.com>
	<AANLkTimx0mPEvu6vmjeOwgQEGi2fGteRW2MUYd=xcqM5@mail.gmail.com>
	<AANLkTim60S3bJ7QyKH2f_Pfuf2Kk5dTeEK3KM=6kv_9R@mail.gmail.com>
	<AANLkTinMHe1empOMomQ5epH0AvWUXuh91CoMdrF4jOrm@mail.gmail.com>
	<AANLkTi=aU21hCpq2=O1CJBSiTLPHcDcsuBPy_2MNHEO+@mail.gmail.com>
	<AANLkTindOhpNjt8mV6ZnNb7HMzVXOLtR0-VsX_cg0X-n@mail.gmail.com>
	<AANLkTikekMJvPV1k+JiwtiUvZiOjqhimpwmancbch=AA@mail.gmail.com>
Message-ID: <AANLkTikzAP61AmwAC3fEH2bvO__DOzLYnNkZRNL0E5rj@mail.gmail.com>

Hello all,

Yesterday, we opened registration for the March 2011 GMOD Meeting (see
http://gmod.oicr.on.ca/wiki/March_2011_GMOD_Meeting).  *That meeting is part
of a larger event, GMOD Americas 2011, that also includes several Satellite
Meetings on March 7*, the day after the meeting ends.

Satellite meetings are smaller groups of people meeting to discuss a common
interest, or work on a common problem (think special interest groups /
birds-of-a-feather).  Unlike the GMOD Meeting, there is *no registration fee
* for the Satellites, and you don't even need to go to any other GMOD
Americas events to participate in the Satellites.  *If you are in the area,
or attending other GMOD Americas events, or are just very interested in the
topic, we strongly encourage you to attend.*

The current list of Satellites (see
http://gmod.oicr.on.ca/wiki/Satellite_Meetings_-_GMOD_Americas_2011)
includes:

   - *GMOD Evo Hackathon
Followup*<http://gmod.oicr.on.ca/wiki/GMOD_Evo_Hackathon#March_2011_Satellite>,
   organized by Duke Leto <http://gmod.oicr.on.ca/wiki/User:Dukeleto>.  A
   followup to the GMOD Evo
Hackathon<http://gmod.oicr.on.ca/wiki/GMOD_Evo_Hackathon>held at
NESCent in November 2011.  You didn't to participate in the original
   event to participate in this followup.  Also, if there is interest, this
   satellite can extend for more than one day.
   - *Customizing and Extending JBrowse<http://gmod.oicr.on.ca/wiki/JBrowse>
   *, organized by Mitch Skinner<http://gmod.oicr.on.ca/wiki/User:MitchSkinner>
   .  JBrowse <http://gmod.oicr.on.ca/wiki/JBrowse> has a few different
   extension points, but they're not (yet) well-documented or widely used. The
   GMOD meeting would be a good time to review those
APIs<http://gmod.oicr.on.ca/wiki/Glossary#API>,
   relate them to the things that people want to do with them, discuss any
   potential changes or new APIs to support specific use cases, and potentially
   start to implement an extension.
   - *GMOD Web services toolkit* <http://gmod.oicr.on.ca/wiki/GMOD_RPC_API>,
   organized by Josh Goodman <http://gmod.oicr.on.ca/wiki/User:Jogoodma>.  Come
   to work on or discuss the GMOD Web services API and the
toolkit<http://gmod.oicr.on.ca/wiki/GMOD_RPC_API>
   .
   - *GMOD in the Sequencing
Center*<http://gmod.oicr.on.ca/wiki/GMOD_in_the_Sequencing_Center>,
   organized by  Chris Hemmerich <http://gmod.oicr.on.ca/wiki/User:Chemmeri>,
   Dave Clements <http://gmod.oicr.on.ca/wiki/User:Clements>.  Sequencing
   centers have tremendous bioinformatics needs that GMOD can help address.
   Attend this satellite to find out what other sequencing centers are doing
   with GMOD, and how GMOD can help you help your researchers.

If you are interested in participating in these, please contact the
organizers, and/or add your name to the satellite's participants list on the
wiki.

Satellites can be organized by anyone.  If you have a topic you would like
to cover, please add it to the list and announce it the appropriate mailing
lists.  Several previous satellites are written up on the GMOD wiki, if you
want an idea of what happens at a satellite.

Finally, please let me and Scott know if you have any questions.

Thanks, and hope to see you in March!

Dave C.
-- 
http://gmod.org/wiki/GMOD_Americas_2011
http://gmod.org/wiki/GMOD_News
http://usegalaxy.org/

From djsomers at wisc.edu  Thu Feb  3 14:58:44 2011
From: djsomers at wisc.edu (Dana J. Wohlbach)
Date: Thu, 3 Feb 2011 13:58:44 -0600
Subject: [Bioperl-l] Bio::Search::Tiling::MapTiling error
Message-ID: <AANLkTinSvrvt+x8t8eQg0sNRf3MBhncGE8BMyUYKhJG1@mail.gmail.com>

Hi all,

I have been trying to use the Bio::Search::Tiling::MapTiling module to
parse the output of a WU-Blast report, but have been encountering the
error message below.  I have tested this on perl v5.10.0 or v5.8.8
with bioperl v1.6.1 or v1.5.21.  I have also tried parsing either
tBlastN or BlastN (sample attached to this message) reports but get
the same error message, which I have been unable to resolve.  Any
suggestions would be much appreciated.

The script I am running is:

#!usr/bin/perl
use warnings;
use strict;
use diagnostics;

use Bio::SearchIO;
use Bio::Search::Tiling::MapTiling;

my $file = shift;

my $in = new Bio::SearchIO(-format => 'blast',
			   -file   => $file);

while (my $result = $in->next_result ) {
  print "\nQUERY: ", $result->query_name, "\n";

  while ( my $hit = $result->next_hit ) {
    print "  HIT: ", $hit->name;

    my $tiling = new Bio::Search::Tiling::MapTiling(-hit => $hit);
    my $numID = $tiling->identities();
    print "  NUMID: $numID\n";
  }
}

And once it gets to a hit with multiple HSPs, it chokes with the message:

--------------------- WARNING ---------------------
MSG: No HSPS present for type 'query' in context 'p_' for this hit
---------------------------------------------------
Can't use an undefined value as an ARRAY reference at
	/Library/Perl/5.10.0/Bio/Search/Tiling/MapTiling.pm line 963, <GEN1>
line 820 (#1)
    (F) A value used as either a hard reference or a symbolic reference must
    be a defined value.  This helps to delurk some insidious errors.

Uncaught exception from user code:
	Can't use an undefined value as an ARRAY reference at
/Library/Perl/5.10.0/Bio/Search/Tiling/MapTiling.pm line 963, <GEN1>
line 820.
 at /Library/Perl/5.10.0/Bio/Search/Tiling/MapTiling.pm line 963
	Bio::Search::Tiling::MapTiling::_calc_stats('Bio::Search::Tiling::MapTiling=HASH(0x100c37400)',
'query', 'exact', 'p_') called at
/Library/Perl/5.10.0/Bio/Search/Tiling/MapTiling.pm line 279
	Bio::Search::Tiling::MapTiling::identities('Bio::Search::Tiling::MapTiling=HASH(0x100c37400)')
called at DummyParseBlastN.pl line 22


Also, is there any reason that identities (i.e. $tiling->identities())
would return a non-integer?  When I run the above script, I am getting
numbers like 150.686622649381 for some of the tilied HSP identity
values.

Thanks in advance for any help!
Cheers,
Dana

-- 
/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\
Dana J. Wohlbach, Ph.D.
Research Associate
University of Wisconsin-Madison
Department of Genetics
Gasch Lab

Genetics-Biotechnology Center
425 Henry Mall
Madison, WI 53706
608-265-0863
\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/
-------------- next part --------------
A non-text attachment was scrubbed...
Name: sampleBlastNOut
Type: application/octet-stream
Size: 483095 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20110203/2bedee45/attachment-0001.obj>

From witch.of.agnessi at gmail.com  Thu Feb  3 17:37:10 2011
From: witch.of.agnessi at gmail.com (B Enn)
Date: Thu, 3 Feb 2011 17:37:10 -0500
Subject: [Bioperl-l] Parsing Tabulated Blast result
Message-ID: <AANLkTi=va-r+RZdORdrXZcSkn+aLLfsoxbEWs+9pkoo9@mail.gmail.com>

Hi all,

I'm new to Bioperl and trying to parse some tabulted result (-m 9 option)
generated by TBLASTX (Blast 2.2.24).

I wish to know if the top hit comes from the minus strand of the Query
sequence or not. I believe one easy way to
know it if the start_query is greater than end_query.

However I found that,while using Bio::SearchIO, the start(query) is always
reported as smaller than end(query), even if the alignment
shows it in a different manner. I'm trying to find out using
strand('query'). I think if the query sequence match
comes from the complementary strand of the sequnce supplied, it is marked as
-1. Am I doing it correctly?

I'll also be very grateful if someone can provide any pointer/link on how to
know which reading frame the TOP query match belongs
to. For that I possibly need a full BLAST report.

The code(crude) I wrote  is as follows:

use strict;
use Bio::SearchIO;
my $in = new Bio::SearchIO(-format => 'blasttable', -file   => 'test.out');

while( my $result = $in->next_result ) {
          my $hit = $result->next_hit;
        my $hsp = $hit->next_hsp;
        print $hsp->start('query')
,"\t",$hsp->end('query'),"\t",$hsp->strand('query'),"\n";
}

Thanks in advance

From anjan.purkayastha at gmail.com  Thu Feb  3 17:20:40 2011
From: anjan.purkayastha at gmail.com (ANJAN PURKAYASTHA)
Date: Thu, 3 Feb 2011 17:20:40 -0500
Subject: [Bioperl-l] Problem installing CJFIELDS/BioPerl-1.6.1.tar.gz
Message-ID: <AANLkTi=urSg+U5vnQH+Z0U+dc24by4O=BF-jv=xnLYfW@mail.gmail.com>

Hello,
I am unable to install distribution CJFIELDS/BioPerl-1.6.1.tar.gz  on my Mac
10.6.6.
Here is the tail end of the installation report:
Result: FAIL
Failed 9/329 test programs. 8/19347 subtests failed.
  CJFIELDS/BioPerl-1.6.1.tar.gz
  ./Build test -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
  reports CJFIELDS/BioPerl-1.6.1.tar.gz
Warning (usually harmless): 'YAML' not installed, will not store persistent
state
Running Build install
  make test had returned bad status, won't install without force
Could not read '/Users/anjan/.cpan/build/GraphViz-2.04-NQf6M6/META.yml'.
Falling back to other methods to determine prerequisites
Failed during this command:
 SHLOMIF/Error-0.17016.tar.gz                 : install NO
 JSWARTZ/Cache-Cache-1.06.tar.gz              : install NO
 LDS/AcePerl-1.92.tar.gz                      : install NO
 JMCNAMARA/OLE-Storage_Lite-0.19.tar.gz       : install NO
 JMCNAMARA/Spreadsheet-ParseExcel-0.58.tar.gz : install NO
 GROMMEL/Math-Random-0.71.tar.gz              : install NO
 JHI/Graph-0.94.tar.gz                        : install NO
 JARW/Math-Spline-0.01.tar.gz                 : install NO
 SHLOMIF/Statistics-Descriptive-3.0201.tar.gz : install NO
 RONAN/SVG-2.50.tar.gz                        : install NO
 JARW/Math-Derivative-0.01.tar.gz             : install NO
 COGENT/Tree-DAG_Node-1.06.tar.gz             : install NO
 ALLENDAY/SVG-Graph-0.02.tar.gz               : install NO
 ADAMK/Task-Weaken-1.03.tar.gz                : install NO
 ADAMK/Class-Inspector-1.25.tar.gz            : install NO
 MKUTTER/SOAP-Lite-0.712.tar.gz               : install NO
 CMUNGALL/Data-Stag-0.11.tar.gz               : install NO
 LBROCARD/GraphViz-2.04.tar.gz                : writemakefile NO
'/usr/bin/perl Makefile.PL' returned status 512
 TOKUHIROM/Test-Requires-0.06.tar.gz          : install NO
 DOY/Try-Tiny-0.09.tar.gz                     : install NO
 RJBS/Test-Fatal-0.003.tar.gz                 : install NO
 ADAMK/Params-Util-1.03.tar.gz                : install NO
 RJBS/Sub-Install-0.925.tar.gz                : install NO
 DROLSKY/Package-DeprecationManager-0.10.tar.gz: install NO
 FLORA/MRO-Compat-0.11.tar.gz                 : install NO
 DOY/Package-Stash-XS-0.21.tar.gz             : install NO
 DOY/Package-Stash-0.25.tar.gz                : make_test NO
 FLORA/Sub-Name-0.05.tar.gz                   : install NO
 RJBS/Data-OptList-0.106.tar.gz               : install NO
 CHOCOLATE/Scope-Guard-0.20.tar.gz            : install NO
 RJBS/Sub-Exporter-0.982.tar.gz               : install NO
 FLORA/Devel-GlobalDestruction-0.03.tar.gz    : install NO
 FLORA/Class-MOP-1.12.tar.gz                  : make_test NO
 DROLSKY/Moose-1.21.tar.gz                    : make_test NO
 DAVECROSS/Array-Compare-2.01.tar.gz          : make_test NO
 MHX/Convert-Binary-C-0.74.tar.gz             : install NO
 TPEDERSE/Algorithm-Munkres-0.08.tar.gz       : install NO
 MIROD/XML-Twig-3.37.tar.gz                   : install NO
 JHI/Set-Scalar-1.25.tar.gz                   : install NO
 DCONWAY/Parse-RecDescent-1.965001.tar.gz     : install NO
 JMCNAMARA/Spreadsheet-WriteExcel-2.37.tar.gz : install NO
 KMACLEOD/libxml-perl-0.08.tar.gz             : install NO
 RBERJON/XML-Filter-BufferText-1.01.tar.gz    : install NO
 PERIGRIN/XML-SAX-Writer-0.53.tar.gz          : install NO
 RDF/Clone-0.31.tar.gz                        : install NO
 MIROD/XML-XPathEngine-0.12.tar.gz            : install NO
 TJMATHER/XML-RegExp-0.03.tar.gz              : install NO
 TJMATHER/XML-DOM-1.44.tar.gz                 : install NO
 MIROD/XML-DOM-XPath-0.14.tar.gz              : install NO
 SHAWNPW/PostScript-0.06.tar.gz               : install NO
 CJFIELDS/BioPerl-1.6.1.tar.gz                : make_test NO

Any feedback on what may be going wrong will be immensley helpful.
Thanks,
Anjan

-- 
===================================
Anjan Purkayastha, PhD
Senior Computational Biologist
TessArae LLC
46090 Lake Center Plaza, Suite 304
Potomac Falls, VA 20165**
Mobile-703.740.6939
===================================

From scott at scottcain.net  Thu Feb  3 22:03:44 2011
From: scott at scottcain.net (Scott Cain)
Date: Thu, 3 Feb 2011 22:03:44 -0500
Subject: [Bioperl-l] Problem installing CJFIELDS/BioPerl-1.6.1.tar.gz
In-Reply-To: <AANLkTi=urSg+U5vnQH+Z0U+dc24by4O=BF-jv=xnLYfW@mail.gmail.com>
References: <AANLkTi=urSg+U5vnQH+Z0U+dc24by4O=BF-jv=xnLYfW@mail.gmail.com>
Message-ID: <AANLkTin6ZeshB2sMLzTJPjCj-UtJsbgMCM3jngLJU_6o@mail.gmail.com>

Hi Anjan,

Can you tell us what tests failed?

Scott


On Thu, Feb 3, 2011 at 5:20 PM, ANJAN PURKAYASTHA
<anjan.purkayastha at gmail.com> wrote:
> Hello,
> I am unable to install distribution CJFIELDS/BioPerl-1.6.1.tar.gz ?on my Mac
> 10.6.6.
> Here is the tail end of the installation report:
> Result: FAIL
> Failed 9/329 test programs. 8/19347 subtests failed.
> ?CJFIELDS/BioPerl-1.6.1.tar.gz
> ?./Build test -- NOT OK
> //hint// to see the cpan-testers results for installing this module, try:
> ?reports CJFIELDS/BioPerl-1.6.1.tar.gz
> Warning (usually harmless): 'YAML' not installed, will not store persistent
> state
> Running Build install
> ?make test had returned bad status, won't install without force
> Could not read '/Users/anjan/.cpan/build/GraphViz-2.04-NQf6M6/META.yml'.
> Falling back to other methods to determine prerequisites
> Failed during this command:
> ?SHLOMIF/Error-0.17016.tar.gz ? ? ? ? ? ? ? ? : install NO
> ?JSWARTZ/Cache-Cache-1.06.tar.gz ? ? ? ? ? ? ?: install NO
> ?LDS/AcePerl-1.92.tar.gz ? ? ? ? ? ? ? ? ? ? ?: install NO
> ?JMCNAMARA/OLE-Storage_Lite-0.19.tar.gz ? ? ? : install NO
> ?JMCNAMARA/Spreadsheet-ParseExcel-0.58.tar.gz : install NO
> ?GROMMEL/Math-Random-0.71.tar.gz ? ? ? ? ? ? ?: install NO
> ?JHI/Graph-0.94.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
> ?JARW/Math-Spline-0.01.tar.gz ? ? ? ? ? ? ? ? : install NO
> ?SHLOMIF/Statistics-Descriptive-3.0201.tar.gz : install NO
> ?RONAN/SVG-2.50.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
> ?JARW/Math-Derivative-0.01.tar.gz ? ? ? ? ? ? : install NO
> ?COGENT/Tree-DAG_Node-1.06.tar.gz ? ? ? ? ? ? : install NO
> ?ALLENDAY/SVG-Graph-0.02.tar.gz ? ? ? ? ? ? ? : install NO
> ?ADAMK/Task-Weaken-1.03.tar.gz ? ? ? ? ? ? ? ?: install NO
> ?ADAMK/Class-Inspector-1.25.tar.gz ? ? ? ? ? ?: install NO
> ?MKUTTER/SOAP-Lite-0.712.tar.gz ? ? ? ? ? ? ? : install NO
> ?CMUNGALL/Data-Stag-0.11.tar.gz ? ? ? ? ? ? ? : install NO
> ?LBROCARD/GraphViz-2.04.tar.gz ? ? ? ? ? ? ? ?: writemakefile NO
> '/usr/bin/perl Makefile.PL' returned status 512
> ?TOKUHIROM/Test-Requires-0.06.tar.gz ? ? ? ? ?: install NO
> ?DOY/Try-Tiny-0.09.tar.gz ? ? ? ? ? ? ? ? ? ? : install NO
> ?RJBS/Test-Fatal-0.003.tar.gz ? ? ? ? ? ? ? ? : install NO
> ?ADAMK/Params-Util-1.03.tar.gz ? ? ? ? ? ? ? ?: install NO
> ?RJBS/Sub-Install-0.925.tar.gz ? ? ? ? ? ? ? ?: install NO
> ?DROLSKY/Package-DeprecationManager-0.10.tar.gz: install NO
> ?FLORA/MRO-Compat-0.11.tar.gz ? ? ? ? ? ? ? ? : install NO
> ?DOY/Package-Stash-XS-0.21.tar.gz ? ? ? ? ? ? : install NO
> ?DOY/Package-Stash-0.25.tar.gz ? ? ? ? ? ? ? ?: make_test NO
> ?FLORA/Sub-Name-0.05.tar.gz ? ? ? ? ? ? ? ? ? : install NO
> ?RJBS/Data-OptList-0.106.tar.gz ? ? ? ? ? ? ? : install NO
> ?CHOCOLATE/Scope-Guard-0.20.tar.gz ? ? ? ? ? ?: install NO
> ?RJBS/Sub-Exporter-0.982.tar.gz ? ? ? ? ? ? ? : install NO
> ?FLORA/Devel-GlobalDestruction-0.03.tar.gz ? ?: install NO
> ?FLORA/Class-MOP-1.12.tar.gz ? ? ? ? ? ? ? ? ?: make_test NO
> ?DROLSKY/Moose-1.21.tar.gz ? ? ? ? ? ? ? ? ? ?: make_test NO
> ?DAVECROSS/Array-Compare-2.01.tar.gz ? ? ? ? ?: make_test NO
> ?MHX/Convert-Binary-C-0.74.tar.gz ? ? ? ? ? ? : install NO
> ?TPEDERSE/Algorithm-Munkres-0.08.tar.gz ? ? ? : install NO
> ?MIROD/XML-Twig-3.37.tar.gz ? ? ? ? ? ? ? ? ? : install NO
> ?JHI/Set-Scalar-1.25.tar.gz ? ? ? ? ? ? ? ? ? : install NO
> ?DCONWAY/Parse-RecDescent-1.965001.tar.gz ? ? : install NO
> ?JMCNAMARA/Spreadsheet-WriteExcel-2.37.tar.gz : install NO
> ?KMACLEOD/libxml-perl-0.08.tar.gz ? ? ? ? ? ? : install NO
> ?RBERJON/XML-Filter-BufferText-1.01.tar.gz ? ?: install NO
> ?PERIGRIN/XML-SAX-Writer-0.53.tar.gz ? ? ? ? ?: install NO
> ?RDF/Clone-0.31.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
> ?MIROD/XML-XPathEngine-0.12.tar.gz ? ? ? ? ? ?: install NO
> ?TJMATHER/XML-RegExp-0.03.tar.gz ? ? ? ? ? ? ?: install NO
> ?TJMATHER/XML-DOM-1.44.tar.gz ? ? ? ? ? ? ? ? : install NO
> ?MIROD/XML-DOM-XPath-0.14.tar.gz ? ? ? ? ? ? ?: install NO
> ?SHAWNPW/PostScript-0.06.tar.gz ? ? ? ? ? ? ? : install NO
> ?CJFIELDS/BioPerl-1.6.1.tar.gz ? ? ? ? ? ? ? ?: make_test NO
>
> Any feedback on what may be going wrong will be immensley helpful.
> Thanks,
> Anjan
>
> --
> ===================================
> Anjan Purkayastha, PhD
> Senior Computational Biologist
> TessArae LLC
> 46090 Lake Center Plaza, Suite 304
> Potomac Falls, VA 20165**
> Mobile-703.740.6939
> ===================================
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From chad.a.davis at gmail.com  Fri Feb  4 08:20:16 2011
From: chad.a.davis at gmail.com (Chad Davis)
Date: Fri, 4 Feb 2011 14:20:16 +0100
Subject: [Bioperl-l] Problem installing CJFIELDS/BioPerl-1.6.1.tar.gz
In-Reply-To: <AANLkTin6ZeshB2sMLzTJPjCj-UtJsbgMCM3jngLJU_6o@mail.gmail.com>
References: <AANLkTi=urSg+U5vnQH+Z0U+dc24by4O=BF-jv=xnLYfW@mail.gmail.com>
	<AANLkTin6ZeshB2sMLzTJPjCj-UtJsbgMCM3jngLJU_6o@mail.gmail.com>
Message-ID: <AANLkTikgM7HeAeicFFZOvhO55vCP5GH-2cRRViO1hRUU@mail.gmail.com>

I may be off track here, but I saw a reference to GraphViz (though no
specific error) above. This reminded me of many problems I've had with
the GraphViz module over the last several years, though I think it's
better today. I generally had to, in CPAN:

force install GraphViz

before installing BioPerl. Make sure you have graphviz installed, first:

fink install graphviz

(I don't think 'graphviz-dev' is required?)

But, of course, it would be better to find the actual source of the
problem and fix it. If you could do:

test GraphViz

and report the errors, in addition to any other Bioperl tests that
might be failing.


Chad


On Fri, Feb 4, 2011 at 04:03, Scott Cain <scott at scottcain.net> wrote:
> Hi Anjan,
>
> Can you tell us what tests failed?
>
> Scott
>
>
> On Thu, Feb 3, 2011 at 5:20 PM, ANJAN PURKAYASTHA
> <anjan.purkayastha at gmail.com> wrote:
>> Hello,
>> I am unable to install distribution CJFIELDS/BioPerl-1.6.1.tar.gz ?on my Mac
>> 10.6.6.
>> Here is the tail end of the installation report:
>> Result: FAIL
>> Failed 9/329 test programs. 8/19347 subtests failed.
>> ?CJFIELDS/BioPerl-1.6.1.tar.gz
>> ?./Build test -- NOT OK
>> //hint// to see the cpan-testers results for installing this module, try:
>> ?reports CJFIELDS/BioPerl-1.6.1.tar.gz
>> Warning (usually harmless): 'YAML' not installed, will not store persistent
>> state
>> Running Build install
>> ?make test had returned bad status, won't install without force
>> Could not read '/Users/anjan/.cpan/build/GraphViz-2.04-NQf6M6/META.yml'.
>> Falling back to other methods to determine prerequisites
>> Failed during this command:
>> ?SHLOMIF/Error-0.17016.tar.gz ? ? ? ? ? ? ? ? : install NO
>> ?JSWARTZ/Cache-Cache-1.06.tar.gz ? ? ? ? ? ? ?: install NO
>> ?LDS/AcePerl-1.92.tar.gz ? ? ? ? ? ? ? ? ? ? ?: install NO
>> ?JMCNAMARA/OLE-Storage_Lite-0.19.tar.gz ? ? ? : install NO
>> ?JMCNAMARA/Spreadsheet-ParseExcel-0.58.tar.gz : install NO
>> ?GROMMEL/Math-Random-0.71.tar.gz ? ? ? ? ? ? ?: install NO
>> ?JHI/Graph-0.94.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
>> ?JARW/Math-Spline-0.01.tar.gz ? ? ? ? ? ? ? ? : install NO
>> ?SHLOMIF/Statistics-Descriptive-3.0201.tar.gz : install NO
>> ?RONAN/SVG-2.50.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
>> ?JARW/Math-Derivative-0.01.tar.gz ? ? ? ? ? ? : install NO
>> ?COGENT/Tree-DAG_Node-1.06.tar.gz ? ? ? ? ? ? : install NO
>> ?ALLENDAY/SVG-Graph-0.02.tar.gz ? ? ? ? ? ? ? : install NO
>> ?ADAMK/Task-Weaken-1.03.tar.gz ? ? ? ? ? ? ? ?: install NO
>> ?ADAMK/Class-Inspector-1.25.tar.gz ? ? ? ? ? ?: install NO
>> ?MKUTTER/SOAP-Lite-0.712.tar.gz ? ? ? ? ? ? ? : install NO
>> ?CMUNGALL/Data-Stag-0.11.tar.gz ? ? ? ? ? ? ? : install NO
>> ?LBROCARD/GraphViz-2.04.tar.gz ? ? ? ? ? ? ? ?: writemakefile NO
>> '/usr/bin/perl Makefile.PL' returned status 512
>> ?TOKUHIROM/Test-Requires-0.06.tar.gz ? ? ? ? ?: install NO
>> ?DOY/Try-Tiny-0.09.tar.gz ? ? ? ? ? ? ? ? ? ? : install NO
>> ?RJBS/Test-Fatal-0.003.tar.gz ? ? ? ? ? ? ? ? : install NO
>> ?ADAMK/Params-Util-1.03.tar.gz ? ? ? ? ? ? ? ?: install NO
>> ?RJBS/Sub-Install-0.925.tar.gz ? ? ? ? ? ? ? ?: install NO
>> ?DROLSKY/Package-DeprecationManager-0.10.tar.gz: install NO
>> ?FLORA/MRO-Compat-0.11.tar.gz ? ? ? ? ? ? ? ? : install NO
>> ?DOY/Package-Stash-XS-0.21.tar.gz ? ? ? ? ? ? : install NO
>> ?DOY/Package-Stash-0.25.tar.gz ? ? ? ? ? ? ? ?: make_test NO
>> ?FLORA/Sub-Name-0.05.tar.gz ? ? ? ? ? ? ? ? ? : install NO
>> ?RJBS/Data-OptList-0.106.tar.gz ? ? ? ? ? ? ? : install NO
>> ?CHOCOLATE/Scope-Guard-0.20.tar.gz ? ? ? ? ? ?: install NO
>> ?RJBS/Sub-Exporter-0.982.tar.gz ? ? ? ? ? ? ? : install NO
>> ?FLORA/Devel-GlobalDestruction-0.03.tar.gz ? ?: install NO
>> ?FLORA/Class-MOP-1.12.tar.gz ? ? ? ? ? ? ? ? ?: make_test NO
>> ?DROLSKY/Moose-1.21.tar.gz ? ? ? ? ? ? ? ? ? ?: make_test NO
>> ?DAVECROSS/Array-Compare-2.01.tar.gz ? ? ? ? ?: make_test NO
>> ?MHX/Convert-Binary-C-0.74.tar.gz ? ? ? ? ? ? : install NO
>> ?TPEDERSE/Algorithm-Munkres-0.08.tar.gz ? ? ? : install NO
>> ?MIROD/XML-Twig-3.37.tar.gz ? ? ? ? ? ? ? ? ? : install NO
>> ?JHI/Set-Scalar-1.25.tar.gz ? ? ? ? ? ? ? ? ? : install NO
>> ?DCONWAY/Parse-RecDescent-1.965001.tar.gz ? ? : install NO
>> ?JMCNAMARA/Spreadsheet-WriteExcel-2.37.tar.gz : install NO
>> ?KMACLEOD/libxml-perl-0.08.tar.gz ? ? ? ? ? ? : install NO
>> ?RBERJON/XML-Filter-BufferText-1.01.tar.gz ? ?: install NO
>> ?PERIGRIN/XML-SAX-Writer-0.53.tar.gz ? ? ? ? ?: install NO
>> ?RDF/Clone-0.31.tar.gz ? ? ? ? ? ? ? ? ? ? ? ?: install NO
>> ?MIROD/XML-XPathEngine-0.12.tar.gz ? ? ? ? ? ?: install NO
>> ?TJMATHER/XML-RegExp-0.03.tar.gz ? ? ? ? ? ? ?: install NO
>> ?TJMATHER/XML-DOM-1.44.tar.gz ? ? ? ? ? ? ? ? : install NO
>> ?MIROD/XML-DOM-XPath-0.14.tar.gz ? ? ? ? ? ? ?: install NO
>> ?SHAWNPW/PostScript-0.06.tar.gz ? ? ? ? ? ? ? : install NO
>> ?CJFIELDS/BioPerl-1.6.1.tar.gz ? ? ? ? ? ? ? ?: make_test NO
>>
>> Any feedback on what may be going wrong will be immensley helpful.
>> Thanks,
>> Anjan
>>
>> --
>> ===================================
>> Anjan Purkayastha, PhD
>> Senior Computational Biologist
>> TessArae LLC
>> 46090 Lake Center Plaza, Suite 304
>> Potomac Falls, VA 20165**
>> Mobile-703.740.6939
>> ===================================
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
> GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
> Ontario Institute for Cancer Research
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From harpactocrates at googlemail.com  Fri Feb  4 09:12:54 2011
From: harpactocrates at googlemail.com (pablo marin-garcia)
Date: Fri, 4 Feb 2011 14:12:54 +0000
Subject: [Bioperl-l] Problem installing CJFIELDS/BioPerl-1.6.1.tar.gz
In-Reply-To: <AANLkTikgM7HeAeicFFZOvhO55vCP5GH-2cRRViO1hRUU@mail.gmail.com>
References: <AANLkTi=urSg+U5vnQH+Z0U+dc24by4O=BF-jv=xnLYfW@mail.gmail.com>
	<AANLkTin6ZeshB2sMLzTJPjCj-UtJsbgMCM3jngLJU_6o@mail.gmail.com>
	<AANLkTikgM7HeAeicFFZOvhO55vCP5GH-2cRRViO1hRUU@mail.gmail.com>
Message-ID: <AANLkTi=4r7tv_Pa6bSkO7y_eq9OWMyJjisKTkdMXPppg@mail.gmail.com>

On Fri, Feb 4, 2011 at 1:20 PM, Chad Davis <chad.a.davis at gmail.com> wrote:
> I may be off track here, but I saw a reference to GraphViz (though no
> specific error) above. This reminded me of many problems I've had with
> the GraphViz module over the last several years, though I think it's
> better today. I generally had to, in CPAN:
>
> force install GraphViz
>
> before installing BioPerl. Make sure you have graphviz installed, first:
>

Hello Chad,

Regarding GraphViz and other dependencies when installing bioperl and
biographics [now independent of bioperl]
I wrote a description of my problem that I have before here
http://pablomarin-garcia.blogspot.com/2010/04/installing-graphviz-from-perl-cpan.html
http://pablomarin-garcia.blogspot.com/2010/04/perl-biographics-module-dependencies-in.html

In the case of GraphViz it needs
"Warning: prerequisite IPC::Run 0.6 not found."

What I needed for installing it in a new ubuntu 9.04 box:  (in a mac
would be different)
[Note the following dependencies could not be for bioperl but for
biographics or both, but it is nice to have them anyway]
[ sudo aptitude install]
- libgd2-xpm-dev # gd for GD. I don't know the difference between xpm
and noxpm but anyway
- libexpat-dev # expat for XML::Parser
- graphviz graphviz-dev graphviz-doc libgraphviz-dev graphviz-cairo #
for GraphViz
- libdb4.6-dev # for DB_File (The headers for 4.7 were also available
but I had 4.6 installed)

[CPAN]
- install IPC::Run # for GraphViz and other modules
- install DB_File # used by several modules so it better to install it first
- install XML::parser
- install GraphViz
- install GD
- install CJFIELDS/BioPerl-1.6.1.tar.gz

The only caveats here were that you should know that you need the
expat for XML, IPC::Run for GraphViz dependency and that DB_File uses
the Berkeley db headers (that I needed to google for finding the
package that contains them).



-- 
?? - Pablo Marin-Garcia


From buiduyminh at gmail.com  Fri Feb  4 10:44:26 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 10:44:26 -0500
Subject: [Bioperl-l] How to install 1.6.2
Message-ID: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>

Hi,

I am trying to use the "summary" feature in  bp_seqfeature_load.pl (for
Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install 1.6.2
but no luck.

First, I used GIT :

git clone git://github.com/bioperl/bioperl-live.git

and I got this error:
*
"github.com[0: 207.97.227.239]: errno=Connection timed out
fatal: unable to connect a socket (Connection timed out)"

*
Then, I downloaded snapshot Core Modules on this page
http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
either.


could someone please show me how to install 1.6.2 or if there is
anyway to use summary feature, please let me know.

Thank you very much,


-- 
Minh Bui.

From buiduyminh at gmail.com  Fri Feb  4 11:05:52 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 11:05:52 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
Message-ID: <AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>

Oh
One more thing, I just downloaded Bioperl 1.6.2 and

When I tried to run perl Build.PL, i got this message.
*
Checking whether your kit is complete...
WARNING: the following files are missing in your kit:
    .shipit
Please inform the author.

Checking prerequisites...
Install [a]ll optional external modules, [n]one, or choose [i]nteractively?
[n]
*

Then I ran ./Build test but it failed.

Test Summary Report
-------------------
t/SeqIO/embl.t                             (Wstat: 512 Tests: 85 Failed: 0)
  Non-zero exit status: 2
  Parse errors: Bad plan.  You planned 95 tests but ran 85.
Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys + 79.46 cusr
4.21 csys = 87.11 CPU)
Result: FAIL
Failed 1/350 test programs. 0/22459 subtests failed.

Is there anyway to install 1.6.2 because I really need it. Thank you for
your help.

On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com> wrote:

> Hi,
>
> I am trying to use the "summary" feature in  bp_seqfeature_load.pl (for
> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install
> 1.6.2 but no luck.
>
> First, I used GIT :
>
> git clone git://github.com/bioperl/bioperl-live.git
>
> and I got this error:
> *
> "github.com[0: 207.97.227.239]: errno=Connection timed out
> fatal: unable to connect a socket (Connection timed out)"
>
> *
> Then, I downloaded snapshot Core Modules on this page http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work either.
>
>
> could someone please show me how to install 1.6.2 or if there is anyway to use summary feature, please let me know.
>
> Thank you very much,
>
>
> --
> Minh Bui.
>



-- 
Minh Bui.

From scott at scottcain.net  Fri Feb  4 11:09:07 2011
From: scott at scottcain.net (Scott Cain)
Date: Fri, 4 Feb 2011 11:09:07 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
Message-ID: <AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>

Hi Minh,

I don't know why that test failed, but if you don't need to parse or
produce EMBL files, it doesn't matter (and even if you do, it still
may not matter, depending on what the test was).  I suggest
installing.

Scott


On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> Oh
> One more thing, I just downloaded Bioperl 1.6.2 and
>
> When I tried to run perl Build.PL, i got this message.
> *
> Checking whether your kit is complete...
> WARNING: the following files are missing in your kit:
> ? ?.shipit
> Please inform the author.
>
> Checking prerequisites...
> Install [a]ll optional external modules, [n]one, or choose [i]nteractively?
> [n]
> *
>
> Then I ran ./Build test but it failed.
>
> Test Summary Report
> -------------------
> t/SeqIO/embl.t ? ? ? ? ? ? ? ? ? ? ? ? ? ? (Wstat: 512 Tests: 85 Failed: 0)
> ?Non-zero exit status: 2
> ?Parse errors: Bad plan. ?You planned 95 tests but ran 85.
> Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr ?0.66 sys + 79.46 cusr
> 4.21 csys = 87.11 CPU)
> Result: FAIL
> Failed 1/350 test programs. 0/22459 subtests failed.
>
> Is there anyway to install 1.6.2 because I really need it. Thank you for
> your help.
>
> On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>
>> Hi,
>>
>> I am trying to use the "summary" feature in ?bp_seqfeature_load.pl (for
>> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install
>> 1.6.2 but no luck.
>>
>> First, I used GIT :
>>
>> git clone git://github.com/bioperl/bioperl-live.git
>>
>> and I got this error:
>> *
>> "github.com[0: 207.97.227.239]: errno=Connection timed out
>> fatal: unable to connect a socket (Connection timed out)"
>>
>> *
>> Then, I downloaded snapshot Core Modules on this page http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work either.
>>
>>
>> could someone please show me how to install 1.6.2 or if there is anyway to use summary feature, please let me know.
>>
>> Thank you very much,
>>
>>
>> --
>> Minh Bui.
>>
>
>
>
> --
> Minh Bui.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From buiduyminh at gmail.com  Fri Feb  4 11:14:14 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 11:14:14 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
Message-ID: <AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>

HI Scott,

I installed it anyway but the terminal (i am using Ubuntu 10.10) and it says
that bp_seqfeature_load.pl (unchanged) --> I still can't use --summary
feature.

Is there other way to use this feature?




On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net> wrote:

> Hi Minh,
>
> I don't know why that test failed, but if you don't need to parse or
> produce EMBL files, it doesn't matter (and even if you do, it still
> may not matter, depending on what the test was).  I suggest
> installing.
>
> Scott
>
>
> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> > Oh
> > One more thing, I just downloaded Bioperl 1.6.2 and
> >
> > When I tried to run perl Build.PL, i got this message.
> > *
> > Checking whether your kit is complete...
> > WARNING: the following files are missing in your kit:
> >    .shipit
> > Please inform the author.
> >
> > Checking prerequisites...
> > Install [a]ll optional external modules, [n]one, or choose
> [i]nteractively?
> > [n]
> > *
> >
> > Then I ran ./Build test but it failed.
> >
> > Test Summary Report
> > -------------------
> > t/SeqIO/embl.t                             (Wstat: 512 Tests: 85 Failed:
> 0)
> >  Non-zero exit status: 2
> >  Parse errors: Bad plan.  You planned 95 tests but ran 85.
> > Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys + 79.46
> cusr
> > 4.21 csys = 87.11 CPU)
> > Result: FAIL
> > Failed 1/350 test programs. 0/22459 subtests failed.
> >
> > Is there anyway to install 1.6.2 because I really need it. Thank you for
> > your help.
> >
> > On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> >
> >> Hi,
> >>
> >> I am trying to use the "summary" feature in  bp_seqfeature_load.pl (for
> >> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install
> >> 1.6.2 but no luck.
> >>
> >> First, I used GIT :
> >>
> >> git clone git://github.com/bioperl/bioperl-live.git
> >>
> >> and I got this error:
> >> *
> >> "github.com[0: 207.97.227.239]: errno=Connection timed out
> >> fatal: unable to connect a socket (Connection timed out)"
> >>
> >> *
> >> Then, I downloaded snapshot Core Modules on this page
> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work either.
> >>
> >>
> >> could someone please show me how to install 1.6.2 or if there is anyway
> to use summary feature, please let me know.
> >>
> >> Thank you very much,
> >>
> >>
> >> --
> >> Minh Bui.
> >>
> >
> >
> >
> > --
> > Minh Bui.
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>



-- 
Minh Bui.

From scott at scottcain.net  Fri Feb  4 11:23:54 2011
From: scott at scottcain.net (Scott Cain)
Date: Fri, 4 Feb 2011 11:23:54 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
Message-ID: <AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>

Hi Minh,

Where did you get BioPerl 1.6.2 from?  It hasn't been released yet.
You need to be BioPerl from git hub to use summary features:

  https://github.com/bioperl/bioperl-live

and click the download link on the right and select either tar.gz or
zip file to download.

Scott


On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> HI Scott,
>
> I installed it anyway but the terminal (i am using Ubuntu 10.10) and it says
> that bp_seqfeature_load.pl (unchanged) --> I still can't use --summary
> feature.
>
> Is there other way to use this feature?
>
>
>
>
> On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net> wrote:
>>
>> Hi Minh,
>>
>> I don't know why that test failed, but if you don't need to parse or
>> produce EMBL files, it doesn't matter (and even if you do, it still
>> may not matter, depending on what the test was). ?I suggest
>> installing.
>>
>> Scott
>>
>>
>> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>> > Oh
>> > One more thing, I just downloaded Bioperl 1.6.2 and
>> >
>> > When I tried to run perl Build.PL, i got this message.
>> > *
>> > Checking whether your kit is complete...
>> > WARNING: the following files are missing in your kit:
>> > ? ?.shipit
>> > Please inform the author.
>> >
>> > Checking prerequisites...
>> > Install [a]ll optional external modules, [n]one, or choose
>> > [i]nteractively?
>> > [n]
>> > *
>> >
>> > Then I ran ./Build test but it failed.
>> >
>> > Test Summary Report
>> > -------------------
>> > t/SeqIO/embl.t ? ? ? ? ? ? ? ? ? ? ? ? ? ? (Wstat: 512 Tests: 85 Failed:
>> > 0)
>> > ?Non-zero exit status: 2
>> > ?Parse errors: Bad plan. ?You planned 95 tests but ran 85.
>> > Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr ?0.66 sys + 79.46
>> > cusr
>> > 4.21 csys = 87.11 CPU)
>> > Result: FAIL
>> > Failed 1/350 test programs. 0/22459 subtests failed.
>> >
>> > Is there anyway to install 1.6.2 because I really need it. Thank you for
>> > your help.
>> >
>> > On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>> >
>> >> Hi,
>> >>
>> >> I am trying to use the "summary" feature in ?bp_seqfeature_load.pl (for
>> >> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install
>> >> 1.6.2 but no luck.
>> >>
>> >> First, I used GIT :
>> >>
>> >> git clone git://github.com/bioperl/bioperl-live.git
>> >>
>> >> and I got this error:
>> >> *
>> >> "github.com[0: 207.97.227.239]: errno=Connection timed out
>> >> fatal: unable to connect a socket (Connection timed out)"
>> >>
>> >> *
>> >> Then, I downloaded snapshot Core Modules on this page
>> >> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work either.
>> >>
>> >>
>> >> could someone please show me how to install 1.6.2 or if there is anyway
>> >> to use summary feature, please let me know.
>> >>
>> >> Thank you very much,
>> >>
>> >>
>> >> --
>> >> Minh Bui.
>> >>
>> >
>> >
>> >
>> > --
>> > Minh Bui.
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l at lists.open-bio.org
>> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
>> Ontario Institute for Cancer Research
>
>
>
> --
> Minh Bui.
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From buiduyminh at gmail.com  Fri Feb  4 11:27:48 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 11:27:48 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
	<AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
Message-ID: <AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>

I got it from here
https://github.com/bioperl/bioperl-live/tree/release-1-6-2



On Fri, Feb 4, 2011 at 11:23 AM, Scott Cain <scott at scottcain.net> wrote:

> Hi Minh,
>
> Where did you get BioPerl 1.6.2 from?  It hasn't been released yet.
> You need to be BioPerl from git hub to use summary features:
>
>  https://github.com/bioperl/bioperl-live
>
> and click the download link on the right and select either tar.gz or
> zip file to download.
>
> Scott
>
>
> On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> > HI Scott,
> >
> > I installed it anyway but the terminal (i am using Ubuntu 10.10) and it
> says
> > that bp_seqfeature_load.pl (unchanged) --> I still can't use --summary
> > feature.
> >
> > Is there other way to use this feature?
> >
> >
> >
> >
> > On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net> wrote:
> >>
> >> Hi Minh,
> >>
> >> I don't know why that test failed, but if you don't need to parse or
> >> produce EMBL files, it doesn't matter (and even if you do, it still
> >> may not matter, depending on what the test was).  I suggest
> >> installing.
> >>
> >> Scott
> >>
> >>
> >> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> >> > Oh
> >> > One more thing, I just downloaded Bioperl 1.6.2 and
> >> >
> >> > When I tried to run perl Build.PL, i got this message.
> >> > *
> >> > Checking whether your kit is complete...
> >> > WARNING: the following files are missing in your kit:
> >> >    .shipit
> >> > Please inform the author.
> >> >
> >> > Checking prerequisites...
> >> > Install [a]ll optional external modules, [n]one, or choose
> >> > [i]nteractively?
> >> > [n]
> >> > *
> >> >
> >> > Then I ran ./Build test but it failed.
> >> >
> >> > Test Summary Report
> >> > -------------------
> >> > t/SeqIO/embl.t                             (Wstat: 512 Tests: 85
> Failed:
> >> > 0)
> >> >  Non-zero exit status: 2
> >> >  Parse errors: Bad plan.  You planned 95 tests but ran 85.
> >> > Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys + 79.46
> >> > cusr
> >> > 4.21 csys = 87.11 CPU)
> >> > Result: FAIL
> >> > Failed 1/350 test programs. 0/22459 subtests failed.
> >> >
> >> > Is there anyway to install 1.6.2 because I really need it. Thank you
> for
> >> > your help.
> >> >
> >> > On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com>
> wrote:
> >> >
> >> >> Hi,
> >> >>
> >> >> I am trying to use the "summary" feature in  bp_seqfeature_load.pl(for
> >> >> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to install
> >> >> 1.6.2 but no luck.
> >> >>
> >> >> First, I used GIT :
> >> >>
> >> >> git clone git://github.com/bioperl/bioperl-live.git
> >> >>
> >> >> and I got this error:
> >> >> *
> >> >> "github.com[0: 207.97.227.239]: errno=Connection timed out
> >> >> fatal: unable to connect a socket (Connection timed out)"
> >> >>
> >> >> *
> >> >> Then, I downloaded snapshot Core Modules on this page
> >> >> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
> either.
> >> >>
> >> >>
> >> >> could someone please show me how to install 1.6.2 or if there is
> anyway
> >> >> to use summary feature, please let me know.
> >> >>
> >> >> Thank you very much,
> >> >>
> >> >>
> >> >> --
> >> >> Minh Bui.
> >> >>
> >> >
> >> >
> >> >
> >> > --
> >> > Minh Bui.
> >> > _______________________________________________
> >> > Bioperl-l mailing list
> >> > Bioperl-l at lists.open-bio.org
> >> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >> >
> >>
> >>
> >>
> >> --
> >> ------------------------------------------------------------------------
> >> Scott Cain, Ph. D.                                   scott at scottcain
> >> dot net
> >> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> >> Ontario Institute for Cancer Research
> >
> >
> >
> > --
> > Minh Bui.
> >
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>



-- 
Minh Bui.

From scott at scottcain.net  Fri Feb  4 11:33:37 2011
From: scott at scottcain.net (Scott Cain)
Date: Fri, 4 Feb 2011 11:33:37 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
	<AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
	<AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>
Message-ID: <AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>

OK, the seqfeature_load script in that branch has the summary feature
option in it.  Are you sure that the script you have doesn't?

Scott


On Fri, Feb 4, 2011 at 11:27 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> I got it from here
> https://github.com/bioperl/bioperl-live/tree/release-1-6-2
>
>
>
> On Fri, Feb 4, 2011 at 11:23 AM, Scott Cain <scott at scottcain.net> wrote:
>>
>> Hi Minh,
>>
>> Where did you get BioPerl 1.6.2 from? ?It hasn't been released yet.
>> You need to be BioPerl from git hub to use summary features:
>>
>> ?https://github.com/bioperl/bioperl-live
>>
>> and click the download link on the right and select either tar.gz or
>> zip file to download.
>>
>> Scott
>>
>>
>> On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>> > HI Scott,
>> >
>> > I installed it anyway but the terminal (i am using Ubuntu 10.10) and it
>> > says
>> > that bp_seqfeature_load.pl (unchanged) --> I still can't use --summary
>> > feature.
>> >
>> > Is there other way to use this feature?
>> >
>> >
>> >
>> >
>> > On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net> wrote:
>> >>
>> >> Hi Minh,
>> >>
>> >> I don't know why that test failed, but if you don't need to parse or
>> >> produce EMBL files, it doesn't matter (and even if you do, it still
>> >> may not matter, depending on what the test was). ?I suggest
>> >> installing.
>> >>
>> >> Scott
>> >>
>> >>
>> >> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>> >> > Oh
>> >> > One more thing, I just downloaded Bioperl 1.6.2 and
>> >> >
>> >> > When I tried to run perl Build.PL, i got this message.
>> >> > *
>> >> > Checking whether your kit is complete...
>> >> > WARNING: the following files are missing in your kit:
>> >> > ? ?.shipit
>> >> > Please inform the author.
>> >> >
>> >> > Checking prerequisites...
>> >> > Install [a]ll optional external modules, [n]one, or choose
>> >> > [i]nteractively?
>> >> > [n]
>> >> > *
>> >> >
>> >> > Then I ran ./Build test but it failed.
>> >> >
>> >> > Test Summary Report
>> >> > -------------------
>> >> > t/SeqIO/embl.t ? ? ? ? ? ? ? ? ? ? ? ? ? ? (Wstat: 512 Tests: 85
>> >> > Failed:
>> >> > 0)
>> >> > ?Non-zero exit status: 2
>> >> > ?Parse errors: Bad plan. ?You planned 95 tests but ran 85.
>> >> > Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr ?0.66 sys +
>> >> > 79.46
>> >> > cusr
>> >> > 4.21 csys = 87.11 CPU)
>> >> > Result: FAIL
>> >> > Failed 1/350 test programs. 0/22459 subtests failed.
>> >> >
>> >> > Is there anyway to install 1.6.2 because I really need it. Thank you
>> >> > for
>> >> > your help.
>> >> >
>> >> > On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com>
>> >> > wrote:
>> >> >
>> >> >> Hi,
>> >> >>
>> >> >> I am trying to use the "summary" feature in ?bp_seqfeature_load.pl
>> >> >> (for
>> >> >> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to
>> >> >> install
>> >> >> 1.6.2 but no luck.
>> >> >>
>> >> >> First, I used GIT :
>> >> >>
>> >> >> git clone git://github.com/bioperl/bioperl-live.git
>> >> >>
>> >> >> and I got this error:
>> >> >> *
>> >> >> "github.com[0: 207.97.227.239]: errno=Connection timed out
>> >> >> fatal: unable to connect a socket (Connection timed out)"
>> >> >>
>> >> >> *
>> >> >> Then, I downloaded snapshot Core Modules on this page
>> >> >> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
>> >> >> either.
>> >> >>
>> >> >>
>> >> >> could someone please show me how to install 1.6.2 or if there is
>> >> >> anyway
>> >> >> to use summary feature, please let me know.
>> >> >>
>> >> >> Thank you very much,
>> >> >>
>> >> >>
>> >> >> --
>> >> >> Minh Bui.
>> >> >>
>> >> >
>> >> >
>> >> >
>> >> > --
>> >> > Minh Bui.
>> >> > _______________________________________________
>> >> > Bioperl-l mailing list
>> >> > Bioperl-l at lists.open-bio.org
>> >> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> >> >
>> >>
>> >>
>> >>
>> >> --
>> >>
>> >> ------------------------------------------------------------------------
>> >> Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain
>> >> dot net
>> >> GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
>> >> Ontario Institute for Cancer Research
>> >
>> >
>> >
>> > --
>> > Minh Bui.
>> >
>>
>>
>>
>> --
>> ------------------------------------------------------------------------
>> Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain
>> dot net
>> GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
>> Ontario Institute for Cancer Research
>
>
>
> --
> Minh Bui.
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From minou.nowrousian at rub.de  Fri Feb  4 11:37:46 2011
From: minou.nowrousian at rub.de (Minou Nowrousian)
Date: 4 Feb 2011 17:37:46 +0100
Subject: [Bioperl-l] BioPerl with Active Perl 5.12.2 ?
Message-ID: <000001cbc489$da869d90$8f93d8b0$@rub.de>

Hi all,

 

is Active Perl 5.12.2 (for Windows) supported by BioPerl or only Active Perl
5.10 ?

 

Regards,

Minou

 

 

Minou Nowrousian, Ph.D.

Department of General and Molecular Botany

Ruhr-University Bochum ND 6/165

Universitaetsstr. 150

44780 Bochum

Germany

phone +49 234 3224588

fax +49 234 3214184

email minou.nowrousian at rub.de


From buiduyminh at gmail.com  Fri Feb  4 11:37:59 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 11:37:59 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
	<AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
	<AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>
	<AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>
Message-ID: <AANLkTikwgoXAwLGZwffirrTRW0pZpjVdxjVrrSVt_cMM@mail.gmail.com>

I install the version you sent.

and it works.

Thank you very much, Scott.


On Fri, Feb 4, 2011 at 11:33 AM, Scott Cain <scott at scottcain.net> wrote:

> OK, the seqfeature_load script in that branch has the summary feature
> option in it.  Are you sure that the script you have doesn't?
>
> Scott
>
>
> On Fri, Feb 4, 2011 at 11:27 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> > I got it from here
> > https://github.com/bioperl/bioperl-live/tree/release-1-6-2
> >
> >
> >
> > On Fri, Feb 4, 2011 at 11:23 AM, Scott Cain <scott at scottcain.net> wrote:
> >>
> >> Hi Minh,
> >>
> >> Where did you get BioPerl 1.6.2 from?  It hasn't been released yet.
> >> You need to be BioPerl from git hub to use summary features:
> >>
> >>  https://github.com/bioperl/bioperl-live
> >>
> >> and click the download link on the right and select either tar.gz or
> >> zip file to download.
> >>
> >> Scott
> >>
> >>
> >> On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> >> > HI Scott,
> >> >
> >> > I installed it anyway but the terminal (i am using Ubuntu 10.10) and
> it
> >> > says
> >> > that bp_seqfeature_load.pl (unchanged) --> I still can't use
> --summary
> >> > feature.
> >> >
> >> > Is there other way to use this feature?
> >> >
> >> >
> >> >
> >> >
> >> > On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net>
> wrote:
> >> >>
> >> >> Hi Minh,
> >> >>
> >> >> I don't know why that test failed, but if you don't need to parse or
> >> >> produce EMBL files, it doesn't matter (and even if you do, it still
> >> >> may not matter, depending on what the test was).  I suggest
> >> >> installing.
> >> >>
> >> >> Scott
> >> >>
> >> >>
> >> >> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com>
> wrote:
> >> >> > Oh
> >> >> > One more thing, I just downloaded Bioperl 1.6.2 and
> >> >> >
> >> >> > When I tried to run perl Build.PL, i got this message.
> >> >> > *
> >> >> > Checking whether your kit is complete...
> >> >> > WARNING: the following files are missing in your kit:
> >> >> >    .shipit
> >> >> > Please inform the author.
> >> >> >
> >> >> > Checking prerequisites...
> >> >> > Install [a]ll optional external modules, [n]one, or choose
> >> >> > [i]nteractively?
> >> >> > [n]
> >> >> > *
> >> >> >
> >> >> > Then I ran ./Build test but it failed.
> >> >> >
> >> >> > Test Summary Report
> >> >> > -------------------
> >> >> > t/SeqIO/embl.t                             (Wstat: 512 Tests: 85
> >> >> > Failed:
> >> >> > 0)
> >> >> >  Non-zero exit status: 2
> >> >> >  Parse errors: Bad plan.  You planned 95 tests but ran 85.
> >> >> > Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys +
> >> >> > 79.46
> >> >> > cusr
> >> >> > 4.21 csys = 87.11 CPU)
> >> >> > Result: FAIL
> >> >> > Failed 1/350 test programs. 0/22459 subtests failed.
> >> >> >
> >> >> > Is there anyway to install 1.6.2 because I really need it. Thank
> you
> >> >> > for
> >> >> > your help.
> >> >> >
> >> >> > On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com>
> >> >> > wrote:
> >> >> >
> >> >> >> Hi,
> >> >> >>
> >> >> >> I am trying to use the "summary" feature in
> bp_seqfeature_load.pl
> >> >> >> (for
> >> >> >> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to
> >> >> >> install
> >> >> >> 1.6.2 but no luck.
> >> >> >>
> >> >> >> First, I used GIT :
> >> >> >>
> >> >> >> git clone git://github.com/bioperl/bioperl-live.git
> >> >> >>
> >> >> >> and I got this error:
> >> >> >> *
> >> >> >> "github.com[0: 207.97.227.239]: errno=Connection timed out
> >> >> >> fatal: unable to connect a socket (Connection timed out)"
> >> >> >>
> >> >> >> *
> >> >> >> Then, I downloaded snapshot Core Modules on this page
> >> >> >> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
> >> >> >> either.
> >> >> >>
> >> >> >>
> >> >> >> could someone please show me how to install 1.6.2 or if there is
> >> >> >> anyway
> >> >> >> to use summary feature, please let me know.
> >> >> >>
> >> >> >> Thank you very much,
> >> >> >>
> >> >> >>
> >> >> >> --
> >> >> >> Minh Bui.
> >> >> >>
> >> >> >
> >> >> >
> >> >> >
> >> >> > --
> >> >> > Minh Bui.
> >> >> > _______________________________________________
> >> >> > Bioperl-l mailing list
> >> >> > Bioperl-l at lists.open-bio.org
> >> >> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >> >> >
> >> >>
> >> >>
> >> >>
> >> >> --
> >> >>
> >> >>
> ------------------------------------------------------------------------
> >> >> Scott Cain, Ph. D.                                   scott at
> scottcain
> >> >> dot net
> >> >> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> >> >> Ontario Institute for Cancer Research
> >> >
> >> >
> >> >
> >> > --
> >> > Minh Bui.
> >> >
> >>
> >>
> >>
> >> --
> >> ------------------------------------------------------------------------
> >> Scott Cain, Ph. D.                                   scott at scottcain
> >> dot net
> >> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> >> Ontario Institute for Cancer Research
> >
> >
> >
> > --
> > Minh Bui.
> >
>
>
>
> --
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot
> net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
>



-- 
Minh Bui.

From cjfields at illinois.edu  Fri Feb  4 11:50:22 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 4 Feb 2011 10:50:22 -0600
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
	<AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
	<AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>
	<AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>
Message-ID: <9DC67C84-FA88-4F3C-90B9-3D007E4B64E7@illinois.edu>

Note that is a branch, not a tagged release.  We created a new branch for the eventual 1.6.2 release due to problems cherry-picking commits over the last year or so.  It's not really different from master, with the exception that we'll be merging code in from the recent evo hackathon soon to master and NOT to the release.

chris

On Feb 4, 2011, at 10:33 AM, Scott Cain wrote:

> OK, the seqfeature_load script in that branch has the summary feature
> option in it.  Are you sure that the script you have doesn't?
> 
> Scott
> 
> 
> On Fri, Feb 4, 2011 at 11:27 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>> I got it from here
>> https://github.com/bioperl/bioperl-live/tree/release-1-6-2
>> 
>> 
>> 
>> On Fri, Feb 4, 2011 at 11:23 AM, Scott Cain <scott at scottcain.net> wrote:
>>> 
>>> Hi Minh,
>>> 
>>> Where did you get BioPerl 1.6.2 from?  It hasn't been released yet.
>>> You need to be BioPerl from git hub to use summary features:
>>> 
>>>  https://github.com/bioperl/bioperl-live
>>> 
>>> and click the download link on the right and select either tar.gz or
>>> zip file to download.
>>> 
>>> Scott
>>> 
>>> 
>>> On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>>>> HI Scott,
>>>> 
>>>> I installed it anyway but the terminal (i am using Ubuntu 10.10) and it
>>>> says
>>>> that bp_seqfeature_load.pl (unchanged) --> I still can't use --summary
>>>> feature.
>>>> 
>>>> Is there other way to use this feature?
>>>> 
>>>> 
>>>> 
>>>> 
>>>> On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net> wrote:
>>>>> 
>>>>> Hi Minh,
>>>>> 
>>>>> I don't know why that test failed, but if you don't need to parse or
>>>>> produce EMBL files, it doesn't matter (and even if you do, it still
>>>>> may not matter, depending on what the test was).  I suggest
>>>>> installing.
>>>>> 
>>>>> Scott
>>>>> 
>>>>> 
>>>>> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com> wrote:
>>>>>> Oh
>>>>>> One more thing, I just downloaded Bioperl 1.6.2 and
>>>>>> 
>>>>>> When I tried to run perl Build.PL, i got this message.
>>>>>> *
>>>>>> Checking whether your kit is complete...
>>>>>> WARNING: the following files are missing in your kit:
>>>>>>    .shipit
>>>>>> Please inform the author.
>>>>>> 
>>>>>> Checking prerequisites...
>>>>>> Install [a]ll optional external modules, [n]one, or choose
>>>>>> [i]nteractively?
>>>>>> [n]
>>>>>> *
>>>>>> 
>>>>>> Then I ran ./Build test but it failed.
>>>>>> 
>>>>>> Test Summary Report
>>>>>> -------------------
>>>>>> t/SeqIO/embl.t                             (Wstat: 512 Tests: 85
>>>>>> Failed:
>>>>>> 0)
>>>>>>  Non-zero exit status: 2
>>>>>>  Parse errors: Bad plan.  You planned 95 tests but ran 85.
>>>>>> Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys +
>>>>>> 79.46
>>>>>> cusr
>>>>>> 4.21 csys = 87.11 CPU)
>>>>>> Result: FAIL
>>>>>> Failed 1/350 test programs. 0/22459 subtests failed.
>>>>>> 
>>>>>> Is there anyway to install 1.6.2 because I really need it. Thank you
>>>>>> for
>>>>>> your help.
>>>>>> 
>>>>>> On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com>
>>>>>> wrote:
>>>>>> 
>>>>>>> Hi,
>>>>>>> 
>>>>>>> I am trying to use the "summary" feature in  bp_seqfeature_load.pl
>>>>>>> (for
>>>>>>> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to
>>>>>>> install
>>>>>>> 1.6.2 but no luck.
>>>>>>> 
>>>>>>> First, I used GIT :
>>>>>>> 
>>>>>>> git clone git://github.com/bioperl/bioperl-live.git
>>>>>>> 
>>>>>>> and I got this error:
>>>>>>> *
>>>>>>> "github.com[0: 207.97.227.239]: errno=Connection timed out
>>>>>>> fatal: unable to connect a socket (Connection timed out)"
>>>>>>> 
>>>>>>> *
>>>>>>> Then, I downloaded snapshot Core Modules on this page
>>>>>>> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
>>>>>>> either.
>>>>>>> 
>>>>>>> 
>>>>>>> could someone please show me how to install 1.6.2 or if there is
>>>>>>> anyway
>>>>>>> to use summary feature, please let me know.
>>>>>>> 
>>>>>>> Thank you very much,
>>>>>>> 
>>>>>>> 
>>>>>>> --
>>>>>>> Minh Bui.
>>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> 
>>>>>> --
>>>>>> Minh Bui.
>>>>>> _______________________________________________
>>>>>> Bioperl-l mailing list
>>>>>> Bioperl-l at lists.open-bio.org
>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>> 
>>>>> 
>>>>> 
>>>>> 
>>>>> --
>>>>> 
>>>>> ------------------------------------------------------------------------
>>>>> Scott Cain, Ph. D.                                   scott at scottcain
>>>>> dot net
>>>>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>>>>> Ontario Institute for Cancer Research
>>>> 
>>>> 
>>>> 
>>>> --
>>>> Minh Bui.
>>>> 
>>> 
>>> 
>>> 
>>> --
>>> ------------------------------------------------------------------------
>>> Scott Cain, Ph. D.                                   scott at scottcain
>>> dot net
>>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
>>> Ontario Institute for Cancer Research
>> 
>> 
>> 
>> --
>> Minh Bui.
>> 
> 
> 
> 
> -- 
> ------------------------------------------------------------------------
> Scott Cain, Ph. D.                                   scott at scottcain dot net
> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> Ontario Institute for Cancer Research
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From buiduyminh at gmail.com  Fri Feb  4 12:52:21 2011
From: buiduyminh at gmail.com (Minh Bui)
Date: Fri, 4 Feb 2011 12:52:21 -0500
Subject: [Bioperl-l] How to install 1.6.2
In-Reply-To: <9DC67C84-FA88-4F3C-90B9-3D007E4B64E7@illinois.edu>
References: <AANLkTikbS83rP=ZrzLQVRYwohOgCAD9dKhLMmNO33_QD@mail.gmail.com>
	<AANLkTingC4ntHGcSyVM16JeD=ovLkv8achUeyUn9bL-D@mail.gmail.com>
	<AANLkTim0s+2sf+h7VJBYq7QMSGKMniJyz2Vsk5wV4d7X@mail.gmail.com>
	<AANLkTinUwrOyN0cO6THzhaopOvL_R4v7ohKdaQD2D7y4@mail.gmail.com>
	<AANLkTi=1Cy_abrRm61uaiJMBcprgFLyC4jt3LQPpK4X2@mail.gmail.com>
	<AANLkTikbvofh9sggczOOtUXBVtZ6_iftW2YzUOOGQn+d@mail.gmail.com>
	<AANLkTim6LXuXG5PY6BLjJXQ58ZUMnM5KeEZ2T8TwW=jw@mail.gmail.com>
	<9DC67C84-FA88-4F3C-90B9-3D007E4B64E7@illinois.edu>
Message-ID: <AANLkTin9v00Y==3szyff1BeOqibdAaJLhLO-g6Haqqz1@mail.gmail.com>

Thank you so much for your help and clarification.

Minh.

On Fri, Feb 4, 2011 at 11:50 AM, Chris Fields <cjfields at illinois.edu> wrote:

> Note that is a branch, not a tagged release.  We created a new branch for
> the eventual 1.6.2 release due to problems cherry-picking commits over the
> last year or so.  It's not really different from master, with the exception
> that we'll be merging code in from the recent evo hackathon soon to master
> and NOT to the release.
>
> chris
>
> On Feb 4, 2011, at 10:33 AM, Scott Cain wrote:
>
> > OK, the seqfeature_load script in that branch has the summary feature
> > option in it.  Are you sure that the script you have doesn't?
> >
> > Scott
> >
> >
> > On Fri, Feb 4, 2011 at 11:27 AM, Minh Bui <buiduyminh at gmail.com> wrote:
> >> I got it from here
> >> https://github.com/bioperl/bioperl-live/tree/release-1-6-2
> >>
> >>
> >>
> >> On Fri, Feb 4, 2011 at 11:23 AM, Scott Cain <scott at scottcain.net>
> wrote:
> >>>
> >>> Hi Minh,
> >>>
> >>> Where did you get BioPerl 1.6.2 from?  It hasn't been released yet.
> >>> You need to be BioPerl from git hub to use summary features:
> >>>
> >>>  https://github.com/bioperl/bioperl-live
> >>>
> >>> and click the download link on the right and select either tar.gz or
> >>> zip file to download.
> >>>
> >>> Scott
> >>>
> >>>
> >>> On Fri, Feb 4, 2011 at 11:14 AM, Minh Bui <buiduyminh at gmail.com>
> wrote:
> >>>> HI Scott,
> >>>>
> >>>> I installed it anyway but the terminal (i am using Ubuntu 10.10) and
> it
> >>>> says
> >>>> that bp_seqfeature_load.pl (unchanged) --> I still can't use
> --summary
> >>>> feature.
> >>>>
> >>>> Is there other way to use this feature?
> >>>>
> >>>>
> >>>>
> >>>>
> >>>> On Fri, Feb 4, 2011 at 11:09 AM, Scott Cain <scott at scottcain.net>
> wrote:
> >>>>>
> >>>>> Hi Minh,
> >>>>>
> >>>>> I don't know why that test failed, but if you don't need to parse or
> >>>>> produce EMBL files, it doesn't matter (and even if you do, it still
> >>>>> may not matter, depending on what the test was).  I suggest
> >>>>> installing.
> >>>>>
> >>>>> Scott
> >>>>>
> >>>>>
> >>>>> On Fri, Feb 4, 2011 at 11:05 AM, Minh Bui <buiduyminh at gmail.com>
> wrote:
> >>>>>> Oh
> >>>>>> One more thing, I just downloaded Bioperl 1.6.2 and
> >>>>>>
> >>>>>> When I tried to run perl Build.PL, i got this message.
> >>>>>> *
> >>>>>> Checking whether your kit is complete...
> >>>>>> WARNING: the following files are missing in your kit:
> >>>>>>    .shipit
> >>>>>> Please inform the author.
> >>>>>>
> >>>>>> Checking prerequisites...
> >>>>>> Install [a]ll optional external modules, [n]one, or choose
> >>>>>> [i]nteractively?
> >>>>>> [n]
> >>>>>> *
> >>>>>>
> >>>>>> Then I ran ./Build test but it failed.
> >>>>>>
> >>>>>> Test Summary Report
> >>>>>> -------------------
> >>>>>> t/SeqIO/embl.t                             (Wstat: 512 Tests: 85
> >>>>>> Failed:
> >>>>>> 0)
> >>>>>>  Non-zero exit status: 2
> >>>>>>  Parse errors: Bad plan.  You planned 95 tests but ran 85.
> >>>>>> Files=350, Tests=22459, 96 wallclock secs ( 2.78 usr  0.66 sys +
> >>>>>> 79.46
> >>>>>> cusr
> >>>>>> 4.21 csys = 87.11 CPU)
> >>>>>> Result: FAIL
> >>>>>> Failed 1/350 test programs. 0/22459 subtests failed.
> >>>>>>
> >>>>>> Is there anyway to install 1.6.2 because I really need it. Thank you
> >>>>>> for
> >>>>>> your help.
> >>>>>>
> >>>>>> On Fri, Feb 4, 2011 at 10:44 AM, Minh Bui <buiduyminh at gmail.com>
> >>>>>> wrote:
> >>>>>>
> >>>>>>> Hi,
> >>>>>>>
> >>>>>>> I am trying to use the "summary" feature in  bp_seqfeature_load.pl
> >>>>>>> (for
> >>>>>>> Gbrowse) but it requires Bioperl 1.6.2. I have been trying to
> >>>>>>> install
> >>>>>>> 1.6.2 but no luck.
> >>>>>>>
> >>>>>>> First, I used GIT :
> >>>>>>>
> >>>>>>> git clone git://github.com/bioperl/bioperl-live.git
> >>>>>>>
> >>>>>>> and I got this error:
> >>>>>>> *
> >>>>>>> "github.com[0: 207.97.227.239]: errno=Connection timed out
> >>>>>>> fatal: unable to connect a socket (Connection timed out)"
> >>>>>>>
> >>>>>>> *
> >>>>>>> Then, I downloaded snapshot Core Modules on this page
> >>>>>>> http://www.bioperl.org/wiki/Getting_BioPerl but it doesn't work
> >>>>>>> either.
> >>>>>>>
> >>>>>>>
> >>>>>>> could someone please show me how to install 1.6.2 or if there is
> >>>>>>> anyway
> >>>>>>> to use summary feature, please let me know.
> >>>>>>>
> >>>>>>> Thank you very much,
> >>>>>>>
> >>>>>>>
> >>>>>>> --
> >>>>>>> Minh Bui.
> >>>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>> --
> >>>>>> Minh Bui.
> >>>>>> _______________________________________________
> >>>>>> Bioperl-l mailing list
> >>>>>> Bioperl-l at lists.open-bio.org
> >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>> --
> >>>>>
> >>>>>
> ------------------------------------------------------------------------
> >>>>> Scott Cain, Ph. D.                                   scott at
> scottcain
> >>>>> dot net
> >>>>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> >>>>> Ontario Institute for Cancer Research
> >>>>
> >>>>
> >>>>
> >>>> --
> >>>> Minh Bui.
> >>>>
> >>>
> >>>
> >>>
> >>> --
> >>>
> ------------------------------------------------------------------------
> >>> Scott Cain, Ph. D.                                   scott at scottcain
> >>> dot net
> >>> GMOD Coordinator (http://gmod.org/)                     216-392-3087
> >>> Ontario Institute for Cancer Research
> >>
> >>
> >>
> >> --
> >> Minh Bui.
> >>
> >
> >
> >
> > --
> > ------------------------------------------------------------------------
> > Scott Cain, Ph. D.                                   scott at scottcain
> dot net
> > GMOD Coordinator (http://gmod.org/)                     216-392-3087
> > Ontario Institute for Cancer Research
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


-- 
Minh Bui.

From cjfields at illinois.edu  Fri Feb  4 16:19:13 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Fri, 4 Feb 2011 15:19:13 -0600
Subject: [Bioperl-l] Bioperl-run Wrappers
In-Reply-To: <AANLkTim2nUcaRVxfXrYt45mL8K2ODr+PmVkR9tZA0PxB@mail.gmail.com>
References: <AANLkTim2nUcaRVxfXrYt45mL8K2ODr+PmVkR9tZA0PxB@mail.gmail.com>
Message-ID: <C9A3F12C-BE80-4214-8C77-87F4CD98ECFB@illinois.edu>

On Jan 28, 2011, at 12:18 PM, Ben Bimber wrote:

> Hello,
> 
> I'm using CommandExts to wrap a number of tools.  In a pipeline I was
> looking to make the tools log their current version.  I realized that
> instead of using run() in a unique way for each tool, perhaps there
> should be a consistent method that gets called and returns a version
> string.  because obtaining this version string is specific to the
> tool, perhaps each wrapper could provide a version() method that runs
> the appropriate command on the executable, parses, then returns some
> string.  has something like this been discussed?  have others already
> solved this?
> 
> Thanks,
> Ben

(apologies for the late response, maybe you worked it out?)

If you mean a version string for the wrapped tool, there is a Bio::Tools::Run::WrapperBase method called version() I believe (not implemented for obvious reasons, but implemented by each wrapper as needed).  If you want a specific version of the module (say, an API version) you may want to assign $VERSION or create a new global ($API_VERSION, perhaps) in case it conflicts with the BioPerl core version.

chris




From bbimber at gmail.com  Fri Feb  4 16:33:57 2011
From: bbimber at gmail.com (Ben Bimber)
Date: Fri, 4 Feb 2011 15:33:57 -0600
Subject: [Bioperl-l] Bioperl-run Wrappers
In-Reply-To: <C9A3F12C-BE80-4214-8C77-87F4CD98ECFB@illinois.edu>
References: <AANLkTim2nUcaRVxfXrYt45mL8K2ODr+PmVkR9tZA0PxB@mail.gmail.com>
	<C9A3F12C-BE80-4214-8C77-87F4CD98ECFB@illinois.edu>
Message-ID: <AANLkTim5HP+FDBrdwZVbOPwrBOgj=qicrNqiecyKVVrn@mail.gmail.com>

Hi Chris,

I actually was referring to the software version of the executable
itself, not the perl code.  for example, I added something like this
to a mosaik wrapper I made:

sub version {
	my $self = shift;	
	my ($out, $err);
	IPC::Run::run([$self->executable, '-h'], '>', \$out, '2>', \$err);
	my @out = split("\n", $out);
	my $version = join(';', grep( /^Mosaik/i, @out));
	$version =~ m/^.*0m ([\d\.]*)\b/i;
	return "Mosaik Version: $1\n";
	
}

It runs the executable, parses the output (which is specific to mosaik
in this case) and returns it.  I had an issue with a tool version
recently, so I decided it was probably a good idea to start recording
them with pipelines.  In hindsight version() is probably the wrong
name since it's confusing with perl's VERSION, but maybe exe_version()
or something makes sense.  I would personally find it useful if there
were a standard, but optional method across BioPerl wrappers to do
this sort of thing.  implementing it would be optional per wrapper.
all it would really need to do it return a string.

-Ben









On Fri, Feb 4, 2011 at 3:19 PM, Chris Fields <cjfields at illinois.edu> wrote:
> On Jan 28, 2011, at 12:18 PM, Ben Bimber wrote:
>
>> Hello,
>>
>> I'm using CommandExts to wrap a number of tools. ?In a pipeline I was
>> looking to make the tools log their current version. ?I realized that
>> instead of using run() in a unique way for each tool, perhaps there
>> should be a consistent method that gets called and returns a version
>> string. ?because obtaining this version string is specific to the
>> tool, perhaps each wrapper could provide a version() method that runs
>> the appropriate command on the executable, parses, then returns some
>> string. ?has something like this been discussed? ?have others already
>> solved this?
>>
>> Thanks,
>> Ben
>
> (apologies for the late response, maybe you worked it out?)
>
> If you mean a version string for the wrapped tool, there is a Bio::Tools::Run::WrapperBase method called version() I believe (not implemented for obvious reasons, but implemented by each wrapper as needed). ?If you want a specific version of the module (say, an API version) you may want to assign $VERSION or create a new global ($API_VERSION, perhaps) in case it conflicts with the BioPerl core version.
>
> chris
>
>
>


From jason.stajich at gmail.com  Fri Feb  4 17:03:48 2011
From: jason.stajich at gmail.com (Jason Stajich)
Date: Fri, 04 Feb 2011 14:03:48 -0800
Subject: [Bioperl-l] Bioperl-run Wrappers
In-Reply-To: <AANLkTim5HP+FDBrdwZVbOPwrBOgj=qicrNqiecyKVVrn@mail.gmail.com>
References: <AANLkTim2nUcaRVxfXrYt45mL8K2ODr+PmVkR9tZA0PxB@mail.gmail.com>	<C9A3F12C-BE80-4214-8C77-87F4CD98ECFB@illinois.edu>
	<AANLkTim5HP+FDBrdwZVbOPwrBOgj=qicrNqiecyKVVrn@mail.gmail.com>
Message-ID: <4D4C77C4.7080506@gmail.com>

There is such a method in the Wrapper interface - it is implemented for 
tools (exe) that support outputting the version in some way. e.g. here 
is implementation for infernal (Bio::Tools::Run::Infernal)

=head2  version

  Title   : version
  Usage   : $v = $prog->version();
  Function: Determine the version number of the program (uses cmsearch)
  Example :
  Returns : float or undef
  Args    : none

=cut

sub version {
     my ($self) = @_;
     return unless $self->executable;
     my $exe = $self->executable;
     my $string = `$exe -h 2>&1`;
     my $v;
     if ($string =~ m{Infernal\s([\d.]+)}) {
         $v = $1;
         $self->deprecated(-message => "Only Infernal 1.0 and above is 
supported.",
                           -version => 1.006001) if $v < 1;
     }
     return $self->{'_progversion'} = $v || undef;
}



Ben Bimber wrote:
> Hi Chris,
>
> I actually was referring to the software version of the executable
> itself, not the perl code.  for example, I added something like this
> to a mosaik wrapper I made:
>
> sub version {
> 	my $self = shift;	
> 	my ($out, $err);
> 	IPC::Run::run([$self->executable, '-h'], '>', \$out, '2>', \$err);
> 	my @out = split("\n", $out);
> 	my $version = join(';', grep( /^Mosaik/i, @out));
> 	$version =~ m/^.*0m ([\d\.]*)\b/i;
> 	return "Mosaik Version: $1\n";
> 	
> }
>
> It runs the executable, parses the output (which is specific to mosaik
> in this case) and returns it.  I had an issue with a tool version
> recently, so I decided it was probably a good idea to start recording
> them with pipelines.  In hindsight version() is probably the wrong
> name since it's confusing with perl's VERSION, but maybe exe_version()
> or something makes sense.  I would personally find it useful if there
> were a standard, but optional method across BioPerl wrappers to do
> this sort of thing.  implementing it would be optional per wrapper.
> all it would really need to do it return a string.
>
> -Ben
>
>
>
>
>
>
>
>
>
> On Fri, Feb 4, 2011 at 3:19 PM, Chris Fields<cjfields at illinois.edu>  wrote:
>> On Jan 28, 2011, at 12:18 PM, Ben Bimber wrote:
>>
>>> Hello,
>>>
>>> I'm using CommandExts to wrap a number of tools.  In a pipeline I was
>>> looking to make the tools log their current version.  I realized that
>>> instead of using run() in a unique way for each tool, perhaps there
>>> should be a consistent method that gets called and returns a version
>>> string.  because obtaining this version string is specific to the
>>> tool, perhaps each wrapper could provide a version() method that runs
>>> the appropriate command on the executable, parses, then returns some
>>> string.  has something like this been discussed?  have others already
>>> solved this?
>>>
>>> Thanks,
>>> Ben
>> (apologies for the late response, maybe you worked it out?)
>>
>> If you mean a version string for the wrapped tool, there is a Bio::Tools::Run::WrapperBase method called version() I believe (not implemented for obvious reasons, but implemented by each wrapper as needed).  If you want a specific version of the module (say, an API version) you may want to assign $VERSION or create a new global ($API_VERSION, perhaps) in case it conflicts with the BioPerl core version.
>>
>> chris
>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
Jason Stajich



From bbimber at gmail.com  Fri Feb  4 17:10:10 2011
From: bbimber at gmail.com (Ben Bimber)
Date: Fri, 4 Feb 2011 16:10:10 -0600
Subject: [Bioperl-l] Bioperl-run Wrappers
In-Reply-To: <4D4C77C4.7080506@gmail.com>
References: <AANLkTim2nUcaRVxfXrYt45mL8K2ODr+PmVkR9tZA0PxB@mail.gmail.com>
	<C9A3F12C-BE80-4214-8C77-87F4CD98ECFB@illinois.edu>
	<AANLkTim5HP+FDBrdwZVbOPwrBOgj=qicrNqiecyKVVrn@mail.gmail.com>
	<4D4C77C4.7080506@gmail.com>
Message-ID: <AANLkTinCXDVKaFUL3yg49BrgJdzxSvphoAnvb2jOWZY1@mail.gmail.com>

Jason,

thanks for the reply - i will look into that more, but that looks
roughly comparable to what i tried to do.

the one comment i have is that "Returns : float or undef" may or may
not be the right thing.  i forget which forum i saw this in, but
relatively recently there was a similar discussion about whether
version was a string or numeric.  it happened because some tool
reported its version as "1.3b".  one could argue that this is the
tool's fault and a version is always numeric, but it should be noted
that sometimes it isnt reported as such.

-Ben




On Fri, Feb 4, 2011 at 4:03 PM, Jason Stajich <jason.stajich at gmail.com> wrote:
> There is such a method in the Wrapper interface - it is implemented for
> tools (exe) that support outputting the version in some way. e.g. here is
> implementation for infernal (Bio::Tools::Run::Infernal)
>
> =head2 ?version
>
> ?Title ? : version
> ?Usage ? : $v = $prog->version();
> ?Function: Determine the version number of the program (uses cmsearch)
> ?Example :
> ?Returns : float or undef
> ?Args ? ?: none
>
> =cut
>
> sub version {
> ? ?my ($self) = @_;
> ? ?return unless $self->executable;
> ? ?my $exe = $self->executable;
> ? ?my $string = `$exe -h 2>&1`;
> ? ?my $v;
> ? ?if ($string =~ m{Infernal\s([\d.]+)}) {
> ? ? ? ?$v = $1;
> ? ? ? ?$self->deprecated(-message => "Only Infernal 1.0 and above is
> supported.",
> ? ? ? ? ? ? ? ? ? ? ? ? ?-version => 1.006001) if $v < 1;
> ? ?}
> ? ?return $self->{'_progversion'} = $v || undef;
> }
>
>
>
> Ben Bimber wrote:
>>
>> Hi Chris,
>>
>> I actually was referring to the software version of the executable
>> itself, not the perl code. ?for example, I added something like this
>> to a mosaik wrapper I made:
>>
>> sub version {
>> ? ? ? ?my $self = shift;
>> ? ? ? ?my ($out, $err);
>> ? ? ? ?IPC::Run::run([$self->executable, '-h'], '>', \$out, '2>', \$err);
>> ? ? ? ?my @out = split("\n", $out);
>> ? ? ? ?my $version = join(';', grep( /^Mosaik/i, @out));
>> ? ? ? ?$version =~ m/^.*0m ([\d\.]*)\b/i;
>> ? ? ? ?return "Mosaik Version: $1\n";
>>
>> }
>>
>> It runs the executable, parses the output (which is specific to mosaik
>> in this case) and returns it. ?I had an issue with a tool version
>> recently, so I decided it was probably a good idea to start recording
>> them with pipelines. ?In hindsight version() is probably the wrong
>> name since it's confusing with perl's VERSION, but maybe exe_version()
>> or something makes sense. ?I would personally find it useful if there
>> were a standard, but optional method across BioPerl wrappers to do
>> this sort of thing. ?implementing it would be optional per wrapper.
>> all it would really need to do it return a string.
>>
>> -Ben
>>
>>
>>
>>
>>
>>
>>
>>
>>
>> On Fri, Feb 4, 2011 at 3:19 PM, Chris Fields<cjfields at illinois.edu>
>> ?wrote:
>>>
>>> On Jan 28, 2011, at 12:18 PM, Ben Bimber wrote:
>>>
>>>> Hello,
>>>>
>>>> I'm using CommandExts to wrap a number of tools. ?In a pipeline I was
>>>> looking to make the tools log their current version. ?I realized that
>>>> instead of using run() in a unique way for each tool, perhaps there
>>>> should be a consistent method that gets called and returns a version
>>>> string. ?because obtaining this version string is specific to the
>>>> tool, perhaps each wrapper could provide a version() method that runs
>>>> the appropriate command on the executable, parses, then returns some
>>>> string. ?has something like this been discussed? ?have others already
>>>> solved this?
>>>>
>>>> Thanks,
>>>> Ben
>>>
>>> (apologies for the late response, maybe you worked it out?)
>>>
>>> If you mean a version string for the wrapped tool, there is a
>>> Bio::Tools::Run::WrapperBase method called version() I believe (not
>>> implemented for obvious reasons, but implemented by each wrapper as needed).
>>> ?If you want a specific version of the module (say, an API version) you may
>>> want to assign $VERSION or create a new global ($API_VERSION, perhaps) in
>>> case it conflicts with the BioPerl core version.
>>>
>>> chris
>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
> --
> Jason Stajich
>
>
>


From aradwen at gmail.com  Sat Feb  5 10:23:52 2011
From: aradwen at gmail.com (Radhouane Aniba)
Date: Sat, 5 Feb 2011 10:23:52 -0500
Subject: [Bioperl-l] Biocoders.net
Message-ID: <AANLkTi=4qysj=fMtUHHmX6AAUnuDMXVAQzV=Y=pnETix@mail.gmail.com>

Dear collegues,

biocoders.net is now open for perl/bioperl and java/biojava coders since I
recieved many requests for that.

Feel free to join and to share your source codes and snippets.

Regards

Radhouane
http://biocoders.net


-- 
*Radhouane Aniba*
*Bioinformatics Research Associate*
*Institute for Advanced Computer Studies
Center for Bioinformatics and Computational Biology* *(CBCB)*
*University of Maryland, College Park
MD 20742*

From hlapp at drycafe.net  Sat Feb  5 18:45:47 2011
From: hlapp at drycafe.net (Hilmar Lapp)
Date: Sat, 5 Feb 2011 18:45:47 -0500
Subject: [Bioperl-l] NESCent Seeks Hackathon Whitepapers
In-Reply-To: <0D7D89E4-C0D4-4347-A94C-21800E927746@ad.unc.edu>
References: <BF0025BB-27BC-440C-83A4-77172421C9C8@ad.unc.edu>
	<E3EBA44A-EFE4-4279-BD4D-38FC9D190413@nescent.org>
	<0D7D89E4-C0D4-4347-A94C-21800E927746@ad.unc.edu>
Message-ID: <066A2391-6041-408C-B26E-9B867DE785C7@drycafe.net>

The National Evolutionary Synthesis Center (NESCent), in keeping with  
its objective to promote collaborative development of open-source,  
reusable, and standards-supporting informatics resources, sponsors  
highly collaborative, face-to-face software development events, called  
"hackathons" (see [1]). To ensure that this program continues to be  
responsive to user needs and to tap into the expertise and creativity  
of the evolutionary biology community, NESCent is soliciting short  
whitepapers (2-6 pages) [2] on potential target areas for future  
hackathons.

To further encourage submissions, we have now distilled specific  
guidelines for proposing hackathon events, based on the experiences  
gained from events we have sponsored in the past:
http://informatics.nescent.org/wiki/Hackathon_Whitepaper_Guidelines

The Center's Call for Informatics Whitepapers [3] includes not only  
hackathons, but also a large spectrum of other initiatives to be  
undertaken by the Center, including training, software development,  
collaborative ontology development, and coordination of data  
standards. Whitepapers are accepted at any time and reviewed on an on- 
going basis.

URLs:
[1] Collaborative cyberinfrastructure events and programs organized by  
NESCent:
http://informatics.nescent.org/wiki/Main_Page

[2] NESCent Call for Informatics Whitepapers
http://www.nescent.org/informatics/whitepapers.php

[3] Hackathon Whitepaper Guidelines:
http://informatics.nescent.org/wiki/Hackathon_Whitepaper_Guidelines

[4] Past NESCent-sponsored hackathons:
http://informatics.nescent.org/wiki/Main_Page#Hackathons

From shalabh.sharma7 at gmail.com  Sun Feb  6 15:42:02 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Sun, 6 Feb 2011 15:42:02 -0500
Subject: [Bioperl-l] Reading and writing fastq files
Message-ID: <AANLkTinZuSnKLbJaON=pnEinEZSDE6s_Z4CD1qC60Wjj@mail.gmail.com>

Hi,
    i am trying to read and write fastq files.
I can read them and can change format (like fastq files to fasta) but when i
try to write them back as 'fastq' format i am getting a warning:

--------------------- WARNING ---------------------
MSG: You can't write FASTQ without supplying a Bio::Seq::Quality object!

and i am not getting getting any output.
I am using bioperl 1.61

My part of code looks like this:

#!/usr/bin/perl -w
use Bio::SeqIO;
$in = Bio::SeqIO->new(-file => "$ARGV[0]", -format => 'fastq');
- - - - -- -
 - - - -- - -

while(my $seq = $in->next_seq){
         -- - - - -  -
         - - - - - - -
         $outr->write_seq($in);
}

fastq file looks like this:

@1477:2:1:1143:901/1
NTCGGTACAGCGACAAACAGACGATATCACCGGCTAAGCTCGATGGTGGTTACGGATGCGAAACAACGTGGTAGCTCAGGTAAGGATTTAAGGCCTTCTATTACTTTGGTTAATGAAGGCCGTGAACCAATTTGTGTGCCTGGACTCAATA
+
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@1477:2:1:1143:901/2
ATTAACCACCGCACCTGCAGGCATTACATAATGCACCGCGATATTGGTTCCAGCCACCCAAATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNGCTTCCCATCGNTAACCACCATC
+
\cf_ff[fdcfebcad^e\YadcYdceWe\^deaed_Y[c\dd[ce^bfbdbRLWa]R^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@1477:2:1:1166:923/1
NTACTCCAGCGGAAAATGCTACGCTTCGATCATTGCTAATATCAAATAACGTTTTTTGCTCAACCGATGAGCTTTCCAGTCGGTAAGGAAGCGGTTCATTAGCCTGAGCGAGCGGGTCAAAAACGATATCTTCGCGAGCTTCATACTTAAC
+
BKOHONNNMN_______________BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

I would really appreciate if some one can help me out.

Thanks
Shalabh

From bbimber at gmail.com  Sun Feb  6 16:09:31 2011
From: bbimber at gmail.com (Ben Bimber)
Date: Sun, 6 Feb 2011 15:09:31 -0600
Subject: [Bioperl-l] Reading and writing fastq files
In-Reply-To: <AANLkTinZuSnKLbJaON=pnEinEZSDE6s_Z4CD1qC60Wjj@mail.gmail.com>
References: <AANLkTinZuSnKLbJaON=pnEinEZSDE6s_Z4CD1qC60Wjj@mail.gmail.com>
Message-ID: <AANLkTinNYnZP4Ks3dkrELT7r8A+RBNNZwH64bz7AwTT5@mail.gmail.com>

i think you want:

$outr->write_seq($seq);

instead of trying to write $in.

-ben



On Sun, Feb 6, 2011 at 2:42 PM, shalabh sharma
<shalabh.sharma7 at gmail.com> wrote:
> Hi,
> ? ?i am trying to read and write fastq files.
> I can read them and can change format (like fastq files to fasta) but when i
> try to write them back as 'fastq' format i am getting a warning:
>
> --------------------- WARNING ---------------------
> MSG: You can't write FASTQ without supplying a Bio::Seq::Quality object!
>
> and i am not getting getting any output.
> I am using bioperl 1.61
>
> My part of code looks like this:
>
> #!/usr/bin/perl -w
> use Bio::SeqIO;
> $in = Bio::SeqIO->new(-file => "$ARGV[0]", -format => 'fastq');
> - - - - -- -
> ?- - - -- - -
>
> while(my $seq = $in->next_seq){
> ? ? ? ? -- - - - - ?-
> ? ? ? ? - - - - - - -
> ? ? ? ? $outr->write_seq($in);
> }
>
> fastq file looks like this:
>
> @1477:2:1:1143:901/1
> NTCGGTACAGCGACAAACAGACGATATCACCGGCTAAGCTCGATGGTGGTTACGGATGCGAAACAACGTGGTAGCTCAGGTAAGGATTTAAGGCCTTCTATTACTTTGGTTAATGAAGGCCGTGAACCAATTTGTGTGCCTGGACTCAATA
> +
> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> @1477:2:1:1143:901/2
> ATTAACCACCGCACCTGCAGGCATTACATAATGCACCGCGATATTGGTTCCAGCCACCCAAATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNGCTTCCCATCGNTAACCACCATC
> +
> \cf_ff[fdcfebcad^e\YadcYdceWe\^deaed_Y[c\dd[ce^bfbdbRLWa]R^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> @1477:2:1:1166:923/1
> NTACTCCAGCGGAAAATGCTACGCTTCGATCATTGCTAATATCAAATAACGTTTTTTGCTCAACCGATGAGCTTTCCAGTCGGTAAGGAAGCGGTTCATTAGCCTGAGCGAGCGGGTCAAAAACGATATCTTCGCGAGCTTCATACTTAAC
> +
> BKOHONNNMN_______________BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
>
> I would really appreciate if some one can help me out.
>
> Thanks
> Shalabh
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From shalabh.sharma7 at gmail.com  Sun Feb  6 16:12:39 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Sun, 6 Feb 2011 16:12:39 -0500
Subject: [Bioperl-l] Reading and writing fastq files
In-Reply-To: <AANLkTinNYnZP4Ks3dkrELT7r8A+RBNNZwH64bz7AwTT5@mail.gmail.com>
References: <AANLkTinZuSnKLbJaON=pnEinEZSDE6s_Z4CD1qC60Wjj@mail.gmail.com>
	<AANLkTinNYnZP4Ks3dkrELT7r8A+RBNNZwH64bz7AwTT5@mail.gmail.com>
Message-ID: <AANLkTikdDp5HJQAzQBkTTf3W-c7A2d=2A9=0r0K+=Oyy@mail.gmail.com>

Hi Ben,
        Thanks a lot, i didn't even noticed that, my bad.
I really appreciate it.

Thanks
Shalabh


On Sun, Feb 6, 2011 at 4:09 PM, Ben Bimber <bbimber at gmail.com> wrote:

> i think you want:
>
> $outr->write_seq($seq);
>
> instead of trying to write $in.
>
> -ben
>
>
>
> On Sun, Feb 6, 2011 at 2:42 PM, shalabh sharma
> <shalabh.sharma7 at gmail.com> wrote:
> > Hi,
> >    i am trying to read and write fastq files.
> > I can read them and can change format (like fastq files to fasta) but
> when i
> > try to write them back as 'fastq' format i am getting a warning:
> >
> > --------------------- WARNING ---------------------
> > MSG: You can't write FASTQ without supplying a Bio::Seq::Quality object!
> >
> > and i am not getting getting any output.
> > I am using bioperl 1.61
> >
> > My part of code looks like this:
> >
> > #!/usr/bin/perl -w
> > use Bio::SeqIO;
> > $in = Bio::SeqIO->new(-file => "$ARGV[0]", -format => 'fastq');
> > - - - - -- -
> >  - - - -- - -
> >
> > while(my $seq = $in->next_seq){
> >         -- - - - -  -
> >         - - - - - - -
> >         $outr->write_seq($in);
> > }
> >
> > fastq file looks like this:
> >
> > @1477:2:1:1143:901/1
> >
> NTCGGTACAGCGACAAACAGACGATATCACCGGCTAAGCTCGATGGTGGTTACGGATGCGAAACAACGTGGTAGCTCAGGTAAGGATTTAAGGCCTTCTATTACTTTGGTTAATGAAGGCCGTGAACCAATTTGTGTGCCTGGACTCAATA
> > +
> >
> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> > @1477:2:1:1143:901/2
> >
> ATTAACCACCGCACCTGCAGGCATTACATAATGCACCGCGATATTGGTTCCAGCCACCCAAATTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNGCTTCCCATCGNTAACCACCATC
> > +
> >
> \cf_ff[fdcfebcad^e\YadcYdceWe\^deaed_Y[c\dd[ce^bfbdbRLWa]R^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> > @1477:2:1:1166:923/1
> >
> NTACTCCAGCGGAAAATGCTACGCTTCGATCATTGCTAATATCAAATAACGTTTTTTGCTCAACCGATGAGCTTTCCAGTCGGTAAGGAAGCGGTTCATTAGCCTGAGCGAGCGGGTCAAAAACGATATCTTCGCGAGCTTCATACTTAAC
> > +
> >
> BKOHONNNMN_______________BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
> >
> > I would really appreciate if some one can help me out.
> >
> > Thanks
> > Shalabh
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>

From sharmashalu.bio at gmail.com  Mon Feb  7 17:07:33 2011
From: sharmashalu.bio at gmail.com (shalu sharma)
Date: Mon, 7 Feb 2011 17:07:33 -0500
Subject: [Bioperl-l] randomizing fastq sequences
Message-ID: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>

Hi,
   i am trying to test one program for which i need to change order of
sequences in a fastq file.
My fastq file contains about 50,000 sequences.
Is there any script that can do this task?

Thanks
Shalu

From simon.andrews at bbsrc.ac.uk  Tue Feb  8 03:41:10 2011
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Tue, 8 Feb 2011 08:41:10 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
Message-ID: <0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>


On 7 Feb 2011, at 22:07, shalu sharma wrote:

> Hi,
>   i am trying to test one program for which i need to change order of
> sequences in a fastq file.
> My fastq file contains about 50,000 sequences.
> Is there any script that can do this task?

Since FastQ is supported in SeqIO you could do something like (untested):

#!/usr/bin/perl
use warnings;
use strict;
use List::Util 'shuffle';
use Bio::SeqIO;

my @seqs;

my $in = Bio::SeqIO->new(-file => 'your_intput.fastq',
			 -format => 'Fastq');

while (my $seq = $in -> next_seq()) {
    push @seqs,$seq;
}

@seqs = shuffle(@seqs);

my $out = Bio::SeqIO->new(-file => '>your_output.fastq',
			  -format => 'Fastq');

foreach my $seq (@seqs) {
    $out->write_seq($seq);
}

## End

This has the disadvantage that it will hold all of the sequences in memory whilst shuffling, but I don't think there's an easy way around that.

Simon.

From fs5 at sanger.ac.uk  Tue Feb  8 04:08:37 2011
From: fs5 at sanger.ac.uk (Frank Schwach)
Date: Tue, 08 Feb 2011 09:08:37 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
	<0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>
Message-ID: <4D510815.1020800@sanger.ac.uk>

If memory is an issue then I guess you could create a file of just the 
sequence IDs (one per line), then shuffle those (using List::Util like 
Simon demonstrated). In the end you would substitute the IDs for the 
whole fastq entry again, which you can do without reading an entire file 
into memory (might be bit slow but that probably doesn't
matter)
Frank


simon andrews (BI) wrote:
> On 7 Feb 2011, at 22:07, shalu sharma wrote:
>
>   
>> Hi,
>>   i am trying to test one program for which i need to change order of
>> sequences in a fastq file.
>> My fastq file contains about 50,000 sequences.
>> Is there any script that can do this task?
>>     
>
> Since FastQ is supported in SeqIO you could do something like (untested):
>
> #!/usr/bin/perl
> use warnings;
> use strict;
> use List::Util 'shuffle';
> use Bio::SeqIO;
>
> my @seqs;
>
> my $in = Bio::SeqIO->new(-file => 'your_intput.fastq',
> 			 -format => 'Fastq');
>
> while (my $seq = $in -> next_seq()) {
>     push @seqs,$seq;
> }
>
> @seqs = shuffle(@seqs);
>
> my $out = Bio::SeqIO->new(-file => '>your_output.fastq',
> 			  -format => 'Fastq');
>
> foreach my $seq (@seqs) {
>     $out->write_seq($seq);
> }
>
> ## End
>
> This has the disadvantage that it will hold all of the sequences in memory whilst shuffling, but I don't think there's an easy way around that.
>
> Simon.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>   


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From roy.chaudhuri at gmail.com  Tue Feb  8 06:31:15 2011
From: roy.chaudhuri at gmail.com (Roy Chaudhuri)
Date: Tue, 08 Feb 2011 11:31:15 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <4D510815.1020800@sanger.ac.uk>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>	<0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>
	<4D510815.1020800@sanger.ac.uk>
Message-ID: <4D512983.1040008@gmail.com>

TMTOWTDI, maybe also use the Tie::File module?

Something like:

#!/usr/bin/perl
use warnings FATAL=>qw(all);
use Modern::Perl;
use Tie::File;
use Fcntl qw(O_RDONLY);
use List::Util qw(shuffle);
my @fastq;
tie @fastq, 'Tie::File', $ARGV[0], mode=>O_RDONLY or die $!;
say join "\n", @fastq[4*$_..4*$_+3] for shuffle 0..$#fastq/4;

Cheers,
Roy.

On 08/02/2011 09:08, Frank Schwach wrote:
> If memory is an issue then I guess you could create a file of just the
> sequence IDs (one per line), then shuffle those (using List::Util like
> Simon demonstrated). In the end you would substitute the IDs for the
> whole fastq entry again, which you can do without reading an entire file
> into memory (might be bit slow but that probably doesn't
> matter)
> Frank
>
>
> simon andrews (BI) wrote:
>> On 7 Feb 2011, at 22:07, shalu sharma wrote:
>>
>>
>>> Hi,
>>>    i am trying to test one program for which i need to change order of
>>> sequences in a fastq file.
>>> My fastq file contains about 50,000 sequences.
>>> Is there any script that can do this task?
>>>
>>
>> Since FastQ is supported in SeqIO you could do something like (untested):
>>
>> #!/usr/bin/perl
>> use warnings;
>> use strict;
>> use List::Util 'shuffle';
>> use Bio::SeqIO;
>>
>> my @seqs;
>>
>> my $in = Bio::SeqIO->new(-file =>  'your_intput.fastq',
>> 			 -format =>  'Fastq');
>>
>> while (my $seq = $in ->  next_seq()) {
>>      push @seqs,$seq;
>> }
>>
>> @seqs = shuffle(@seqs);
>>
>> my $out = Bio::SeqIO->new(-file =>  '>your_output.fastq',
>> 			  -format =>  'Fastq');
>>
>> foreach my $seq (@seqs) {
>>      $out->write_seq($seq);
>> }
>>
>> ## End
>>
>> This has the disadvantage that it will hold all of the sequences in memory whilst shuffling, but I don't think there's an easy way around that.
>>
>> Simon.
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>


From fs5 at sanger.ac.uk  Tue Feb  8 06:57:12 2011
From: fs5 at sanger.ac.uk (Frank Schwach)
Date: Tue, 08 Feb 2011 11:57:12 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <4D512983.1040008@gmail.com>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>	<0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>	<4D510815.1020800@sanger.ac.uk>
	<4D512983.1040008@gmail.com>
Message-ID: <4D512F98.2020005@sanger.ac.uk>

nice one - but if I understand it correctly it relies on there being 
exactly 4 lines for each record. This is probably the case but it would 
be a good idea to double-check the fastq file in question, just to make 
sure.

Frank


Roy Chaudhuri wrote:
> TMTOWTDI, maybe also use the Tie::File module?
>
> Something like:
>
> #!/usr/bin/perl
> use warnings FATAL=>qw(all);
> use Modern::Perl;
> use Tie::File;
> use Fcntl qw(O_RDONLY);
> use List::Util qw(shuffle);
> my @fastq;
> tie @fastq, 'Tie::File', $ARGV[0], mode=>O_RDONLY or die $!;
> say join "\n", @fastq[4*$_..4*$_+3] for shuffle 0..$#fastq/4;
>
> Cheers,
> Roy.
>
> On 08/02/2011 09:08, Frank Schwach wrote:
>> If memory is an issue then I guess you could create a file of just the
>> sequence IDs (one per line), then shuffle those (using List::Util like
>> Simon demonstrated). In the end you would substitute the IDs for the
>> whole fastq entry again, which you can do without reading an entire file
>> into memory (might be bit slow but that probably doesn't
>> matter)
>> Frank
>>
>>
>> simon andrews (BI) wrote:
>>> On 7 Feb 2011, at 22:07, shalu sharma wrote:
>>>
>>>
>>>> Hi,
>>>>    i am trying to test one program for which i need to change order of
>>>> sequences in a fastq file.
>>>> My fastq file contains about 50,000 sequences.
>>>> Is there any script that can do this task?
>>>>
>>>
>>> Since FastQ is supported in SeqIO you could do something like 
>>> (untested):
>>>
>>> #!/usr/bin/perl
>>> use warnings;
>>> use strict;
>>> use List::Util 'shuffle';
>>> use Bio::SeqIO;
>>>
>>> my @seqs;
>>>
>>> my $in = Bio::SeqIO->new(-file =>  'your_intput.fastq',
>>>              -format =>  'Fastq');
>>>
>>> while (my $seq = $in ->  next_seq()) {
>>>      push @seqs,$seq;
>>> }
>>>
>>> @seqs = shuffle(@seqs);
>>>
>>> my $out = Bio::SeqIO->new(-file =>  '>your_output.fastq',
>>>               -format =>  'Fastq');
>>>
>>> foreach my $seq (@seqs) {
>>>      $out->write_seq($seq);
>>> }
>>>
>>> ## End
>>>
>>> This has the disadvantage that it will hold all of the sequences in 
>>> memory whilst shuffling, but I don't think there's an easy way 
>>> around that.
>>>
>>> Simon.
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From roy.chaudhuri at gmail.com  Tue Feb  8 07:09:39 2011
From: roy.chaudhuri at gmail.com (Roy Chaudhuri)
Date: Tue, 08 Feb 2011 12:09:39 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <4D512F98.2020005@sanger.ac.uk>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>	<0B4CB72F-2479-48B3-93BF-96733C670C7A@bbsrc.ac.uk>	<4D510815.1020800@sanger.ac.uk>
	<4D512983.1040008@gmail.com> <4D512F98.2020005@sanger.ac.uk>
Message-ID: <4D513283.2060205@gmail.com>

Sorry, I should have included that caveat.

On 08/02/2011 11:57, Frank Schwach wrote:
> nice one - but if I understand it correctly it relies on there being
> exactly 4 lines for each record. This is probably the case but it would
> be a good idea to double-check the fastq file in question, just to make
> sure.
>
> Frank
>
>
> Roy Chaudhuri wrote:
>> TMTOWTDI, maybe also use the Tie::File module?
>>
>> Something like:
>>
>> #!/usr/bin/perl
>> use warnings FATAL=>qw(all);
>> use Modern::Perl;
>> use Tie::File;
>> use Fcntl qw(O_RDONLY);
>> use List::Util qw(shuffle);
>> my @fastq;
>> tie @fastq, 'Tie::File', $ARGV[0], mode=>O_RDONLY or die $!;
>> say join "\n", @fastq[4*$_..4*$_+3] for shuffle 0..$#fastq/4;
>>
>> Cheers,
>> Roy.
>>
>> On 08/02/2011 09:08, Frank Schwach wrote:
>>> If memory is an issue then I guess you could create a file of just the
>>> sequence IDs (one per line), then shuffle those (using List::Util like
>>> Simon demonstrated). In the end you would substitute the IDs for the
>>> whole fastq entry again, which you can do without reading an entire file
>>> into memory (might be bit slow but that probably doesn't
>>> matter)
>>> Frank
>>>
>>>
>>> simon andrews (BI) wrote:
>>>> On 7 Feb 2011, at 22:07, shalu sharma wrote:
>>>>
>>>>
>>>>> Hi,
>>>>>     i am trying to test one program for which i need to change order of
>>>>> sequences in a fastq file.
>>>>> My fastq file contains about 50,000 sequences.
>>>>> Is there any script that can do this task?
>>>>>
>>>>
>>>> Since FastQ is supported in SeqIO you could do something like
>>>> (untested):
>>>>
>>>> #!/usr/bin/perl
>>>> use warnings;
>>>> use strict;
>>>> use List::Util 'shuffle';
>>>> use Bio::SeqIO;
>>>>
>>>> my @seqs;
>>>>
>>>> my $in = Bio::SeqIO->new(-file =>   'your_intput.fastq',
>>>>               -format =>   'Fastq');
>>>>
>>>> while (my $seq = $in ->   next_seq()) {
>>>>       push @seqs,$seq;
>>>> }
>>>>
>>>> @seqs = shuffle(@seqs);
>>>>
>>>> my $out = Bio::SeqIO->new(-file =>   '>your_output.fastq',
>>>>                -format =>   'Fastq');
>>>>
>>>> foreach my $seq (@seqs) {
>>>>       $out->write_seq($seq);
>>>> }
>>>>
>>>> ## End
>>>>
>>>> This has the disadvantage that it will hold all of the sequences in
>>>> memory whilst shuffling, but I don't think there's an easy way
>>>> around that.
>>>>
>>>> Simon.
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


From MEC at stowers.org  Tue Feb  8 10:12:47 2011
From: MEC at stowers.org (Cook, Malcolm)
Date: Tue, 8 Feb 2011 09:12:47 -0600
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
Message-ID: <BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>

Gotta chime in....

If 
	you're working with fastq files 
	are working in unix and have the `shuf` command available

I recommand you to install cdbyank http://sourceforge.net/projects/cdbfasta/ which provides for indexing fasta and fastq files and providing random access to them 

Index the fastq, then extract the IDs with cdyank, pipe them through `shuf` and then through cdyank again to pull out the sequences.

Like this example, which uses a test fastq from my local install of bioperl:

> cd ~/local/src/bioperl-live/t/data/fastq/
> cdbfasta -Q example.fastq
3 entries from file example.fastq were indexed in file example.fastq.cidx
> cdbyank -l example.fastq.cidx | shuf | cdbyank example.fastq.cidx > shuf_example.fastq

There would be issues if your IDs are not unique.

Malcolm Cook
Stowers Institute for Medical Research -  Bioinformatics
Kansas City, Missouri  USA
 
 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org 
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
> shalu sharma
> Sent: Monday, February 07, 2011 4:08 PM
> To: bioperl-l at lists.open-bio.org
> Subject: [Bioperl-l] randomizing fastq sequences
> 
> Hi,
>    i am trying to test one program for which i need to change 
> order of sequences in a fastq file.
> My fastq file contains about 50,000 sequences.
> Is there any script that can do this task?
> 
> Thanks
> Shalu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

From cjfields at illinois.edu  Tue Feb  8 10:53:27 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 8 Feb 2011 09:53:27 -0600
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>
Message-ID: <16863A4B-A091-42C9-BD6A-2CA383743ED0@illinois.edu>

Just to note, I have been thinking about wrapping this for fast indexing and retrieval of FASTQ for bioperl (this came up in a prior thread, with the same suggestion from Malcolm IIRC).

chris

On Feb 8, 2011, at 9:12 AM, Cook, Malcolm wrote:

> Gotta chime in....
> 
> If 
> 	you're working with fastq files 
> 	are working in unix and have the `shuf` command available
> 
> I recommand you to install cdbyank http://sourceforge.net/projects/cdbfasta/ which provides for indexing fasta and fastq files and providing random access to them 
> 
> Index the fastq, then extract the IDs with cdyank, pipe them through `shuf` and then through cdyank again to pull out the sequences.
> 
> Like this example, which uses a test fastq from my local install of bioperl:
> 
>> cd ~/local/src/bioperl-live/t/data/fastq/
>> cdbfasta -Q example.fastq
> 3 entries from file example.fastq were indexed in file example.fastq.cidx
>> cdbyank -l example.fastq.cidx | shuf | cdbyank example.fastq.cidx > shuf_example.fastq
> 
> There would be issues if your IDs are not unique.
> 
> Malcolm Cook
> Stowers Institute for Medical Research -  Bioinformatics
> Kansas City, Missouri  USA
> 
> 
> 
>> -----Original Message-----
>> From: bioperl-l-bounces at lists.open-bio.org 
>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
>> shalu sharma
>> Sent: Monday, February 07, 2011 4:08 PM
>> To: bioperl-l at lists.open-bio.org
>> Subject: [Bioperl-l] randomizing fastq sequences
>> 
>> Hi,
>>   i am trying to test one program for which i need to change 
>> order of sequences in a fastq file.
>> My fastq file contains about 50,000 sequences.
>> Is there any script that can do this task?
>> 
>> Thanks
>> Shalu
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From sharmashalu.bio at gmail.com  Tue Feb  8 11:48:44 2011
From: sharmashalu.bio at gmail.com (shalu sharma)
Date: Tue, 8 Feb 2011 11:48:44 -0500
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <16863A4B-A091-42C9-BD6A-2CA383743ED0@illinois.edu>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>
	<16863A4B-A091-42C9-BD6A-2CA383743ED0@illinois.edu>
Message-ID: <AANLkTikq_uHzVa=p9EeqDS=mKmWdYGD-+pdqOWnWxNm2@mail.gmail.com>

Hi All,
    Thanks for all the suggestions.
@Simon Andrew and Roy:
   Your method worked perfect but now memory is the issue.
Now i have to select 50K fastq sequences from a illumina data (around 70 mil
reads) randomly , so is there again any module that can select random
sequences from fastq file?

I can still use same methods on 50k sequences but getting 50k from huge data
set is a problem.
Also at some point i need to shuffle the  fastq reads (order of
nucleotides).

I am really sorry for asking lot of things , i know i am really bad in
handling fastq sequences.
i would really appreciate your suggestions.

Thanks
Shalu

On Tue, Feb 8, 2011 at 10:53 AM, Chris Fields <cjfields at illinois.edu> wrote:

> Just to note, I have been thinking about wrapping this for fast indexing
> and retrieval of FASTQ for bioperl (this came up in a prior thread, with the
> same suggestion from Malcolm IIRC).
>
> chris
>
> On Feb 8, 2011, at 9:12 AM, Cook, Malcolm wrote:
>
> > Gotta chime in....
> >
> > If
> >       you're working with fastq files
> >       are working in unix and have the `shuf` command available
> >
> > I recommand you to install cdbyank
> http://sourceforge.net/projects/cdbfasta/ which provides for indexing
> fasta and fastq files and providing random access to them
> >
> > Index the fastq, then extract the IDs with cdyank, pipe them through
> `shuf` and then through cdyank again to pull out the sequences.
> >
> > Like this example, which uses a test fastq from my local install of
> bioperl:
> >
> >> cd ~/local/src/bioperl-live/t/data/fastq/
> >> cdbfasta -Q example.fastq
> > 3 entries from file example.fastq were indexed in file example.fastq.cidx
> >> cdbyank -l example.fastq.cidx | shuf | cdbyank example.fastq.cidx >
> shuf_example.fastq
> >
> > There would be issues if your IDs are not unique.
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research -  Bioinformatics
> > Kansas City, Missouri  USA
> >
> >
> >
> >> -----Original Message-----
> >> From: bioperl-l-bounces at lists.open-bio.org
> >> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of
> >> shalu sharma
> >> Sent: Monday, February 07, 2011 4:08 PM
> >> To: bioperl-l at lists.open-bio.org
> >> Subject: [Bioperl-l] randomizing fastq sequences
> >>
> >> Hi,
> >>   i am trying to test one program for which i need to change
> >> order of sequences in a fastq file.
> >> My fastq file contains about 50,000 sequences.
> >> Is there any script that can do this task?
> >>
> >> Thanks
> >> Shalu
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>

From cjfields at illinois.edu  Tue Feb  8 12:29:56 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 8 Feb 2011 11:29:56 -0600
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <AANLkTikq_uHzVa=p9EeqDS=mKmWdYGD-+pdqOWnWxNm2@mail.gmail.com>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>
	<16863A4B-A091-42C9-BD6A-2CA383743ED0@illinois.edu>
	<AANLkTikq_uHzVa=p9EeqDS=mKmWdYGD-+pdqOWnWxNm2@mail.gmail.com>
Message-ID: <D104BF48-01EC-448B-8079-BC341836A059@illinois.edu>

Shalu,

(Note: this isn't a Perl solution): I do think this problem has been solved somewhat in R/BioC if you have it installed, in the ShortRead package (see 'Sampler-class' in the ShortRead docs).

I think using perl and the current BioPerl Bio::Index::Fastq indexing scheme for FASTQ will be problematic/slow for very large files with millions of sequences (i.e. pretty much anything that is rolling out of modern day sequencing pipelines), as the current indexing implementation uses a very simple indexing scheme using DB_File, originally designed years ago for much smaller sequencing samples.  Think: Sanger sequencing.  

Of course, this is with the caveat that I haven't tested this out personally, but I recall some complaints about this in the past (Jason?).  There was an effort to deal with this at one point with AnyDBM_File (which allows SQLite now) but I don't think it progressed very far, primarily b/c there simply hasn't been enough demand.  Most users seem to sample randomly from BAM files instead, which are conveniently accessible via samtools/Picard/bamtools/etc (bamtools has a 'random' option for this purpose).

chris

On Feb 8, 2011, at 10:48 AM, shalu sharma wrote:

> Hi All,
>     Thanks for all the suggestions.
> @Simon Andrew and Roy:
>    Your method worked perfect but now memory is the issue.
> Now i have to select 50K fastq sequences from a illumina data (around 70 mil reads) randomly , so is there again any module that can select random sequences from fastq file?
> 
> I can still use same methods on 50k sequences but getting 50k from huge data set is a problem.
> Also at some point i need to shuffle the  fastq reads (order of nucleotides).
> 
> I am really sorry for asking lot of things , i know i am really bad in handling fastq sequences.
> i would really appreciate your suggestions.
> 
> Thanks
> Shalu 
> 
> On Tue, Feb 8, 2011 at 10:53 AM, Chris Fields <cjfields at illinois.edu> wrote:
> Just to note, I have been thinking about wrapping this for fast indexing and retrieval of FASTQ for bioperl (this came up in a prior thread, with the same suggestion from Malcolm IIRC).
> 
> chris
> 
> On Feb 8, 2011, at 9:12 AM, Cook, Malcolm wrote:
> 
> > Gotta chime in....
> >
> > If
> >       you're working with fastq files
> >       are working in unix and have the `shuf` command available
> >
> > I recommand you to install cdbyank http://sourceforge.net/projects/cdbfasta/ which provides for indexing fasta and fastq files and providing random access to them
> >
> > Index the fastq, then extract the IDs with cdyank, pipe them through `shuf` and then through cdyank again to pull out the sequences.
> >
> > Like this example, which uses a test fastq from my local install of bioperl:
> >
> >> cd ~/local/src/bioperl-live/t/data/fastq/
> >> cdbfasta -Q example.fastq
> > 3 entries from file example.fastq were indexed in file example.fastq.cidx
> >> cdbyank -l example.fastq.cidx | shuf | cdbyank example.fastq.cidx > shuf_example.fastq
> >
> > There would be issues if your IDs are not unique.
> >
> > Malcolm Cook
> > Stowers Institute for Medical Research -  Bioinformatics
> > Kansas City, Missouri  USA
> >
> >
> >
> >> -----Original Message-----
> >> From: bioperl-l-bounces at lists.open-bio.org
> >> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of
> >> shalu sharma
> >> Sent: Monday, February 07, 2011 4:08 PM
> >> To: bioperl-l at lists.open-bio.org
> >> Subject: [Bioperl-l] randomizing fastq sequences
> >>
> >> Hi,
> >>   i am trying to test one program for which i need to change
> >> order of sequences in a fastq file.
> >> My fastq file contains about 50,000 sequences.
> >> Is there any script that can do this task?
> >>
> >> Thanks
> >> Shalu
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 



From simon.andrews at bbsrc.ac.uk  Wed Feb  9 03:35:34 2011
From: simon.andrews at bbsrc.ac.uk (simon andrews (BI))
Date: Wed, 9 Feb 2011 08:35:34 +0000
Subject: [Bioperl-l] randomizing fastq sequences
In-Reply-To: <AANLkTikq_uHzVa=p9EeqDS=mKmWdYGD-+pdqOWnWxNm2@mail.gmail.com>
References: <AANLkTinCZTMeHRVY3EeTE+O+L=QEG4y2GCw8aMerZCXV@mail.gmail.com>
	<BD62CBAC4395B94096109020651BE2EC13A1F92ADB@EXCHMB-02.stowers-institute.org>
	<16863A4B-A091-42C9-BD6A-2CA383743ED0@illinois.edu>
	<AANLkTikq_uHzVa=p9EeqDS=mKmWdYGD-+pdqOWnWxNm2@mail.gmail.com>
Message-ID: <9A0DA8F0-A3F1-47F6-951F-AD884F5630C8@bbsrc.ac.uk>


On 8 Feb 2011, at 16:48, shalu sharma wrote:

> Hi All,
>    Thanks for all the suggestions.
> @Simon Andrew and Roy:
>   Your method worked perfect but now memory is the issue.
> Now i have to select 50K fastq sequences from a illumina data (around 70 mil
> reads) randomly , so is there again any module that can select random
> sequences from fastq file?

The simple approach to this is to do it in two passes.  

In the first pass you simply find out how many fastq entries you have in your file.  You then randomly select 50K numbers from 1..[number of fastq seqs in file].

In the second pass you pull out any sequences at an index position you randomly selected.  If you don't mind them being in the same order then you can just write them out immediately and use virtually no memory, or you could put them in an array and shuffle them before writing (using the same memory as the 50K experiment).

If you're going to be doing a lot of shuffling on the same dataset then it would be worth looking into doing a proper indexing of your file, as others have suggested, but if you're only going to do this once per dataset then it might not save you any time.


> Also at some point i need to shuffle the  fastq reads (order of
> nucleotides).

Same basic process - extract the sequence, split it into an array, shuffle the array, reassign the sequence.  If you want to keep the original quality scores associated with the same bases you'll need to shuffle indices and then reassemble both the shuffled sequences and qualities at the same time.


Simon.






From jordi.durban at gmail.com  Mon Feb 14 05:41:56 2011
From: jordi.durban at gmail.com (Jordi Durban)
Date: Mon, 14 Feb 2011 11:41:56 +0100
Subject: [Bioperl-l] parse columns file
Message-ID: <AANLkTik4kgb1Y4WvE2wBYXWbbQAw3MqTguxOwtYVdA9d@mail.gmail.com>

Hi all!
I'm trying to parse a three columns file. The first one could be repeated.
However, I would like to obtain the results for the first one.
That is:
my file:
*uaccno=FF56QEU12HD1LC *   *gi|166216293|sp|P0C616.1|PA2HA_BOTAS
3.52797e-18*
uaccno=FF56QEU12HD1LC    gi|164421989|gb|ABY55159.1|    3.52797e-18
*uaccno=FF56QEU12HMBY2*    *gi|166216293|sp|P0C616.1|PA2HA_BOTAS
9.01317e-19*
uaccno=FF56QEU12HMBY2    gi|164421989|gb|ABY55159.1|    9.01317e-19
*uaccno=FF56QEU12HDB9V *  * gi|166215047|sp|P24605.3|PA2H2_BOTAS
2.61668e-25*
uaccno=FF56QEU12HDB9V    gi|71041979|pdb|1Y4L|A    2.61668e-25

I'm interested in the bold lines.
I'll be grateful for some advices.
Thanks

-- 
Jordi

From jordi.durban at gmail.com  Mon Feb 14 06:34:36 2011
From: jordi.durban at gmail.com (Jordi Durban)
Date: Mon, 14 Feb 2011 12:34:36 +0100
Subject: [Bioperl-l] parse columns file
In-Reply-To: <AANLkTik7nbc-J-Jxr671hHuB7ANJ1kU1nzYgeykW4y0H@mail.gmail.com>
References: <AANLkTik4kgb1Y4WvE2wBYXWbbQAw3MqTguxOwtYVdA9d@mail.gmail.com>
	<AANLkTik7nbc-J-Jxr671hHuB7ANJ1kU1nzYgeykW4y0H@mail.gmail.com>
Message-ID: <AANLkTikpDwean+g5-0tKpRL9PWWYGr2d7aZGdvASPFKE@mail.gmail.com>

Thank you very much John. The output should be the two fields from each
entry. In the example above, it should be:
*uaccno=FF56QEU12HD1LC *   *gi|166216293|sp|P0C616.1|PA2HA_BOTAS
**uaccno=FF56QEU12HMBY2*    *gi|166216293|sp|P0C616.1|PA2HA_BOTAS *
*uaccno=FF56QEU12HDB9V *  * gi|166215047|sp|P24605.3|PA2H2_BOTAS

*According to http://perl.about.com/od/filesystem/a/perl_parse_tabs.htm I
have to do:

open (FILE, 'data.txt');
 while (<FILE>) {
 chomp;
 ($name, $email, $phone) = split("\t");
 print "Name: $name\n";
 print "Email: $email\n";
 print "Phone: $phone\n";

 print "---------\n";
 }

 close (FILE);

But this script doesn't deal with the duplicated lines...

2011/2/14 John SJ Anderson <genehack at genehack.org>

> On Mon, Feb 14, 2011 at 05:41, Jordi Durban <jordi.durban at gmail.com>
> wrote:
> > Hi all!
> > I'm trying to parse a three columns file. The first one could be
> repeated.
> > However, I would like to obtain the results for the first one.
> [ snip ]
>
> You've given us the input. What should the output look like?
>
> j.
>



-- 
Jordi

From jordi.durban at gmail.com  Mon Feb 14 07:27:58 2011
From: jordi.durban at gmail.com (Jordi Durban)
Date: Mon, 14 Feb 2011 13:27:58 +0100
Subject: [Bioperl-l] parse columns file
In-Reply-To: <1297685447.4541.113.camel@deskpro15336.internal.sanger.ac.uk>
References: <AANLkTik4kgb1Y4WvE2wBYXWbbQAw3MqTguxOwtYVdA9d@mail.gmail.com>
	<AANLkTik7nbc-J-Jxr671hHuB7ANJ1kU1nzYgeykW4y0H@mail.gmail.com>
	<AANLkTikpDwean+g5-0tKpRL9PWWYGr2d7aZGdvASPFKE@mail.gmail.com>
	<1297685447.4541.113.camel@deskpro15336.internal.sanger.ac.uk>
Message-ID: <AANLkTi=Zi_aEUxdNahZCS+qDJqMAh5KTRMrGCRx-_qfA@mail.gmail.com>

Ok. That's true. I suspected that was a "hash" question but I don't know
much about hashes and I expectd to find some bioperl scripts to do that.
Thank you very much.

2011/2/14 Frank Schwach <fs5 at sanger.ac.uk>

> Hi Jordi,
>
> you will want to use a *hash* to store your IDs if you want to make them
> non-redundant. This is not BioPerl related - it's more of a basic Perl
> question. My recommendation would be to get the excellent "Beginning
> Perl for Bioinformatics" book from O'Reilly and also check out the
> general-Perl sites and forums, such as perlmonks.com. You can also just
> google for Perl hashes and see if it makes sense to you and try to work
> it into the example script you found already. Good luck!!
>
> Frank
>
>
> On Mon, 2011-02-14 at 12:34 +0100, Jordi Durban wrote:
> > Thank you very much John. The output should be the two fields from each
> > entry. In the example above, it should be:
> > *uaccno=FF56QEU12HD1LC *   *gi|166216293|sp|P0C616.1|PA2HA_BOTAS
> > **uaccno=FF56QEU12HMBY2*    *gi|166216293|sp|P0C616.1|PA2HA_BOTAS *
> > *uaccno=FF56QEU12HDB9V *  * gi|166215047|sp|P24605.3|PA2H2_BOTAS
> >
> > *According to http://perl.about.com/od/filesystem/a/perl_parse_tabs.htmI
> > have to do:
> >
> > open (FILE, 'data.txt');
> >  while (<FILE>) {
> >  chomp;
> >  ($name, $email, $phone) = split("\t");
> >  print "Name: $name\n";
> >  print "Email: $email\n";
> >  print "Phone: $phone\n";
> >
> >  print "---------\n";
> >  }
> >
> >  close (FILE);
> >
> > But this script doesn't deal with the duplicated lines...
> >
> > 2011/2/14 John SJ Anderson <genehack at genehack.org>
> >
> > > On Mon, Feb 14, 2011 at 05:41, Jordi Durban <jordi.durban at gmail.com>
> > > wrote:
> > > > Hi all!
> > > > I'm trying to parse a three columns file. The first one could be
> > > repeated.
> > > > However, I would like to obtain the results for the first one.
> > > [ snip ]
> > >
> > > You've given us the input. What should the output look like?
> > >
> > > j.
> > >
> >
> >
> >
>
>
>
> --
>  The Wellcome Trust Sanger Institute is operated by Genome Research
>  Limited, a charity registered in England with number 1021457 and a
>  company registered in England with number 2742969, whose registered
>  office is 215 Euston Road, London, NW1 2BE.
>



-- 
Jordi

From fs5 at sanger.ac.uk  Mon Feb 14 07:10:46 2011
From: fs5 at sanger.ac.uk (Frank Schwach)
Date: Mon, 14 Feb 2011 12:10:46 +0000
Subject: [Bioperl-l] parse columns file
In-Reply-To: <AANLkTikpDwean+g5-0tKpRL9PWWYGr2d7aZGdvASPFKE@mail.gmail.com>
References: <AANLkTik4kgb1Y4WvE2wBYXWbbQAw3MqTguxOwtYVdA9d@mail.gmail.com>
	<AANLkTik7nbc-J-Jxr671hHuB7ANJ1kU1nzYgeykW4y0H@mail.gmail.com>
	<AANLkTikpDwean+g5-0tKpRL9PWWYGr2d7aZGdvASPFKE@mail.gmail.com>
Message-ID: <1297685447.4541.113.camel@deskpro15336.internal.sanger.ac.uk>

Hi Jordi,

you will want to use a *hash* to store your IDs if you want to make them
non-redundant. This is not BioPerl related - it's more of a basic Perl
question. My recommendation would be to get the excellent "Beginning
Perl for Bioinformatics" book from O'Reilly and also check out the
general-Perl sites and forums, such as perlmonks.com. You can also just
google for Perl hashes and see if it makes sense to you and try to work
it into the example script you found already. Good luck!!

Frank


On Mon, 2011-02-14 at 12:34 +0100, Jordi Durban wrote:
> Thank you very much John. The output should be the two fields from each
> entry. In the example above, it should be:
> *uaccno=FF56QEU12HD1LC *   *gi|166216293|sp|P0C616.1|PA2HA_BOTAS
> **uaccno=FF56QEU12HMBY2*    *gi|166216293|sp|P0C616.1|PA2HA_BOTAS *
> *uaccno=FF56QEU12HDB9V *  * gi|166215047|sp|P24605.3|PA2H2_BOTAS
> 
> *According to http://perl.about.com/od/filesystem/a/perl_parse_tabs.htm I
> have to do:
> 
> open (FILE, 'data.txt');
>  while (<FILE>) {
>  chomp;
>  ($name, $email, $phone) = split("\t");
>  print "Name: $name\n";
>  print "Email: $email\n";
>  print "Phone: $phone\n";
> 
>  print "---------\n";
>  }
> 
>  close (FILE);
> 
> But this script doesn't deal with the duplicated lines...
> 
> 2011/2/14 John SJ Anderson <genehack at genehack.org>
> 
> > On Mon, Feb 14, 2011 at 05:41, Jordi Durban <jordi.durban at gmail.com>
> > wrote:
> > > Hi all!
> > > I'm trying to parse a three columns file. The first one could be
> > repeated.
> > > However, I would like to obtain the results for the first one.
> > [ snip ]
> >
> > You've given us the input. What should the output look like?
> >
> > j.
> >
> 
> 
> 



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From rondonbio at yahoo.com.br  Mon Feb 14 12:49:01 2011
From: rondonbio at yahoo.com.br (Rondon Neto)
Date: Mon, 14 Feb 2011 09:49:01 -0800 (PST)
Subject: [Bioperl-l] extract overhangs from Clustalw
Message-ID: <285603.48757.qm@web130206.mail.mud.yahoo.com>

How to extract overhangs from Clustalw alignments and return the aln file 
without the overhangs? I'm trying to use Bio::AlignIO, but Im confused.
Thank you very much.

Rondon


      

From rene.malenfant at gmail.com  Thu Feb 10 14:11:39 2011
From: rene.malenfant at gmail.com (=?ISO-8859-1?Q?Ren=E9_Malenfant?=)
Date: Thu, 10 Feb 2011 12:11:39 -0700
Subject: [Bioperl-l] BioPerl Fastq Parser Error?
Message-ID: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>

Hi.  I think there may be an error in BioPerl's FASTQ parser.  It  
fails when the last character of a quality sequence is a zero and it  
is alone on a line by itself.

I've attached the error message below:


Thanks,

Rene Malenfant



Error message:
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Quality string [!!) 
WZ`cii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ 
{uuooWWTWWWW>WWWQWWWWW]QKHHHHHHHHHHHHHHEEEEEEEEEEEEBEEEEBBBBBBBBBBBB]  
of length [120]
doesn't match length of sequence  
nnAGACTTTGTATTTATGTTCCTTTTTGGTGGATTCTTAATGACTATATCGTTACTGTCGAATGCTAGAAGA 
AGGCTCTTTCCGAGGTCGGACAGCAGACTTTGTATTtatgttccttttt
[121], line: 322124
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/rene/perl5/lib/perl5/Bio/Root/ 
Root.pm:368
STACK: Bio::SeqIO::fastq::next_dataset /home/rene/perl5/lib/perl5/Bio/ 
SeqIO/fastq.pm:102
STACK: Bio::SeqIO::fastq::next_seq /home/rene/perl5/lib/perl5/Bio/ 
SeqIO/fastq.pm:29
STACK: ./foo.pl:12
-----------------------------------------------------------


Program I'm trying to use:
====
#! /usr/bin/perl -w
use strict;
use Bio::SeqIO;

my $inputfilename = shift;
my $in  = Bio::SeqIO->new(-file => "$inputfilename",
                           -format => 'Fastq');
my $out = Bio::SeqIO->new(-file => ">outputfilename",
                           -format => 'Fasta');

while ( my $seq = $in->next_seq() ) {
     $out->write_seq($seq);
}

exit;
====


Sequence that appears to be messing things up.  It looks fine to me:
====
@21_NODE_24053-0.94|PREMKED.FA|PREDICTED:
nnAGACTTTGTATTTATGTTCCTTTTTGGTGGATTCTTAATGACTATATCGTTACTGTCG
AATGCTAGAAGAAGGCTCTTTCCGAGGTCGGACAGCAGACTTTGTATTtatgttcctttt
t
+
!!)WZ`cii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{uuooWWT
W0WW>WWWQWWWWW]QKHHHHHHHHHHHHHHEEEEEEEEEEEEBEEEEBBBBBBBBBBBB
0
====


From clements at nescent.org  Mon Feb 14 14:43:22 2011
From: clements at nescent.org (Dave Clements)
Date: Mon, 14 Feb 2011 11:43:22 -0800
Subject: [Bioperl-l] March 2011 GMOD Meeting early registration closes this
	Friday
In-Reply-To: <AANLkTimJ91ty-YkuqscdpQ0JxoNzi-LBD2XtTGxkPzOV@mail.gmail.com>
References: <AANLkTimZeiBa+O+tTLiWBURtY6OuSjmHD1Y=orMmUyn+@mail.gmail.com>
	<AANLkTi=eCA6SrSv7WdwAHche1yBEK85_pUaXgfhOXmzy@mail.gmail.com>
	<AANLkTimuGpa+8aP7EUMzH3AsQbX5sk7bsaYsVuczHYT7@mail.gmail.com>
	<AANLkTinfOzjhHUVxdT6y5yhbStopdwEcmSHOXh1xjjds@mail.gmail.com>
	<AANLkTinMzc29_hRULr5v65kyzkJ4ABtxYR9OUb9dzFLG@mail.gmail.com>
	<AANLkTikeXiYL+XjSZte6nj4tSXU0u90QrbLfmWNVet4h@mail.gmail.com>
	<AANLkTinzOqHyYwBtMVUU24A=DdDC3ZF0bfUGdqUX0vz+@mail.gmail.com>
	<AANLkTik1=CLaPVd2z0FAJTgj=Mr_GUC8knCy2GEvN9n4@mail.gmail.com>
	<AANLkTi=7w6_bbgq76QWLxnsys36ZyFMLhE149vL5e-X2@mail.gmail.com>
	<AANLkTimJ91ty-YkuqscdpQ0JxoNzi-LBD2XtTGxkPzOV@mail.gmail.com>
Message-ID: <AANLkTimuT9uwU=6y9T92Beh9ChXGgZJWeFzeUQAGftTT@mail.gmail.com>

Hello all,

*Register for the March 2011 GMOD Meeting (
http://gmod.org/wiki/March_2011_GMOD_Meeting) by this Friday, Feb 18, and
save  over 15%.*

The March meeting is part of GMOD Americas 2011 (
http://gmod.org/wiki/GMOD_Americas_2011), an event that includes Satellite
Meetings, a GMOD Course (already full), and for the first time, an
"Introduction to GMOD" session the night before the meeting for GMOD
newcomers. GMOD Americas 2011 events are being held at the US National
Evolutionary Synthesis Center (NESCent) in Durham, North Carolina, United
States.

Also, if you have a topic you want to discuss at the meeting, please send it
to Scott Cain <scott at scottcain.net> ASAP so he can get you on the program.

*About GMOD:*
GMOD is the Generic Model Organism Database project, a collection of
interoperable open-source software components for annotating, visualizing,
managing and analyzing biological data. GMOD is also an active community of
software developers and biologists addressing common challenges with their
data.

The GMOD suite includes widely used tools such as GBrowse and JBrowse (and
WebGBrowse) for genome browsing, Apollo and MAKER for genome annotation,
GBrowse_syn and CMap for comparative genomics visualization, Chado, BioMart
and InterMine for data integration, management, and querying, and Galaxy and
Ergatis (and ISGA) for data analysis.

*Meeting Overview:
*As with previous GMOD meetings, this meeting will have a mixture of project
talks, component talks, and user talks. Our guest speaker is Dr. Eric Stone of
North Carolina State University. Dr. Stone will talk about his experience on
the "Drosophila Genome Reference Panel," a project that is sequencing and
annotating almost 200 inbred lines.

The agenda is driven by attendee suggestions, and you are encouraged to add
your suggestions now. For an idea of what happens at a GMOD meeting, see the
writeup of the September 2010 GMOD Meeting. GMOD meetings are an excellent
way to meet GMOD developers and users and to learn (and affect) what's
coming in the project.

*Registration:
*Registration for the March 2011 GMOD Meeting is
 $80 on or before February 18
 $95 after February 18

Please register early, both to save money, and ensure a spot. You are also
strongly encouraged to submit a talk and/or sign up for (or propose) a
Satellite Meeting. Details on transportation, suggested lodging, and other
logistics are on the GMOD Americas 2011 page.

This meeting, and all GMOD Americas 2011 events, are jointly sponsored by
NESCent and the Galaxy Project.

Hope to see you in North Carolina!

Dave Clements
Galaxy Project
-- 
http://gmod.org/wiki/GMOD_Americas_2011
http://gmod.org/wiki/GMOD_News
http://usegalaxy.org/
http://getgalaxy.org/

From p.j.a.cock at googlemail.com  Mon Feb 14 15:14:23 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 14 Feb 2011 20:14:23 +0000
Subject: [Bioperl-l] BioPerl Fastq Parser Error?
In-Reply-To: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>
References: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>
Message-ID: <AANLkTim=0QorAx3d9Hgz_1QWRFoxW8e+-9cK9XVbDPLG@mail.gmail.com>

On Thu, Feb 10, 2011 at 7:11 PM, Ren? Malenfant
<rene.malenfant at gmail.com> wrote:
> Hi. ?I think there may be an error in BioPerl's FASTQ parser. ?It fails when
> the last character of a quality sequence is a zero and it is alone on a line
> by itself.

Interesting example - and it does look valid to me too. It would
probably make a good test case, since automatic conversion of
a string to a boolean may treat "0" (zero) as false.

I'm curious where the file came from, since not many tools output
line wrapped FASTQ (it makes parsing and indexing so much easier).

Peter


From cjfields at illinois.edu  Mon Feb 14 15:14:44 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 14 Feb 2011 14:14:44 -0600
Subject: [Bioperl-l] BioPerl Fastq Parser Error?
In-Reply-To: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>
References: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>
Message-ID: <75D5224A-C239-4353-9610-422D547B4333@illinois.edu>

Rene,

This is a bug, now fixed in bioperl-live master on github.  The parsed lines were not being checked for definedness (instead for true/false), so the very last line evaluated as false and prematurely ended the parse, should work fine now.

chris

On Feb 10, 2011, at 1:11 PM, Ren? Malenfant wrote:

> Hi.  I think there may be an error in BioPerl's FASTQ parser.  It fails when the last character of a quality sequence is a zero and it is alone on a line by itself.
> 
> I've attached the error message below:
> 
> 
> Thanks,
> 
> Rene Malenfant
> 
> 
> 
> Error message:
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Quality string [!!)WZ`cii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{uuooWWTWWWW>WWWQWWWWW]QKHHHHHHHHHHHHHHEEEEEEEEEEEEBEEEEBBBBBBBBBBBB] of length [120]
> doesn't match length of sequence nnAGACTTTGTATTTATGTTCCTTTTTGGTGGATTCTTAATGACTATATCGTTACTGTCGAATGCTAGAAGAAGGCTCTTTCCGAGGTCGGACAGCAGACTTTGTATTtatgttccttttt
> [121], line: 322124
> STACK: Error::throw
> STACK: Bio::Root::Root::throw /home/rene/perl5/lib/perl5/Bio/Root/Root.pm:368
> STACK: Bio::SeqIO::fastq::next_dataset /home/rene/perl5/lib/perl5/Bio/SeqIO/fastq.pm:102
> STACK: Bio::SeqIO::fastq::next_seq /home/rene/perl5/lib/perl5/Bio/SeqIO/fastq.pm:29
> STACK: ./foo.pl:12
> -----------------------------------------------------------
> 
> 
> Program I'm trying to use:
> ====
> #! /usr/bin/perl -w
> use strict;
> use Bio::SeqIO;
> 
> my $inputfilename = shift;
> my $in  = Bio::SeqIO->new(-file => "$inputfilename",
>                          -format => 'Fastq');
> my $out = Bio::SeqIO->new(-file => ">outputfilename",
>                          -format => 'Fasta');
> 
> while ( my $seq = $in->next_seq() ) {
>    $out->write_seq($seq);
> }
> 
> exit;
> ====
> 
> 
> Sequence that appears to be messing things up.  It looks fine to me:
> ====
> @21_NODE_24053-0.94|PREMKED.FA|PREDICTED:
> nnAGACTTTGTATTTATGTTCCTTTTTGGTGGATTCTTAATGACTATATCGTTACTGTCG
> AATGCTAGAAGAAGGCTCTTTCCGAGGTCGGACAGCAGACTTTGTATTtatgttcctttt
> t
> +
> !!)WZ`cii~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{uuooWWT
> W0WW>WWWQWWWWW]QKHHHHHHHHHHHHHHEEEEEEEEEEEEBEEEEBBBBBBBBBBBB
> 0
> ====
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From cjfields at illinois.edu  Mon Feb 14 15:21:16 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 14 Feb 2011 14:21:16 -0600
Subject: [Bioperl-l] BioPerl Fastq Parser Error?
In-Reply-To: <AANLkTim=0QorAx3d9Hgz_1QWRFoxW8e+-9cK9XVbDPLG@mail.gmail.com>
References: <565AB0AA-CAB9-4D26-B663-D40618778A5C@gmail.com>
	<AANLkTim=0QorAx3d9Hgz_1QWRFoxW8e+-9cK9XVbDPLG@mail.gmail.com>
Message-ID: <88BEE816-B64E-410E-90FA-2A698B436870@illinois.edu>


On Feb 14, 2011, at 2:14 PM, Peter Cock wrote:

> On Thu, Feb 10, 2011 at 7:11 PM, Ren? Malenfant
> <rene.malenfant at gmail.com> wrote:
>> Hi.  I think there may be an error in BioPerl's FASTQ parser.  It fails when
>> the last character of a quality sequence is a zero and it is alone on a line
>> by itself.
> 
> Interesting example - and it does look valid to me too. It would
> probably make a good test case, since automatic conversion of
> a string to a boolean may treat "0" (zero) as false.

Right, that was the problem: here's the snippet from fastq.pm prior to my fixing it:

while ($line) { # changed to 'while (defined $line) {...}'
  ....
}

> I'm curious where the file came from, since not many tools output
> line wrapped FASTQ (it makes parsing and indexing so much easier).
> 
> Peter

Agreed, would be good to know.  I haven't come across any tools that wrap FASTQ myself.

chris

From jordi.durban at gmail.com  Mon Feb 14 15:52:23 2011
From: jordi.durban at gmail.com (Jordi Durban)
Date: Mon, 14 Feb 2011 21:52:23 +0100
Subject: [Bioperl-l] extract overhangs from Clustalw
In-Reply-To: <285603.48757.qm@web130206.mail.mud.yahoo.com>
References: <285603.48757.qm@web130206.mail.mud.yahoo.com>
Message-ID: <AANLkTik8h5u4mrJ8eybfPihqHTJsCRRTDMk3_tRoN2oo@mail.gmail.com>

What do you mean by "overhangs"?
Have ypu heard about Extending Bio::Tools::Run::Clustalw?
hope this helps.
2011/2/14 Rondon Neto <rondonbio at yahoo.com.br>

> How to extract overhangs from Clustalw alignments and return the aln file
> without the overhangs? I'm trying to use Bio::AlignIO, but Im confused.
> Thank you very much.
>
> Rondon
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Jordi

From comp_sea at yahoo.com  Mon Feb 14 16:51:46 2011
From: comp_sea at yahoo.com (Syed Mustafa Hussain)
Date: Mon, 14 Feb 2011 13:51:46 -0800 (PST)
Subject: [Bioperl-l] Bio::Graphics
Message-ID: <707016.34332.qm@web33602.mail.mud.yahoo.com>

Hi,

We had recently updated BioPerl and Bio::Graphics and found some applications not working properly. As an example simple graphics script like:

#####################################################

use Bio::Graphics::Panel;
use Bio::SeqFeature::Generic;

use CGI;      # or any other CGI:: form handler/decoder

print "Content-type: text/html\n\n";

my $panel = Bio::Graphics::Panel->new(-length => 700,
                                      -width  => 700
                                      );

my $track = $panel->add_track(-glyph       => 'generic',
                              -label       => 1
                              );

my $feature = Bio::SeqFeature::Generic->new(-start        => 1,
                                            -end          => 400
                                            );
$track->add_feature($feature);

print "<html><body>TEST IMAGE:<br>";

open GRAPH, "> /srv/www/htdocs/tmp/test.png" or die "could not open image file";
print GRAPH $panel->png;
close(GRAPH);

print "<img src=\"/tmp/test.png\">";
print "</body></html>";

#####################################################

is giving following error when I debug:

  DB<1> n
Can't locate object method "attributes" via package "Bio::SeqFeature::Generic" at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 703.
 at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 703
        Bio::Graphics::Glyph::bgcolor('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)') called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 1299
        Bio::Graphics::Glyph::filled_box('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 400, 7) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 1471
        Bio::Graphics::Glyph::draw_component('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/generic.pm line 347
        Bio::Graphics::Glyph::generic::draw_component('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 1050
        Bio::Graphics::Glyph::draw('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/generic.pm line 338
        Bio::Graphics::Glyph::generic::draw('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/track.pm line 35
        Bio::Graphics::Glyph::track::draw('Bio::Graphics::Glyph::track=HASH(0x1d5bb10)', 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Panel.pm line 588
        Bio::Graphics::Panel::gd('Bio::Graphics::Panel=HASH(0x1b1f6b0)') called at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Panel.pm line 1067
        Bio::Graphics::Panel::png('Bio::Graphics::Panel=HASH(0x1b1f6b0)') called at test.cgi line 37
Debugged program terminated.  Use q to quit or R to restart,
  use o inhibit_exit to avoid stopping after program termination,
  h q, h R or h o to get additional info.

#####################################################

Is it because of some incompatibility between version of bioperl and bio::Graphics or some thing else?

Thanks,
Mustafa.


 
____________________________________________________________________________________
Finding fabulous fares is fun.  
Let Yahoo! FareChase search your favorite travel sites to find flight and hotel bargains.
http://farechase.yahoo.com/promo-generic-14795097

From roy.chaudhuri at gmail.com  Tue Feb 15 07:19:00 2011
From: roy.chaudhuri at gmail.com (Roy Chaudhuri)
Date: Tue, 15 Feb 2011 12:19:00 +0000
Subject: [Bioperl-l] extract overhangs from Clustalw
In-Reply-To: <AANLkTik8h5u4mrJ8eybfPihqHTJsCRRTDMk3_tRoN2oo@mail.gmail.com>
References: <285603.48757.qm@web130206.mail.mud.yahoo.com>
	<AANLkTik8h5u4mrJ8eybfPihqHTJsCRRTDMk3_tRoN2oo@mail.gmail.com>
Message-ID: <4D5A6F34.9070109@gmail.com>

Hi Rondon,

I'm assuming you mean "how do I remove columns with gaps at either end 
of the alignment?" (since your alignment should be flush if it has come 
from ClustalW). In future, when you ask questions on the list please try 
and give as much information as possible, that way we do not have to 
guess at what you mean.

If those are the only gaps in the alignment, then this will work:

my $gapfree=$aln->remove_gaps;

However, if there are gaps in the central region that you want to keep, 
then try something like this:

$aln->gap_line=~/^(-*).*[^-](-*)$/;
my $endgapfree=$aln->remove_columns([0,length($1)-1], 
[$aln->length-length($2), $aln->length-1]);

This will not work correctly if there aren't gaps at both ends of the 
alignment, so you may have to add in a few checks if you can't make that 
assumption.

Cheers,
Roy.

On 14/02/2011 20:52, Jordi Durban wrote:
> What do you mean by "overhangs"?
> Have ypu heard about Extending Bio::Tools::Run::Clustalw?
> hope this helps.
> 2011/2/14 Rondon Neto<rondonbio at yahoo.com.br>
>
>> How to extract overhangs from Clustalw alignments and return the aln file
>> without the overhangs? I'm trying to use Bio::AlignIO, but Im confused.
>> Thank you very much.
>>
>> Rondon
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>


From jovel_juan at hotmail.com  Tue Feb 15 13:36:11 2011
From: jovel_juan at hotmail.com (Juan Jovel)
Date: Tue, 15 Feb 2011 18:36:11 +0000
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files
In-Reply-To: <4D3F44A8.8020001@bioperl.org>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>,<4D3F44A8.8020001@bioperl.org>
Message-ID: <COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>


Good Morning guys,
sorry for the naive question: What's the simplest way to fish redundant sequences (complete or partial) between two (or more) fasta files.
I was thinking just to do it with SeqIO, opening two files, and compare each sequence of file_1 to each record of file_2, like:
# Read each record of file 1 and compare to each read of file 2while(my $dna1 = $seqin1->next_seq){        my $seq1 = $dna1->seq;        my $id1 = $dna1->id;
        # Iterate inside de second fasta file        while(my $dna2 = $seqin2->next_seq){                my $seq2 = $dna2->seq;                my $id2 = $dna2->id;
                if(($seq1 =~ /$seq2/)||($seq2 =~ /$seq1/)){                        print "Match found \n";                        print OUT "Records $id1 and $id2 are redundants";
...
I am afraid it is going to be slow for large files.  AND, more importantly, how do I reset the object containing the second file to the first line, as done in Perl with (SEEK(IN, 0,0)) for example.  Does SeqIO allows that (sorry, I am not a frequent user of SeqIO).
If there is another more-elaborated module to fish such redundant sequences, I will appreciate to know.
Thanks,
JUAN 		 	   		  

From jovel_juan at hotmail.com  Tue Feb 15 14:34:58 2011
From: jovel_juan at hotmail.com (Juan Jovel)
Date: Tue, 15 Feb 2011 19:34:58 +0000
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>, <4D3F44A8.8020001@bioperl.org>,
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
Message-ID: <COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>


Good Morning guys,
> sorry for the naive question: What's the simplest way to fish redundant sequences (complete or partial) between two (or more) fasta files.
> I was thinking just to do it with SeqIO, opening two files, and compare each sequence of file_1 to each record of file_2, like:
# Read each record of file 1 and compare to each read of
file 2

while(my $dna1 = $seqin1->next_seq){

        my $seq1 =
$dna1->seq;

        my $id1 =
$dna1->id;

 

        # Iterate
inside de second fasta file

        while(my $dna2
= $seqin2->next_seq){

                my $seq2 = $dna2->seq;

                my
$id2 = $dna2->id;

 

               
if(($seq1 =~ /$seq2/)||($seq2 =~ /$seq1/)){

                       
print "Match found \n";

                       
print OUT "Records $id1 and $id2 are redundants";

I am afraid it is going to be slow for large files.  AND, more importantly, how do I reset the object containing the second file to the first line, as done in Perl with (SEEK(IN, 0,0)) for example.  Does SeqIO allows that (sorry, I am not a frequent user of SeqIO). If there is another more-elaborated module to fish such redundant sequences, I will appreciate to know.

Thanks,
JUAN 
 		 	   		  

From cjfields at illinois.edu  Tue Feb 15 15:02:38 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 15 Feb 2011 14:02:38 -0600
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>,
	<4D3F44A8.8020001@bioperl.org>,
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
Message-ID: <F0C2C6EB-1658-4823-AFC8-16399A67A2B2@illinois.edu>

Juan,

If you are checking for simple complete matches, I would suggest using a hash.  However, you are also looking for partial matches as well.  In this case it seems like you should be (ab)using something akin to mcl to cluster like sequences together; you're essentially performing an all-v-all comparison anyway, at least take advantage of faster tools.  

So, basically:

1) Run an all-v-all comparison, filtering on 100% identity, no gaps
2) cluster using mcl

Note the BLAST-related programs here for that purpose:

http://www.micans.org/mcl/man/mclfamily.html

I think you can also use other tools instead of BLAST, just can't recall the mcl pipeline at the moment to use.

chris

On Feb 15, 2011, at 1:34 PM, Juan Jovel wrote:

> Good Morning guys,
>> sorry for the naive question: What's the simplest way to fish redundant sequences (complete or partial) between two (or more) fasta files.
>> I was thinking just to do it with SeqIO, opening two files, and compare each sequence of file_1 to each record of file_2, like:
> # Read each record of file 1 and compare to each read of
> file 2
> 
> while(my $dna1 = $seqin1->next_seq){
> 
>        my $seq1 =
> $dna1->seq;
> 
>        my $id1 =
> $dna1->id;
> 
> 
> 
>        # Iterate
> inside de second fasta file
> 
>        while(my $dna2
> = $seqin2->next_seq){
> 
>                my $seq2 = $dna2->seq;
> 
>                my
> $id2 = $dna2->id;
> 
> 
> 
> 
> if(($seq1 =~ /$seq2/)||($seq2 =~ /$seq1/)){
> 
> 
> print "Match found \n";
> 
> 
> print OUT "Records $id1 and $id2 are redundants";
> 
> I am afraid it is going to be slow for large files.  AND, more importantly, how do I reset the object containing the second file to the first line, as done in Perl with (SEEK(IN, 0,0)) for example.  Does SeqIO allows that (sorry, I am not a frequent user of SeqIO). If there is another more-elaborated module to fish such redundant sequences, I will appreciate to know.
> 
> Thanks,
> JUAN 






From David.Messina at sbc.su.se  Tue Feb 15 15:09:35 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Tue, 15 Feb 2011 21:09:35 +0100
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
Message-ID: <AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>

Hi Juan,

There's a nice example script in the BioPerl distribution that Jason Stajich
wrote which uses MD5 checksums to do the sequence comparison:


https://github.com/bioperl/bioperl-live/blob/master/scripts/utilities/bp_nrdb.PLS


There are also faster, nonBioPerl tools for this, such as the one that comes
with UCLUST:

    http://www.drive5.com/usearch/


Dave

From cjfields at illinois.edu  Tue Feb 15 15:25:07 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 15 Feb 2011 14:25:07 -0600
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
Message-ID: <C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>

SHA should work as well, didn't think of that (though I suppose the encoding step for either would be rate-limiting?).  

Will have to keep an eye on UCLUST, didn't know about that one.

chris

On Feb 15, 2011, at 2:09 PM, Dave Messina wrote:

> Hi Juan,
> 
> There's a nice example script in the BioPerl distribution that Jason Stajich
> wrote which uses MD5 checksums to do the sequence comparison:
> 
> 
> https://github.com/bioperl/bioperl-live/blob/master/scripts/utilities/bp_nrdb.PLS
> 
> 
> There are also faster, nonBioPerl tools for this, such as the one that comes
> with UCLUST:
> 
>    http://www.drive5.com/usearch/
> 
> 
> Dave
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From MEC at stowers.org  Tue Feb 15 15:28:09 2011
From: MEC at stowers.org (Cook, Malcolm)
Date: Tue, 15 Feb 2011 14:28:09 -0600
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files
	[Right	formatting]
In-Reply-To: <C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
Message-ID: <BD62CBAC4395B94096109020651BE2EC13A1F9327C@EXCHMB-02.stowers-institute.org>

there there is CD-HIT

and blastclust from ncbi (which I think still gets installed as part of installed NCBI blast suite)


Malcolm Cook
Stowers Institute for Medical Research -  Bioinformatics
Kansas City, Missouri  USA
 
 

> -----Original Message-----
> From: bioperl-l-bounces at lists.open-bio.org 
> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of 
> Chris Fields
> Sent: Tuesday, February 15, 2011 2:25 PM
> To: Dave Messina
> Cc: Juan Jovel; bioperl
> Subject: Re: [Bioperl-l] Fishing redundant sequences in FASTA 
> files [Right formatting]
> 
> SHA should work as well, didn't think of that (though I 
> suppose the encoding step for either would be rate-limiting?).  
> 
> Will have to keep an eye on UCLUST, didn't know about that one.
> 
> chris
> 
> On Feb 15, 2011, at 2:09 PM, Dave Messina wrote:
> 
> > Hi Juan,
> > 
> > There's a nice example script in the BioPerl distribution 
> that Jason 
> > Stajich wrote which uses MD5 checksums to do the sequence 
> comparison:
> > 
> > 
> > 
> https://github.com/bioperl/bioperl-live/blob/master/scripts/utilities/
> > bp_nrdb.PLS
> > 
> > 
> > There are also faster, nonBioPerl tools for this, such as 
> the one that 
> > comes with UCLUST:
> > 
> >    http://www.drive5.com/usearch/
> > 
> > 
> > Dave
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 

From David.Messina at sbc.su.se  Tue Feb 15 15:47:20 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Tue, 15 Feb 2011 21:47:20 +0100
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
Message-ID: <AANLkTi=atoU7T=Hx6R8XLSHRN95C7uLsMvfXdST-UjCw@mail.gmail.com>

SHA should work as well, didn't think of that (though I suppose the encoding
> step for either would be rate-limiting?).
>

I haven't tested it, but I suspect that encoding either MD5 or SHA would be
relatively quick compared to the sequence I/O, no?



Will have to keep an eye on UCLUST, didn't know about that one.


As it happens, my current pipeline uses MCL but I'm testing UCLUST as a
replacement since it's waaay faster. I'll let you know how the comparison
turns out.

And for that matter, if anyone listening has experience with UCLUST or
CD-HIT or other clustering methods (ideally in the context of metagenomic
next-gen sequence), please chime in with your thoughts.


Dave

From cjfields at illinois.edu  Tue Feb 15 16:01:49 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Tue, 15 Feb 2011 15:01:49 -0600
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <AANLkTi=atoU7T=Hx6R8XLSHRN95C7uLsMvfXdST-UjCw@mail.gmail.com>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
	<AANLkTi=atoU7T=Hx6R8XLSHRN95C7uLsMvfXdST-UjCw@mail.gmail.com>
Message-ID: <1A27685E-82ED-497E-97DB-DA877BFE91B3@illinois.edu>

On Feb 15, 2011, at 2:47 PM, Dave Messina wrote:

> SHA should work as well, didn't think of that (though I suppose the encoding
>> step for either would be rate-limiting?).
>> 
> 
> I haven't tested it, but I suspect that encoding either MD5 or SHA would be
> relatively quick compared to the sequence I/O, no?

Possibly.  But one nice thing is clustering allows for partial matches (which I think is the original criterion).  I don't believe SHA/MD5 would work for that purpose.

> Will have to keep an eye on UCLUST, didn't know about that one.
> 
> 
> As it happens, my current pipeline uses MCL but I'm testing UCLUST as a
> replacement since it's waaay faster. I'll let you know how the comparison
> turns out.
> 
> And for that matter, if anyone listening has experience with UCLUST or
> CD-HIT or other clustering methods (ideally in the context of metagenomic
> next-gen sequence), please chime in with your thoughts.

As malcolm pointed out, blastclust is also available with legacy BLAST, though I'm not sure it's available with BLAST+ (didn't see anything obvious with BLAST+ for that purpose).

chris



From David.Messina at sbc.su.se  Tue Feb 15 16:22:58 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Tue, 15 Feb 2011 22:22:58 +0100
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <1A27685E-82ED-497E-97DB-DA877BFE91B3@illinois.edu>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
	<AANLkTi=atoU7T=Hx6R8XLSHRN95C7uLsMvfXdST-UjCw@mail.gmail.com>
	<1A27685E-82ED-497E-97DB-DA877BFE91B3@illinois.edu>
Message-ID: <AANLkTin5rj6_MtCzvhct86n2tO_tp1khbzYDVmAnWZ-e@mail.gmail.com>

>
> But one nice thing is clustering allows for partial matches (which I think
> is the original criterion).  I don't believe SHA/MD5 would work for that
> purpose.


Yep, for sure. Checksums will find full-length exact matches only.


Dave

From jason at bioperl.org  Tue Feb 15 17:21:34 2011
From: jason at bioperl.org (Jason Stajich)
Date: Tue, 15 Feb 2011 14:21:34 -0800
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
 formatting]
In-Reply-To: <AANLkTin5rj6_MtCzvhct86n2tO_tp1khbzYDVmAnWZ-e@mail.gmail.com>
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>	<4D3F44A8.8020001@bioperl.org>	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>	<AANLkTi=atoU7T=Hx6R8XLSHRN95C7uLsMvfXdST-UjCw@mail.gmail.com>	<1A27685E-82ED-497E-97DB-DA877BFE91B3@illinois.edu>
	<AANLkTin5rj6_MtCzvhct86n2tO_tp1khbzYDVmAnWZ-e@mail.gmail.com>
Message-ID: <4D5AFC6E.9020209@bioperl.org>

also see cd-hit which allows you to tune the %id matching.


Dave Messina wrote:
>> But one nice thing is clustering allows for partial matches (which I think
>> is the original criterion).  I don't believe SHA/MD5 would work for that
>> purpose.
>
>
> Yep, for sure. Checksums will find full-length exact matches only.
>
>
> Dave
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

-- 
Jason Stajich
jason at bioperl.org
http://bioperl.org/wiki


From roy.chaudhuri at gmail.com  Wed Feb 16 05:49:39 2011
From: roy.chaudhuri at gmail.com (Roy Chaudhuri)
Date: Wed, 16 Feb 2011 10:49:39 +0000
Subject: [Bioperl-l] Res:  extract overhangs from Clustalw
In-Reply-To: <93231.32484.qm@web130201.mail.mud.yahoo.com>
References: <285603.48757.qm@web130206.mail.mud.yahoo.com>
	<AANLkTik8h5u4mrJ8eybfPihqHTJsCRRTDMk3_tRoN2oo@mail.gmail.com>
	<4D5A6F34.9070109@gmail.com>
	<93231.32484.qm@web130201.mail.mud.yahoo.com>
Message-ID: <4D5BABC3.9000601@gmail.com>

Hi Rondon,

Please remember to cc the mailing list when you reply, that way others 
can chip in with an answer.

The $endgapfree variable contains a Bio::SimpleAlign object, not a 
Bio::AlignIO. So you can get rid of the while loop and just say:

$out->write_aln($endgapfree);

Cheers,
Roy.

On 15/02/2011 18:05, Rondon Neto wrote:
> Thank you! Sorry my poor question.
>
> I have gaps in the central region and want to keep them. I use your
> suggestion and that works. I tried to print the alignment without
> success, so I'm thinking to save it in a new file, like we do in SeqIO,
> but its not working. Is that the way? see my code:
>
> -----------------------------------------------
> #/usr/bin/perl
> use warnings;
> use strict;
> use Bio::AlignIO;
>
> my $str = Bio::AlignIO->new('-file' => $ARGV[0]);
> my $aln = $str->next_aln();
> $aln->gap_line=~/^(-*).*[^-](-*)$/;
> my $endgapfree=$aln->remove_columns([0,length($1)-1],
> [$aln->length-length($2), $aln->length-1]);
>
> my $out = Bio::AlignIO->new(-file => ">test.out",
> -format => 'clustalw');
>
> while ( my $aln = $endgapfree->next_aln() ) {
> $out->write_aln($aln);
> }
>
> exit;
> ------------------------------------------------
>
> Thank you again,
>
> Rondon Neto
>
>
>
> ------------------------------------------------------------------------
> *De:* Roy Chaudhuri <roy.chaudhuri at gmail.com>
> *Para:* Rondon Neto <rondonbio at yahoo.com.br>
> *Cc:* Jordi Durban <jordi.durban at gmail.com>; bioperl-l at lists.open-bio.org
> *Enviadas:* Ter?a-feira, 15 de Fevereiro de 2011 10:19:00
> *Assunto:* Re: [Bioperl-l] extract overhangs from Clustalw
>
> Hi Rondon,
>
> I'm assuming you mean "how do I remove columns with gaps at either end
> of the alignment?" (since your alignment should be flush if it has come
> from ClustalW). In future, when you ask questions on the list please try
> and give as much information as possible, that way we do not have to
> guess at what you mean.
>
> If those are the only gaps in the alignment, then this will work:
>
> my $gapfree=$aln->remove_gaps;
>
> However, if there are gaps in the central region that you want to keep,
> then try something like this:
>
> $aln->gap_line=~/^(-*).*[^-](-*)$/;
> my $endgapfree=$aln->remove_columns([0,length($1)-1],
> [$aln->length-length($2), $aln->length-1]);
>
> This will not work correctly if there aren't gaps at both ends of the
> alignment, so you may have to add in a few checks if you can't make that
> assumption.
>
> Cheers,
> Roy.
>
> On 14/02/2011 20:52, Jordi Durban wrote:
>  > What do you mean by "overhangs"?
>  > Have ypu heard about Extending Bio::Tools::Run::Clustalw?
>  > hope this helps.
>  > 2011/2/14 Rondon Neto<rondonbio at yahoo.com.br
> <mailto:rondonbio at yahoo.com.br>>
>  >
>  >> How to extract overhangs from Clustalw alignments and return the aln
> file
>  >> without the overhangs? I'm trying to use Bio::AlignIO, but Im confused.
>  >> Thank you very much.
>  >>
>  >> Rondon
>  >>
>  >>
>  >>
>  >> _______________________________________________
>  >> Bioperl-l mailing list
>  >> Bioperl-l at lists.open-bio.org <mailto:Bioperl-l at lists.open-bio.org>
>  >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>  >>
>  >
>  >
>  >
>
>


From ghai.rohit at gmail.com  Wed Feb 16 06:03:44 2011
From: ghai.rohit at gmail.com (Rohit Ghai)
Date: Wed, 16 Feb 2011 12:03:44 +0100
Subject: [Bioperl-l] Res: extract overhangs from Clustalw
In-Reply-To: <4D5BABC3.9000601@gmail.com>
References: <285603.48757.qm@web130206.mail.mud.yahoo.com>
	<AANLkTik8h5u4mrJ8eybfPihqHTJsCRRTDMk3_tRoN2oo@mail.gmail.com>
	<4D5A6F34.9070109@gmail.com>
	<93231.32484.qm@web130201.mail.mud.yahoo.com>
	<4D5BABC3.9000601@gmail.com>
Message-ID: <AANLkTikXxC+gYNtRuQZBcD+2y88Jiu_cAdpKDuoE+OhN@mail.gmail.com>

Hi

You could also consider using trimAL for cutting out selected columns from
an alignment.

http://trimal.cgenomics.org/

cheers
Rohit


On Wed, Feb 16, 2011 at 11:49 AM, Roy Chaudhuri <roy.chaudhuri at gmail.com>wrote:

> Hi Rondon,
>
> Please remember to cc the mailing list when you reply, that way others can
> chip in with an answer.
>
> The $endgapfree variable contains a Bio::SimpleAlign object, not a
> Bio::AlignIO. So you can get rid of the while loop and just say:
>
> $out->write_aln($endgapfree);
>
> Cheers,
> Roy.
>
> On 15/02/2011 18:05, Rondon Neto wrote:
>
>> Thank you! Sorry my poor question.
>>
>> I have gaps in the central region and want to keep them. I use your
>> suggestion and that works. I tried to print the alignment without
>> success, so I'm thinking to save it in a new file, like we do in SeqIO,
>> but its not working. Is that the way? see my code:
>>
>> -----------------------------------------------
>> #/usr/bin/perl
>> use warnings;
>> use strict;
>> use Bio::AlignIO;
>>
>> my $str = Bio::AlignIO->new('-file' => $ARGV[0]);
>> my $aln = $str->next_aln();
>> $aln->gap_line=~/^(-*).*[^-](-*)$/;
>> my $endgapfree=$aln->remove_columns([0,length($1)-1],
>> [$aln->length-length($2), $aln->length-1]);
>>
>> my $out = Bio::AlignIO->new(-file => ">test.out",
>> -format => 'clustalw');
>>
>> while ( my $aln = $endgapfree->next_aln() ) {
>> $out->write_aln($aln);
>> }
>>
>> exit;
>> ------------------------------------------------
>>
>> Thank you again,
>>
>> Rondon Neto
>>
>>
>>
>> ------------------------------------------------------------------------
>> *De:* Roy Chaudhuri <roy.chaudhuri at gmail.com>
>> *Para:* Rondon Neto <rondonbio at yahoo.com.br>
>> *Cc:* Jordi Durban <jordi.durban at gmail.com>; bioperl-l at lists.open-bio.org
>> *Enviadas:* Ter?a-feira, 15 de Fevereiro de 2011 10:19:00
>> *Assunto:* Re: [Bioperl-l] extract overhangs from Clustalw
>>
>> Hi Rondon,
>>
>> I'm assuming you mean "how do I remove columns with gaps at either end
>> of the alignment?" (since your alignment should be flush if it has come
>> from ClustalW). In future, when you ask questions on the list please try
>> and give as much information as possible, that way we do not have to
>> guess at what you mean.
>>
>> If those are the only gaps in the alignment, then this will work:
>>
>> my $gapfree=$aln->remove_gaps;
>>
>> However, if there are gaps in the central region that you want to keep,
>> then try something like this:
>>
>> $aln->gap_line=~/^(-*).*[^-](-*)$/;
>> my $endgapfree=$aln->remove_columns([0,length($1)-1],
>> [$aln->length-length($2), $aln->length-1]);
>>
>> This will not work correctly if there aren't gaps at both ends of the
>> alignment, so you may have to add in a few checks if you can't make that
>> assumption.
>>
>> Cheers,
>> Roy.
>>
>> On 14/02/2011 20:52, Jordi Durban wrote:
>>  > What do you mean by "overhangs"?
>>  > Have ypu heard about Extending Bio::Tools::Run::Clustalw?
>>  > hope this helps.
>>  > 2011/2/14 Rondon Neto<rondonbio at yahoo.com.br
>> <mailto:rondonbio at yahoo.com.br>>
>>  >
>>  >> How to extract overhangs from Clustalw alignments and return the aln
>> file
>>  >> without the overhangs? I'm trying to use Bio::AlignIO, but Im
>> confused.
>>  >> Thank you very much.
>>  >>
>>  >> Rondon
>>  >>
>>  >>
>>  >>
>>  >> _______________________________________________
>>  >> Bioperl-l mailing list
>>  >> Bioperl-l at lists.open-bio.org <mailto:Bioperl-l at lists.open-bio.org>
>>  >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>  >>
>>  >
>>  >
>>  >
>>
>>
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From adsj at novozymes.com  Wed Feb 16 08:01:31 2011
From: adsj at novozymes.com (Adam =?utf-8?Q?Sj=C3=B8gren?=)
Date: Wed, 16 Feb 2011 14:01:31 +0100
Subject: [Bioperl-l] Fishing redundant sequences in FASTA files [Right
	formatting]
In-Reply-To: <C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu> (Chris
	Fields's message of "Tue, 15 Feb 2011 14:25:07 -0600")
References: <000801cbbcd6$ddd295e0$9977c1a0$@edu>
	<4D3F44A8.8020001@bioperl.org>
	<COL102-W50028B0C13B51D5B62FD00FAD30@phx.gbl>
	<COL102-W2916C63DB3DB92D99FA62DFAD30@phx.gbl>
	<AANLkTi=oWJo0rZsCwPrELezGFB9T5NfJfxLbMbXOnBOU@mail.gmail.com>
	<C89DEACD-4C4D-4C54-8994-50545AD94D98@illinois.edu>
Message-ID: <87d3msf80k.fsf@topper.koldfront.dk>

On Tue, 15 Feb 2011 14:25:07 -0600, Chris wrote:

> SHA should work as well, didn't think of that (though I suppose the
> encoding step for either would be rate-limiting?).

Disk I/O might be the bottleneck - on a 3+ year old desktop I get ~144
MB/s for sha1 and ~217 MB/s for md5 in a simple test:

  $ dd if=/dev/zero bs=1M count=1024 | sha1sum -
  1024+0 records in
  1024+0 records out
  1073741824 bytes (1.1 GB) copied, 7.44032 s, 144 MB/s
  2a492f15396a6768bcbca016993f4b4c8b0b5307  -
  $ dd if=/dev/zero bs=1M count=1024 | md5sum -
  1024+0 records in
  1024+0 records out
  1073741824 bytes (1.1 GB) copied, 4.94205 s, 217 MB/s
  cd573cfaace07e7949bc0c46028904ff  -

On a reasonably new standard Dell desktop I get ~249 MB/s and ~410 MB/s
respectively.


  Best regards,

    Adam

-- 
                                                          Adam Sj?gren
                                                    adsj at novozymes.com


From lembark at wrkhors.com  Wed Feb 16 10:12:18 2011
From: lembark at wrkhors.com (Steven Lembark)
Date: Wed, 16 Feb 2011 09:12:18 -0600
Subject: [Bioperl-l] YAPC::NA 2011 is going to be at a resort this year...
Message-ID: <20110216091218.36a10773.lembark_wrkhors.com@wrkhors.com>


Comfortable place to meet, and much cheaper than 
any of the Bioinformatics conferences I know about.

It'd be great to get a track on bioinfrmatics
there. The point is getting talks that are useful
to people who use Perl and BioPerl -- not just 
about Perl or Bio::* internals themselves.

Useful topics include things like how-to talks
about getting work done with Perl, BioPerl, Bio::*,
or even integrating Perl with R.

The website, including submissions page, are at:

    <http://www.yapc2011.us/yn2011/main>

-- 
Steven Lembark                                             3646 Flora Pl
Workhorse Computing                                   St Louis, MO 63110
lembark at wrkhors.com                                      +1 888 359 3508

From shalabh.sharma7 at gmail.com  Wed Feb 16 10:38:16 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 16 Feb 2011 10:38:16 -0500
Subject: [Bioperl-l] Trimming low quality reads
Message-ID: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>

Hi,
    Is there any bioperl module available to quality trim in fasta-qual
 format.
i am little worried about the efficiency as i have huge data (~ 50 gb).
Also i would really appreciate if some one has some other suggestions.

Thanks
Shalabh

From jordi.durban at gmail.com  Wed Feb 16 11:36:06 2011
From: jordi.durban at gmail.com (Jordi Durban)
Date: Wed, 16 Feb 2011 17:36:06 +0100
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
Message-ID: <AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>

Well, there's a program called Seqtrim that uses bioperl to trim the
sequences.
Here more information:
http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
Hope this helps.

2011/2/16 shalabh sharma <shalabh.sharma7 at gmail.com>

> Hi,
>    Is there any bioperl module available to quality trim in fasta-qual
>  format.
> i am little worried about the efficiency as i have huge data (~ 50 gb).
> Also i would really appreciate if some one has some other suggestions.
>
> Thanks
> Shalabh
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Jordi

From jason.stajich at gmail.com  Wed Feb 16 11:41:40 2011
From: jason.stajich at gmail.com (Jason Stajich)
Date: Wed, 16 Feb 2011 08:41:40 -0800
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
Message-ID: <4D5BFE44.80604@gmail.com>

I would use a faster implementation like the fastx toolkit - 
http://hannonlab.cshl.edu/fastx_toolkit/

There are lots of answers to NGS questions on seqanswers too
  http://www.google.com/search?q=site:seqanswers.com+trim


Jordi Durban wrote:
> Well, there's a program called Seqtrim that uses bioperl to trim the
> sequences.
> Here more information:
> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
> Hope this helps.
>
> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
>
>> Hi,
>>     Is there any bioperl module available to quality trim in fasta-qual
>>   format.
>> i am little worried about the efficiency as i have huge data (~ 50 gb).
>> Also i would really appreciate if some one has some other suggestions.
>>
>> Thanks
>> Shalabh
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
>
>

-- 
Jason Stajich



From cjfields at illinois.edu  Wed Feb 16 11:59:30 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 16 Feb 2011 10:59:30 -0600
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <4D5BFE44.80604@gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
Message-ID: <796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>

+1 on using fastx.  I believe this is what our local seq pipeline uses prior to us sending out the processed stuff.

chris

On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:

> I would use a faster implementation like the fastx toolkit - http://hannonlab.cshl.edu/fastx_toolkit/
> 
> There are lots of answers to NGS questions on seqanswers too
> http://www.google.com/search?q=site:seqanswers.com+trim
> 
> 
> Jordi Durban wrote:
>> Well, there's a program called Seqtrim that uses bioperl to trim the
>> sequences.
>> Here more information:
>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
>> Hope this helps.
>> 
>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
>> 
>>> Hi,
>>>    Is there any bioperl module available to quality trim in fasta-qual
>>>  format.
>>> i am little worried about the efficiency as i have huge data (~ 50 gb).
>>> Also i would really appreciate if some one has some other suggestions.
>>> 
>>> Thanks
>>> Shalabh
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>> 
>> 
>> 
> 
> -- 
> Jason Stajich
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From jovel_juan at hotmail.com  Wed Feb 16 12:01:21 2011
From: jovel_juan at hotmail.com (Juan Jovel)
Date: Wed, 16 Feb 2011 17:01:21 +0000
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
Message-ID: <COL102-W397B6D99BBC07034B6F57BFAD20@phx.gbl>


Hello Shalabh,
http://hannonlab.cshl.edu/fastx_toolkit/
is pretty good. Do not re-invent the wheel if not necessary. The Hannon's lab has done a lot of work on deep sequencing analyses which led to many fundamental discoveries.....this is a reason to trust their processing algorithms.
Best,
JUAN 		 	   		  

From bbimber at gmail.com  Wed Feb 16 12:10:34 2011
From: bbimber at gmail.com (Ben Bimber)
Date: Wed, 16 Feb 2011 11:10:34 -0600
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
Message-ID: <AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>

Fastx is great and we use those tools in a number of places, but If
I'm not mistaken, doesnt its trimming involve filters their either
including or excluding the read as a whole, rather than end clipping?

The need probably depends on your data.  With short reads, I could
imagine that's what you want.  With 500bp 454 reads, end clipping is
nice.  I ended up making a simple little (and not terribly efficient)
script that does 3' end clipping.  My datasets are orders of magnitude
smaller than what you posted though....

-Ben




On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu> wrote:
> +1 on using fastx. ?I believe this is what our local seq pipeline uses prior to us sending out the processed stuff.
>
> chris
>
> On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
>
>> I would use a faster implementation like the fastx toolkit - http://hannonlab.cshl.edu/fastx_toolkit/
>>
>> There are lots of answers to NGS questions on seqanswers too
>> http://www.google.com/search?q=site:seqanswers.com+trim
>>
>>
>> Jordi Durban wrote:
>>> Well, there's a program called Seqtrim that uses bioperl to trim the
>>> sequences.
>>> Here more information:
>>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
>>> Hope this helps.
>>>
>>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
>>>
>>>> Hi,
>>>> ? ?Is there any bioperl module available to quality trim in fasta-qual
>>>> ?format.
>>>> i am little worried about the efficiency as i have huge data (~ 50 gb).
>>>> Also i would really appreciate if some one has some other suggestions.
>>>>
>>>> Thanks
>>>> Shalabh
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>
>>>
>>>
>>
>> --
>> Jason Stajich
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From shalabh.sharma7 at gmail.com  Wed Feb 16 12:28:03 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 16 Feb 2011 12:28:03 -0500
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
	<AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
Message-ID: <AANLkTim3v3M8A3WM7-huOBfEO9BzQYKrZY5b9-Q1pEtG@mail.gmail.com>

Hi ,
      Thanks all for valuable suggestions, actually i was looking at FASTX
tool kit but at i glance i saw that the quality filter is only implemented
for FASTQ files and not for fasta files.
But i will take a look again.

Thanks
Shalabh


On Wed, Feb 16, 2011 at 12:10 PM, Ben Bimber <bbimber at gmail.com> wrote:

> Fastx is great and we use those tools in a number of places, but If
> I'm not mistaken, doesnt its trimming involve filters their either
> including or excluding the read as a whole, rather than end clipping?
>
> The need probably depends on your data.  With short reads, I could
> imagine that's what you want.  With 500bp 454 reads, end clipping is
> nice.  I ended up making a simple little (and not terribly efficient)
> script that does 3' end clipping.  My datasets are orders of magnitude
> smaller than what you posted though....
>
> -Ben
>
>
>
>
> On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu>
> wrote:
> > +1 on using fastx.  I believe this is what our local seq pipeline uses
> prior to us sending out the processed stuff.
> >
> > chris
> >
> > On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
> >
> >> I would use a faster implementation like the fastx toolkit -
> http://hannonlab.cshl.edu/fastx_toolkit/
> >>
> >> There are lots of answers to NGS questions on seqanswers too
> >> http://www.google.com/search?q=site:seqanswers.com+trim
> >>
> >>
> >> Jordi Durban wrote:
> >>> Well, there's a program called Seqtrim that uses bioperl to trim the
> >>> sequences.
> >>> Here more information:
> >>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
> >>> Hope this helps.
> >>>
> >>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
> >>>
> >>>> Hi,
> >>>>    Is there any bioperl module available to quality trim in fasta-qual
> >>>>  format.
> >>>> i am little worried about the efficiency as i have huge data (~ 50
> gb).
> >>>> Also i would really appreciate if some one has some other suggestions.
> >>>>
> >>>> Thanks
> >>>> Shalabh
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l at lists.open-bio.org
> >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>>
> >>>
> >>>
> >>>
> >>
> >> --
> >> Jason Stajich
> >>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
>

From cjfields at illinois.edu  Wed Feb 16 12:36:01 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 16 Feb 2011 11:36:01 -0600
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTim3v3M8A3WM7-huOBfEO9BzQYKrZY5b9-Q1pEtG@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
	<AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
	<AANLkTim3v3M8A3WM7-huOBfEO9BzQYKrZY5b9-Q1pEtG@mail.gmail.com>
Message-ID: <D4CEEBB5-2175-4AFC-BF62-438BBA124D30@illinois.edu>

Ah, you need qual filtering tied to a specific fasta file.  As most tools like fastx expect FASTQ input, it might be advisable to convert to FASTQ (which Bio::SeqIO::fastq does if I'm not mistaken).

chris

On Feb 16, 2011, at 11:28 AM, shalabh sharma wrote:

> Hi ,
>       Thanks all for valuable suggestions, actually i was looking at FASTX tool kit but at i glance i saw that the quality filter is only implemented for FASTQ files and not for fasta files.
> But i will take a look again.
> 
> Thanks
> Shalabh
> 
> 
> On Wed, Feb 16, 2011 at 12:10 PM, Ben Bimber <bbimber at gmail.com> wrote:
> Fastx is great and we use those tools in a number of places, but If
> I'm not mistaken, doesnt its trimming involve filters their either
> including or excluding the read as a whole, rather than end clipping?
> 
> The need probably depends on your data.  With short reads, I could
> imagine that's what you want.  With 500bp 454 reads, end clipping is
> nice.  I ended up making a simple little (and not terribly efficient)
> script that does 3' end clipping.  My datasets are orders of magnitude
> smaller than what you posted though....
> 
> -Ben
> 
> 
> 
> 
> On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu> wrote:
> > +1 on using fastx.  I believe this is what our local seq pipeline uses prior to us sending out the processed stuff.
> >
> > chris
> >
> > On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
> >
> >> I would use a faster implementation like the fastx toolkit - http://hannonlab.cshl.edu/fastx_toolkit/
> >>
> >> There are lots of answers to NGS questions on seqanswers too
> >> http://www.google.com/search?q=site:seqanswers.com+trim
> >>
> >>
> >> Jordi Durban wrote:
> >>> Well, there's a program called Seqtrim that uses bioperl to trim the
> >>> sequences.
> >>> Here more information:
> >>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
> >>> Hope this helps.
> >>>
> >>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
> >>>
> >>>> Hi,
> >>>>    Is there any bioperl module available to quality trim in fasta-qual
> >>>>  format.
> >>>> i am little worried about the efficiency as i have huge data (~ 50 gb).
> >>>> Also i would really appreciate if some one has some other suggestions.
> >>>>
> >>>> Thanks
> >>>> Shalabh
> >>>> _______________________________________________
> >>>> Bioperl-l mailing list
> >>>> Bioperl-l at lists.open-bio.org
> >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>>
> >>>
> >>>
> >>>
> >>
> >> --
> >> Jason Stajich
> >>
> >>
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> 



From cjfields at illinois.edu  Wed Feb 16 12:49:34 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Wed, 16 Feb 2011 11:49:34 -0600
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
	<AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
Message-ID: <1B27EE5A-86FE-4C74-B4DC-0899881B3A41@illinois.edu>

Ben,

I haven't used fastx directly, but from the docs I would guess fastx_clipper returns everything that isn't adaptor-only, has just N's, or is above a specified length.  (e.g. I would assume running 'fastx_clipper -k -n -l 0 <foo.fastq>' would return everything).  Is that not the case?

chris

On Feb 16, 2011, at 11:10 AM, Ben Bimber wrote:

> Fastx is great and we use those tools in a number of places, but If
> I'm not mistaken, doesnt its trimming involve filters their either
> including or excluding the read as a whole, rather than end clipping?
> 
> The need probably depends on your data.  With short reads, I could
> imagine that's what you want.  With 500bp 454 reads, end clipping is
> nice.  I ended up making a simple little (and not terribly efficient)
> script that does 3' end clipping.  My datasets are orders of magnitude
> smaller than what you posted though....
> 
> -Ben
> 
> 
> 
> 
> On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu> wrote:
>> +1 on using fastx.  I believe this is what our local seq pipeline uses prior to us sending out the processed stuff.
>> 
>> chris
>> 
>> On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
>> 
>>> I would use a faster implementation like the fastx toolkit - http://hannonlab.cshl.edu/fastx_toolkit/
>>> 
>>> There are lots of answers to NGS questions on seqanswers too
>>> http://www.google.com/search?q=site:seqanswers.com+trim
>>> 
>>> 
>>> Jordi Durban wrote:
>>>> Well, there's a program called Seqtrim that uses bioperl to trim the
>>>> sequences.
>>>> Here more information:
>>>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
>>>> Hope this helps.
>>>> 
>>>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
>>>> 
>>>>> Hi,
>>>>>    Is there any bioperl module available to quality trim in fasta-qual
>>>>>  format.
>>>>> i am little worried about the efficiency as i have huge data (~ 50 gb).
>>>>> Also i would really appreciate if some one has some other suggestions.
>>>>> 
>>>>> Thanks
>>>>> Shalabh
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>> 
>>>> 
>>>> 
>>>> 
>>> 
>>> --
>>> Jason Stajich
>>> 
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From shalabh.sharma7 at gmail.com  Wed Feb 16 12:50:39 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Wed, 16 Feb 2011 12:50:39 -0500
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <D4CEEBB5-2175-4AFC-BF62-438BBA124D30@illinois.edu>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
	<AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
	<AANLkTim3v3M8A3WM7-huOBfEO9BzQYKrZY5b9-Q1pEtG@mail.gmail.com>
	<D4CEEBB5-2175-4AFC-BF62-438BBA124D30@illinois.edu>
Message-ID: <AANLkTinxXyhdt7N0ZLV=Nwi9=5w+TFC8s9bHdMDfgRPD@mail.gmail.com>

@chris,
     Thanks for the suggestions, as i have mentioned earlier that i have
very huge dataset, so before starting anything i am trying to run few test
to see the efficiency of seqTrim, so i can avoid converting fasta to fastq.

Thanks
Shalabh

On Wed, Feb 16, 2011 at 12:36 PM, Chris Fields <cjfields at illinois.edu>wrote:

> Ah, you need qual filtering tied to a specific fasta file.  As most tools
> like fastx expect FASTQ input, it might be advisable to convert to FASTQ
> (which Bio::SeqIO::fastq does if I'm not mistaken).
>
> chris
>
> On Feb 16, 2011, at 11:28 AM, shalabh sharma wrote:
>
> > Hi ,
> >       Thanks all for valuable suggestions, actually i was looking at
> FASTX tool kit but at i glance i saw that the quality filter is only
> implemented for FASTQ files and not for fasta files.
> > But i will take a look again.
> >
> > Thanks
> > Shalabh
> >
> >
> > On Wed, Feb 16, 2011 at 12:10 PM, Ben Bimber <bbimber at gmail.com> wrote:
> > Fastx is great and we use those tools in a number of places, but If
> > I'm not mistaken, doesnt its trimming involve filters their either
> > including or excluding the read as a whole, rather than end clipping?
> >
> > The need probably depends on your data.  With short reads, I could
> > imagine that's what you want.  With 500bp 454 reads, end clipping is
> > nice.  I ended up making a simple little (and not terribly efficient)
> > script that does 3' end clipping.  My datasets are orders of magnitude
> > smaller than what you posted though....
> >
> > -Ben
> >
> >
> >
> >
> > On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu>
> wrote:
> > > +1 on using fastx.  I believe this is what our local seq pipeline uses
> prior to us sending out the processed stuff.
> > >
> > > chris
> > >
> > > On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
> > >
> > >> I would use a faster implementation like the fastx toolkit -
> http://hannonlab.cshl.edu/fastx_toolkit/
> > >>
> > >> There are lots of answers to NGS questions on seqanswers too
> > >> http://www.google.com/search?q=site:seqanswers.com+trim
> > >>
> > >>
> > >> Jordi Durban wrote:
> > >>> Well, there's a program called Seqtrim that uses bioperl to trim the
> > >>> sequences.
> > >>> Here more information:
> > >>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
> > >>> Hope this helps.
> > >>>
> > >>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
> > >>>
> > >>>> Hi,
> > >>>>    Is there any bioperl module available to quality trim in
> fasta-qual
> > >>>>  format.
> > >>>> i am little worried about the efficiency as i have huge data (~ 50
> gb).
> > >>>> Also i would really appreciate if some one has some other
> suggestions.
> > >>>>
> > >>>> Thanks
> > >>>> Shalabh
> > >>>> _______________________________________________
> > >>>> Bioperl-l mailing list
> > >>>> Bioperl-l at lists.open-bio.org
> > >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >>>>
> > >>>
> > >>>
> > >>>
> > >>
> > >> --
> > >> Jason Stajich
> > >>
> > >>
> > >> _______________________________________________
> > >> Bioperl-l mailing list
> > >> Bioperl-l at lists.open-bio.org
> > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > >
> >
>
>

From bbimber at gmail.com  Wed Feb 16 13:15:24 2011
From: bbimber at gmail.com (Ben Bimber)
Date: Wed, 16 Feb 2011 12:15:24 -0600
Subject: [Bioperl-l] Trimming low quality reads
In-Reply-To: <1B27EE5A-86FE-4C74-B4DC-0899881B3A41@illinois.edu>
References: <AANLkTikS33rAfCejGv3g1pRX9mBJ5cdWsc29_755fqM3@mail.gmail.com>
	<AANLkTinq6m_2gS9GvnOQWhq7WBV4xJ1a-XLWWkJJDNB=@mail.gmail.com>
	<4D5BFE44.80604@gmail.com>
	<796DBEB4-6788-4AF5-AE81-A17B10E95388@illinois.edu>
	<AANLkTi=onBqPcdo6gZ5syFJxA6-iXhyHF+fJQ_f0PvxQ@mail.gmail.com>
	<1B27EE5A-86FE-4C74-B4DC-0899881B3A41@illinois.edu>
Message-ID: <AANLkTi=QTpooVBjEvANsPsY0rrtTBFo9fRxjFUrEO=RC@mail.gmail.com>

hi chris,

you're right on fastx_clipped, but i think the tool i'm remembering is
called quality filter or something.  it does things like filter reads
containing Ns, reads with total quality below a threshold etc.

as the same suggests, it removes low qual reads, but does not appear
to trim per se.

-ben



On Wed, Feb 16, 2011 at 11:49 AM, Chris Fields <cjfields at illinois.edu> wrote:
> Ben,
>
> I haven't used fastx directly, but from the docs I would guess fastx_clipper returns everything that isn't adaptor-only, has just N's, or is above a specified length. ?(e.g. I would assume running 'fastx_clipper -k -n -l 0 <foo.fastq>' would return everything). ?Is that not the case?
>
> chris
>
> On Feb 16, 2011, at 11:10 AM, Ben Bimber wrote:
>
>> Fastx is great and we use those tools in a number of places, but If
>> I'm not mistaken, doesnt its trimming involve filters their either
>> including or excluding the read as a whole, rather than end clipping?
>>
>> The need probably depends on your data. ?With short reads, I could
>> imagine that's what you want. ?With 500bp 454 reads, end clipping is
>> nice. ?I ended up making a simple little (and not terribly efficient)
>> script that does 3' end clipping. ?My datasets are orders of magnitude
>> smaller than what you posted though....
>>
>> -Ben
>>
>>
>>
>>
>> On Wed, Feb 16, 2011 at 10:59 AM, Chris Fields <cjfields at illinois.edu> wrote:
>>> +1 on using fastx. ?I believe this is what our local seq pipeline uses prior to us sending out the processed stuff.
>>>
>>> chris
>>>
>>> On Feb 16, 2011, at 10:41 AM, Jason Stajich wrote:
>>>
>>>> I would use a faster implementation like the fastx toolkit - http://hannonlab.cshl.edu/fastx_toolkit/
>>>>
>>>> There are lots of answers to NGS questions on seqanswers too
>>>> http://www.google.com/search?q=site:seqanswers.com+trim
>>>>
>>>>
>>>> Jordi Durban wrote:
>>>>> Well, there's a program called Seqtrim that uses bioperl to trim the
>>>>> sequences.
>>>>> Here more information:
>>>>> http://www.scbi.uma.es/cgi-bin/seqtrim/seqtrim_login.cgi
>>>>> Hope this helps.
>>>>>
>>>>> 2011/2/16 shalabh sharma<shalabh.sharma7 at gmail.com>
>>>>>
>>>>>> Hi,
>>>>>> ? ?Is there any bioperl module available to quality trim in fasta-qual
>>>>>> ?format.
>>>>>> i am little worried about the efficiency as i have huge data (~ 50 gb).
>>>>>> Also i would really appreciate if some one has some other suggestions.
>>>>>>
>>>>>> Thanks
>>>>>> Shalabh
>>>>>> _______________________________________________
>>>>>> Bioperl-l mailing list
>>>>>> Bioperl-l at lists.open-bio.org
>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>> --
>>>> Jason Stajich
>>>>
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


From jonathan at leto.net  Wed Feb 16 17:02:39 2011
From: jonathan at leto.net (Jonathan "Duke" Leto)
Date: Wed, 16 Feb 2011 14:02:39 -0800
Subject: [Bioperl-l] YAPC::NA 2011 is going to be at a resort this
	year...
In-Reply-To: <20110216091218.36a10773.lembark_wrkhors.com@wrkhors.com>
References: <20110216091218.36a10773.lembark_wrkhors.com@wrkhors.com>
Message-ID: <AANLkTi=ZB+w4qJqvApHSAMGHbRkV083d+eCwHW-t1f24@mail.gmail.com>

Howdy,

I plan on attending this conf and giving some talks relating to Perl +
bioinformatics.

Perhaps we should organize some kind of hackathon?

Duke

On Wed, Feb 16, 2011 at 7:12 AM, Steven Lembark <lembark at wrkhors.com> wrote:
>
> Comfortable place to meet, and much cheaper than
> any of the Bioinformatics conferences I know about.
>
> It'd be great to get a track on bioinfrmatics
> there. The point is getting talks that are useful
> to people who use Perl and BioPerl -- not just
> about Perl or Bio::* internals themselves.
>
> Useful topics include things like how-to talks
> about getting work done with Perl, BioPerl, Bio::*,
> or even integrating Perl with R.
>
> The website, including submissions page, are at:
>
> ? ?<http://www.yapc2011.us/yn2011/main>
>
> --
> Steven Lembark ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 3646 Flora Pl
> Workhorse Computing ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? St Louis, MO 63110
> lembark at wrkhors.com ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?+1 888 359 3508
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
Jonathan "Duke" Leto
jonathan at leto.net
http://leto.net


From jw12 at sanger.ac.uk  Thu Feb 17 09:30:08 2011
From: jw12 at sanger.ac.uk (Jonathan Warren)
Date: Thu, 17 Feb 2011 14:30:08 +0000
Subject: [Bioperl-l] DAS Workshop Registration Closing Soon
Message-ID: <0BCCE860-9AEA-4377-A9D6-F28E264DE43A@sanger.ac.uk>

Registration closes for the DAS workshop at 5pm this Friday GMT.  
Limited places still available.
Please note that for the tutorials day (Day 1) it is advisable to know  
at least one of PERL, Java or Javascript.
Further information and registration from here: http://www.ebi.ac.uk/training/onsite/110302DAS.html

There are still a few places for short talks on the second day if you  
have anything to talk about of interest to the DAS community.

Jonathan Warren
Senior Developer and DAS coordinator
blog: http://biodasman.wordpress.com/
jw12 at sanger.ac.uk
Ext: 2314
Telephone: 01223 492314










-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From bpcwhite at gmail.com  Fri Feb 18 09:28:28 2011
From: bpcwhite at gmail.com (Bryan White)
Date: Fri, 18 Feb 2011 06:28:28 -0800 (PST)
Subject: [Bioperl-l] Append a whole tree to a node
Message-ID: <fe29712d-1701-4f86-82d4-cf9825e81245@r19g2000prm.googlegroups.com>

Hello, I was wondering if there is built in functionality to append a
whole subtree to a node? For instance, I want to replace the Primate
node on an order-level mammal tree with a Primate species-level tree.
It seems like if there isn't already a function for it, that iterating
through add_descendant from Bio::Tree::NodeI would be my best bet.

Thanks,
Bryan

From laurent.frantz at wur.nl  Fri Feb 18 12:51:26 2011
From: laurent.frantz at wur.nl (Frantz, Laurent)
Date: Fri, 18 Feb 2011 18:51:26 +0100
Subject: [Bioperl-l] PAML Codeml version supported
Message-ID: <A16818D279B31C48BDF4657E2E728259164CEFCAC7@scomp0534.wurnet.nl>

Dear Bioperl Gurus,

I have a large set of genes that I need to check separately for dS/dN. I am trying to use the Bioperl wrapper for PAML, however I can not get it to work.
I have read that there are problems with the output of newer version of PAML that does not fit to the wrapper. I have tried 4.4, 4.1 and then 3.15 none of those work.

Here is my error message (same with all those versions):

------------- EXCEPTION: Bio::Root::NotImplemented -------------
MSG: Unknown format of PAML output did not see seqtype
STACK: Error::throw
STACK: Bio::Root::Root::throw /usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
STACK: Bio::Tools::Phylo::PAML::_parse_summary /usr/local/share/perl/5.10.1/Bio/Tools/Phylo/PAML.pm:461
STACK: Bio::Tools::Phylo::PAML::next_result /usr/local/share/perl/5.10.1/Bio/Tools/Phylo/PAML.pm:270
STACK: paml_gene_parse.pl:26
----------------------------------------------------------------

Could anyone tell me which of the PAML - Codeml versions gives an output that can be parsed by Bioperl?
I am surprised that it does not work with the version 3.15 as it is suppose to (http://www.bioperl.org/wiki/PAML). 

I am also wondering if my syntax is correct.

@files = @ARGV;

foreach $files (@files) {
        my $kaks_factory = Bio::Tools::Run::Phylo::PAML::Codeml->new
        ( -params => { 'runmode' => -2,
                        'seqtype' => 1,
                                   } );
        $kaks_factory->alignment($files);
        my ($rc,$parser) = $kaks_factory->run();
        my $result = $parser->next_result;
        my $MLmatrix = $result->get_MLmatrix();
        print "$MLmatrix\n";
}

The files that I input are already formated for Codeml, they work perfectly fine when I feed them myself to Codeml through the config file.

I hope someone can help me..
Thank you,

Laurent Frantz
PhD Student - Comparative Genomics
Wageningen University
laurent.frantz at wur.nl


From sharmashalu.bio at gmail.com  Fri Feb 18 16:13:34 2011
From: sharmashalu.bio at gmail.com (shalu sharma)
Date: Fri, 18 Feb 2011 16:13:34 -0500
Subject: [Bioperl-l] reading Quality files
Message-ID: <AANLkTi=Rs_n+j4=0ReExYX42my4dWOCeQpKuw_3g7BJe@mail.gmail.com>

Hi ,
     Can i read quality files just as the same way i read fasta files (by
using Bio::SeqIO) ?
I tried reading with using -format => 'fasta' but as the output all the
spaces between the quality scores are deleted.
 ex:
>1508:1:1:2228:1817_55bp_47.8_0.74
3939383938393935393939393936383735393533383338382735233838333835381135353838383836173536362735383838353835353638353636293835383238293838403939314040357241596965596364474950225467646314607056636769717175707161732538333520353735382029254040294037392036393229253535371940403537353540402940423137423737223540222227202220

and when i tried to read it with -format => 'qual' i got error message.
Can't locate object method "seq" via package "Bio::Seq::PrimaryQual" at
readQual.pl line 6, <GEN0> line 1

Do i have to call different methods when using quality files?

I will really appreciate your help.

Thanks
Shalu


From florent.angly at gmail.com  Fri Feb 18 20:02:17 2011
From: florent.angly at gmail.com (Florent Angly)
Date: Sat, 19 Feb 2011 11:02:17 +1000
Subject: [Bioperl-l] reading Quality files
In-Reply-To: <AANLkTi=Rs_n+j4=0ReExYX42my4dWOCeQpKuw_3g7BJe@mail.gmail.com>
References: <AANLkTi=Rs_n+j4=0ReExYX42my4dWOCeQpKuw_3g7BJe@mail.gmail.com>
Message-ID: <4D5F1699.7010409@gmail.com>

On 19/02/11 07:13, shalu sharma wrote:
> Hi ,
>       Can i read quality files just as the same way i read fasta files (by
> using Bio::SeqIO) ?
> I tried reading with using -format =>  'fasta' but as the output all the
> spaces between the quality scores are deleted.
>   ex:
>> 1508:1:1:2228:1817_55bp_47.8_0.74
> 3939383938393935393939393936383735393533383338382735233838333835381135353838383836173536362735383838353835353638353636293835383238293838403939314040357241596965596364474950225467646314607056636769717175707161732538333520353735382029254040294037392036393229253535371940403537353540402940423137423737223540222227202220
>
Yes, that is not correct. There is a specific IO module for quality 
scores: Bio::SeqIO::qual

> and when i tried to read it with -format =>  'qual'
That is good: see 
http://search.cpan.org/~cjfields/BioPerl-1.6.1/Bio/SeqIO/qual.pm 
<http://search.cpan.org/%7Ecjfields/BioPerl-1.6.1/Bio/SeqIO/qual.pm>
Once you have initialized a Bio::SeqIO object, you can call next_seq() 
to get the next Bio::Seq::Quality object.

> i got error message.
> Can't locate object method "seq" via package "Bio::Seq::PrimaryQual" at
> readQual.pl line 6,<GEN0>  line 1
Once you have a Bio::Seq::Quality object, you can use the qual() method 
on it. See 
http://search.cpan.org/~cjfields/BioPerl-1.6.1/Bio/Seq/Quality.pm 
<http://search.cpan.org/%7Ecjfields/BioPerl-1.6.1/Bio/Seq/Quality.pm>

> Do i have to call different methods when using quality files?
>
> I will really appreciate your help.
>
> Thanks
> Shalu
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


From mm809 at cam.ac.uk  Sat Feb 19 09:53:27 2011
From: mm809 at cam.ac.uk (Mingwei Min)
Date: Sat, 19 Feb 2011 14:53:27 +0000
Subject: [Bioperl-l] question about positioning peptide in a full protein
	sequence
Message-ID: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>

Hi,

I am trying to positioning some post-tranlational modification sites,
which is marked in peptides, in a full length protein sequence. Anyone
would be kind to tell me the model I could use for this?

Many thanks

Mingwei

From David.Messina at sbc.su.se  Sat Feb 19 10:25:17 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sat, 19 Feb 2011 16:25:17 +0100
Subject: [Bioperl-l] PAML Codeml version supported
In-Reply-To: <A16818D279B31C48BDF4657E2E728259164CEFCAC7@scomp0534.wurnet.nl>
References: <A16818D279B31C48BDF4657E2E728259164CEFCAC7@scomp0534.wurnet.nl>
Message-ID: <AANLkTi=+NcLbCcn_NROHjw9vw1sdsjPEpe-G30kwRHW9@mail.gmail.com>

Hi Laurent,

The last version of PAML/CODEML that I personally verified to work with
BioPerl was 4.3b. Unfortunately, PAML's author has a bad habit of constantly
changing his programs' output format ? and constantly releasing new versions
? so it's difficult for us to keep up.

Are you using a relatively recent version of bioperl-live downloaded from
github? If so, would you please file this as a bug? Please include with that
bug a codeml output file from version 4.4 (assuming that's the version you
want to use).

http://bugzilla.open-bio.org/


I haven't tested it, but I think your code is fine ? the error you posted is
in the parsing code, not in the run-PAML code.

Incidentally, I'm surprised 3.15 doesn't work because we have tests
specifically for that version that pass AFAIK. But of course tests don't
cover everything.


Dave





On Fri, Feb 18, 2011 at 18:51, Frantz, Laurent <laurent.frantz at wur.nl>wrote:

> Dear Bioperl Gurus,
>
> I have a large set of genes that I need to check separately for dS/dN. I am
> trying to use the Bioperl wrapper for PAML, however I can not get it to
> work.
> I have read that there are problems with the output of newer version of
> PAML that does not fit to the wrapper. I have tried 4.4, 4.1 and then 3.15
> none of those work.
>
> Here is my error message (same with all those versions):
>
> ------------- EXCEPTION: Bio::Root::NotImplemented -------------
> MSG: Unknown format of PAML output did not see seqtype
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/local/share/perl/5.10.1/Bio/Root/Root.pm:368
> STACK: Bio::Tools::Phylo::PAML::_parse_summary
> /usr/local/share/perl/5.10.1/Bio/Tools/Phylo/PAML.pm:461
> STACK: Bio::Tools::Phylo::PAML::next_result
> /usr/local/share/perl/5.10.1/Bio/Tools/Phylo/PAML.pm:270
> STACK: paml_gene_parse.pl:26
> ----------------------------------------------------------------
>
> Could anyone tell me which of the PAML - Codeml versions gives an output
> that can be parsed by Bioperl?
> I am surprised that it does not work with the version 3.15 as it is suppose
> to (http://www.bioperl.org/wiki/PAML).
>
> I am also wondering if my syntax is correct.
>
> @files = @ARGV;
>
> foreach $files (@files) {
>        my $kaks_factory = Bio::Tools::Run::Phylo::PAML::Codeml->new
>        ( -params => { 'runmode' => -2,
>                        'seqtype' => 1,
>                                   } );
>        $kaks_factory->alignment($files);
>        my ($rc,$parser) = $kaks_factory->run();
>        my $result = $parser->next_result;
>        my $MLmatrix = $result->get_MLmatrix();
>        print "$MLmatrix\n";
> }
>
> The files that I input are already formated for Codeml, they work perfectly
> fine when I feed them myself to Codeml through the config file.
>
> I hope someone can help me..
> Thank you,
>
> Laurent Frantz
> PhD Student - Comparative Genomics
> Wageningen University
> laurent.frantz at wur.nl
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>


From David.Messina at sbc.su.se  Sun Feb 20 16:18:50 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sun, 20 Feb 2011 22:18:50 +0100
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
Message-ID: <AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>

Hi Mingwei,

I'm not sure what you mean by "positioning" here. Do you want to get the
coordinates of the post-translational sites out of a protein sequence
database record? Or do you want to draw the post-translational sites on a
picture of the protein sequence? Or something else entirely?


Dave




On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:

> Hi,
>
> I am trying to positioning some post-tranlational modification sites,
> which is marked in peptides, in a full length protein sequence. Anyone
> would be kind to tell me the model I could use for this?
>
> Many thanks
>
> Mingwei
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

From mm809 at cam.ac.uk  Sun Feb 20 16:41:36 2011
From: mm809 at cam.ac.uk (Mingwei Min)
Date: Sun, 20 Feb 2011 21:41:36 +0000
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
Message-ID: <AANLkTinS21eVAN9ujPTKNjtaNxX2RuCAo8ivNGh3QdhW@mail.gmail.com>

Hi Dave,

Sorry for not making it clear. Yes, I just want to get the coordinates
of the post-translational sites out of a protein sequence. And what I
have now is the peptide sequence with marker on the post-translated
residue... what should i do to map them to the whole protein sequence
and get the coordinates? The only way I could come up with is blast.
But it seems to be too complex for this simple job....

Many thanks,

Mingwei


2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
> Hi Mingwei,
> I'm not sure what you mean by "positioning" here. Do you want to get the
> coordinates of the post-translational sites out of a protein sequence
> database record? Or do you want to draw the post-translational sites on a
> picture of the protein sequence? Or something else entirely?
>
> Dave
>
>
>
> On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>
>> Hi,
>>
>> I am trying to positioning some post-tranlational modification sites,
>> which is marked in peptides, in a full length protein sequence. Anyone
>> would be kind to tell me the model I could use for this?
>>
>> Many thanks
>>
>> Mingwei
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>

From David.Messina at sbc.su.se  Sun Feb 20 17:00:33 2011
From: David.Messina at sbc.su.se (Dave Messina)
Date: Sun, 20 Feb 2011 23:00:33 +0100
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
Message-ID: <AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>

Hi Mingwei,

Please remember to "reply all" so others on the mailing list can follow the
conversation.

Unless you have some way of other way of mapping the coordinates of the
sequence with the post-translational sites to the coordinates of the full
sequence, I think you'll have to do a similarity search of some form.

BLAST may not be best for this, given that it's sloppy with the ends of an
alignment, but there are plenty of options for BLAST that may improve your
results. Again, you'll need to be specific about your problem for us to
help. I don't what "too complex for this simple job" means. Is it too slow?
Are you getting too many hits?



Dave



On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:

> Hi Dave,
>
> Sorry for not making it clear. Yes, I just want to get the coordinates
> of the post-translational sites out of a protein sequence. And what I
> have now is the peptide sequence with marker on the post-translated
> residue... what should i do to map them to the whole protein sequence
> and get the coordinates? The only way I could come up with is blast.
> But it seems to be too complex for this simple job....
>
> Many thanks,
>
> Mingwei
>
> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
> > Hi Mingwei,
> > I'm not sure what you mean by "positioning" here. Do you want to get the
> > coordinates of the post-translational sites out of a protein sequence
> > database record? Or do you want to draw the post-translational sites on a
> > picture of the protein sequence? Or something else entirely?
> >
> > Dave
> >
> >
> >
> > On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
> >>
> >> Hi,
> >>
> >> I am trying to positioning some post-tranlational modification sites,
> >> which is marked in peptides, in a full length protein sequence. Anyone
> >> would be kind to tell me the model I could use for this?
> >>
> >> Many thanks
> >>
> >> Mingwei
> >> _______________________________________________
> >> Bioperl-l mailing list
> >> Bioperl-l at lists.open-bio.org
> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
> >
>

From mm809 at cam.ac.uk  Sun Feb 20 17:28:31 2011
From: mm809 at cam.ac.uk (Mingwei Min)
Date: Sun, 20 Feb 2011 22:28:31 +0000
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
	<AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
Message-ID: <AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>

Hi Dave,

Thank you for your suggestion. when I said "too comple for this simple
job", I just thought that there might be some particular module that
could do this straightforwardly. I'll have a try of BLAST anyway.
Thank you.

Mingwei

2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
> Hi Mingwei,
> Please remember to "reply all" so others on the mailing list can follow the
> conversation.
> Unless you have some way of other way of mapping the coordinates of the
> sequence with the post-translational sites to the coordinates of the full
> sequence, I think you'll have to do a similarity search of some form.
> BLAST may not be best for this, given that it's sloppy with the ends of an
> alignment, but there are plenty of options for BLAST that may improve your
> results.?Again, you'll need to be specific about your problem for us to
> help. I don't what "too complex for this simple job" means. Is it too slow?
> Are you getting too many hits?
>
>
> Dave
>
>
> On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>
>> Hi Dave,
>>
>> Sorry for not making it clear. Yes, I just want to get the coordinates
>> of the post-translational sites out of a protein sequence. And what I
>> have now is the peptide sequence with marker on the post-translated
>> residue... what should i do to map them to the whole protein sequence
>> and get the coordinates? The only way I could come up with is blast.
>> But it seems to be too complex for this simple job....
>>
>> Many thanks,
>>
>> Mingwei
>>
>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>> > Hi Mingwei,
>> > I'm not sure what you mean by "positioning" here. Do you want to get the
>> > coordinates of the post-translational sites out of a protein sequence
>> > database record? Or do you want to draw the post-translational sites on
>> > a
>> > picture of the protein sequence? Or something else entirely?
>> >
>> > Dave
>> >
>> >
>> >
>> > On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
>> >>
>> >> Hi,
>> >>
>> >> I am trying to positioning some post-tranlational modification sites,
>> >> which is marked in peptides, in a full length protein sequence. Anyone
>> >> would be kind to tell me the model I could use for this?
>> >>
>> >> Many thanks
>> >>
>> >> Mingwei
>> >> _______________________________________________
>> >> Bioperl-l mailing list
>> >> Bioperl-l at lists.open-bio.org
>> >> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> >
>> >
>
>



-- 
Mingwei Min ?PhD student
University of Cambridge
Department of Genetics
Downing St
CB2 3EH
UK


From cjfields at illinois.edu  Sun Feb 20 21:57:44 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 20 Feb 2011 20:57:44 -0600
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
	<AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
	<AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>
Message-ID: <43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>

If this is a direct string match (no ambiguity), just use perl's index function:

       index STR,SUBSTR,POSITION
       index STR,SUBSTR
               The index function searches for one string within another, but
               without the wildcard-like behavior of a full regular-expression
               pattern match.  It returns the position of the first occurrence
               of SUBSTR in STR at or after POSITION.  If POSITION is omitted,
               starts searching from the beginning of the string.  POSITION
               before the beginning of the string or after its end is treated
               as if it were the beginning or the end, respectively.  POSITION
               and the return value are based at 0 (or whatever you've set the
               $[ variable to--but don't do that).  If the substring is not
               found, "index" returns one less than the base, ordinarily "-1".

Also see here:

http://perlmeme.org/howtos/perlfunc/index_function.html

chris

On Feb 20, 2011, at 4:28 PM, Mingwei Min wrote:

> Hi Dave,
> 
> Thank you for your suggestion. when I said "too comple for this simple
> job", I just thought that there might be some particular module that
> could do this straightforwardly. I'll have a try of BLAST anyway.
> Thank you.
> 
> Mingwei
> 
> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>> Hi Mingwei,
>> Please remember to "reply all" so others on the mailing list can follow the
>> conversation.
>> Unless you have some way of other way of mapping the coordinates of the
>> sequence with the post-translational sites to the coordinates of the full
>> sequence, I think you'll have to do a similarity search of some form.
>> BLAST may not be best for this, given that it's sloppy with the ends of an
>> alignment, but there are plenty of options for BLAST that may improve your
>> results. Again, you'll need to be specific about your problem for us to
>> help. I don't what "too complex for this simple job" means. Is it too slow?
>> Are you getting too many hits?
>> 
>> 
>> Dave
>> 
>> 
>> On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>> 
>>> Hi Dave,
>>> 
>>> Sorry for not making it clear. Yes, I just want to get the coordinates
>>> of the post-translational sites out of a protein sequence. And what I
>>> have now is the peptide sequence with marker on the post-translated
>>> residue... what should i do to map them to the whole protein sequence
>>> and get the coordinates? The only way I could come up with is blast.
>>> But it seems to be too complex for this simple job....
>>> 
>>> Many thanks,
>>> 
>>> Mingwei
>>> 
>>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>>>> Hi Mingwei,
>>>> I'm not sure what you mean by "positioning" here. Do you want to get the
>>>> coordinates of the post-translational sites out of a protein sequence
>>>> database record? Or do you want to draw the post-translational sites on
>>>> a
>>>> picture of the protein sequence? Or something else entirely?
>>>> 
>>>> Dave
>>>> 
>>>> 
>>>> 
>>>> On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>>>> 
>>>>> Hi,
>>>>> 
>>>>> I am trying to positioning some post-tranlational modification sites,
>>>>> which is marked in peptides, in a full length protein sequence. Anyone
>>>>> would be kind to tell me the model I could use for this?
>>>>> 
>>>>> Many thanks
>>>>> 
>>>>> Mingwei
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>> 
>>>> 
>> 
>> 
> 
> 
> 
> -- 
> Mingwei Min  PhD student
> University of Cambridge
> Department of Genetics
> Downing St
> CB2 3EH
> UK
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From fs5 at sanger.ac.uk  Mon Feb 21 04:26:21 2011
From: fs5 at sanger.ac.uk (Frank Schwach)
Date: Mon, 21 Feb 2011 09:26:21 +0000
Subject: [Bioperl-l] question about positioning peptide in a
	full	protein sequence
In-Reply-To: <43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
	<AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
	<AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>
	<43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>
Message-ID: <1298280381.4541.380.camel@deskpro15336.internal.sanger.ac.uk>

Hi Mingwei,

I guess this is MS data for phosphorylation sites? We are doing the same
here. I don't know what software you are using in yuor MS pipeline but
it may already map the peptides to the full-length protein for you. If
not, you probably get peptide sequences with the probabilities of a site
carrying a phosphate (or whatever post-translational modification)
encoded in the string, e.g the data I'm working with will show me
something like "..LKS[0.99]S[0.01]..." to indicate probabilities of 99%
and 1% of those two serines being modified. You then have to extract
that data from the peptide string using a regex. Then you can identifiy
the most probable site within the string and map the peptide string to
the full-length protein sequence using index (or a regex) as Chris
suggested. You can then calculate the position of the actual modified
site from the match position of the peptide and the position of the site
within the peptide. I don't think there is any ready-made solution of
this as it is basically just simply string-matching but please do let me
knof if you are getting stuck and I can help you further.

Cheers,

Frank



On Sun, 2011-02-20 at 20:57 -0600, Chris Fields wrote:
> If this is a direct string match (no ambiguity), just use perl's index function:
> 
>        index STR,SUBSTR,POSITION
>        index STR,SUBSTR
>                The index function searches for one string within another, but
>                without the wildcard-like behavior of a full regular-expression
>                pattern match.  It returns the position of the first occurrence
>                of SUBSTR in STR at or after POSITION.  If POSITION is omitted,
>                starts searching from the beginning of the string.  POSITION
>                before the beginning of the string or after its end is treated
>                as if it were the beginning or the end, respectively.  POSITION
>                and the return value are based at 0 (or whatever you've set the
>                $[ variable to--but don't do that).  If the substring is not
>                found, "index" returns one less than the base, ordinarily "-1".
> 
> Also see here:
> 
> http://perlmeme.org/howtos/perlfunc/index_function.html
> 
> chris
> 
> On Feb 20, 2011, at 4:28 PM, Mingwei Min wrote:
> 
> > Hi Dave,
> > 
> > Thank you for your suggestion. when I said "too comple for this simple
> > job", I just thought that there might be some particular module that
> > could do this straightforwardly. I'll have a try of BLAST anyway.
> > Thank you.
> > 
> > Mingwei
> > 
> > 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
> >> Hi Mingwei,
> >> Please remember to "reply all" so others on the mailing list can follow the
> >> conversation.
> >> Unless you have some way of other way of mapping the coordinates of the
> >> sequence with the post-translational sites to the coordinates of the full
> >> sequence, I think you'll have to do a similarity search of some form.
> >> BLAST may not be best for this, given that it's sloppy with the ends of an
> >> alignment, but there are plenty of options for BLAST that may improve your
> >> results. Again, you'll need to be specific about your problem for us to
> >> help. I don't what "too complex for this simple job" means. Is it too slow?
> >> Are you getting too many hits?
> >> 
> >> 
> >> Dave
> >> 
> >> 
> >> On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:
> >>> 
> >>> Hi Dave,
> >>> 
> >>> Sorry for not making it clear. Yes, I just want to get the coordinates
> >>> of the post-translational sites out of a protein sequence. And what I
> >>> have now is the peptide sequence with marker on the post-translated
> >>> residue... what should i do to map them to the whole protein sequence
> >>> and get the coordinates? The only way I could come up with is blast.
> >>> But it seems to be too complex for this simple job....
> >>> 
> >>> Many thanks,
> >>> 
> >>> Mingwei
> >>> 
> >>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
> >>>> Hi Mingwei,
> >>>> I'm not sure what you mean by "positioning" here. Do you want to get the
> >>>> coordinates of the post-translational sites out of a protein sequence
> >>>> database record? Or do you want to draw the post-translational sites on
> >>>> a
> >>>> picture of the protein sequence? Or something else entirely?
> >>>> 
> >>>> Dave
> >>>> 
> >>>> 
> >>>> 
> >>>> On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
> >>>>> 
> >>>>> Hi,
> >>>>> 
> >>>>> I am trying to positioning some post-tranlational modification sites,
> >>>>> which is marked in peptides, in a full length protein sequence. Anyone
> >>>>> would be kind to tell me the model I could use for this?
> >>>>> 
> >>>>> Many thanks
> >>>>> 
> >>>>> Mingwei
> >>>>> _______________________________________________
> >>>>> Bioperl-l mailing list
> >>>>> Bioperl-l at lists.open-bio.org
> >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >>>> 
> >>>> 
> >> 
> >> 
> > 
> > 
> > 
> > -- 
> > Mingwei Min  PhD student
> > University of Cambridge
> > Department of Genetics
> > Downing St
> > CB2 3EH
> > UK
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

From shalabh.sharma7 at gmail.com  Mon Feb 21 09:44:33 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Mon, 21 Feb 2011 09:44:33 -0500
Subject: [Bioperl-l] fasta to fastq
Message-ID: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>

Hi,
    Is there any module that can convert fasta and qual files to FASTQ
format?
I found lot of programs that can do it the other way but not fasta to fastq.

I would really appreciate your help.

Thanks
Shalabh

From p.j.a.cock at googlemail.com  Mon Feb 21 10:13:01 2011
From: p.j.a.cock at googlemail.com (Peter Cock)
Date: Mon, 21 Feb 2011 15:13:01 +0000
Subject: [Bioperl-l] fasta to fastq
In-Reply-To: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>
References: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>
Message-ID: <AANLkTimKkwp4b-+ca5SgtN-3Gdhq8gmpsbDU2MXX0j_v@mail.gmail.com>

On Mon, Feb 21, 2011 at 2:44 PM, shalabh sharma
<shalabh.sharma7 at gmail.com> wrote:
> Hi,
> ? ?Is there any module that can convert fasta and qual files to FASTQ
> format?
> I found lot of programs that can do it the other way but not fasta to fastq.
>
> I would really appreciate your help.
>
> Thanks
> Shalabh

Hi,

Yes, you can do FASTA+QUAL to FASTQ with BioPerl, see:
http://www.bioperl.org/wiki/Merging_separate_sequence_and_quality_files_to_FASTQ

For comparison the Biopython Tutorial has a Python example
(section "Converting FASTA and QUAL files into FASTQ files"):
http://biopython.org/DIST/docs/tutorial/Tutorial.html
http://biopython.org/DIST/docs/tutorial/Tutorial.pdf

Peter


From awitney at sgul.ac.uk  Mon Feb 21 10:06:50 2011
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 21 Feb 2011 15:06:50 +0000
Subject: [Bioperl-l] fasta to fastq
In-Reply-To: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>
References: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>
Message-ID: <69FFF792-E3D2-4BC1-B628-3B161434112B@sgul.ac.uk>


I've never tried it, but this looks like it will do what you ask for...

http://www.bioperl.org/wiki/Merging_separate_sequence_and_quality_files_to_FASTQ

adam


On 21 Feb 2011, at 14:44, shalabh sharma wrote:

> Hi,
>    Is there any module that can convert fasta and qual files to FASTQ
> format?
> I found lot of programs that can do it the other way but not fasta to fastq.
> 
> I would really appreciate your help.
> 
> Thanks
> Shalabh
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From shalabh.sharma7 at gmail.com  Mon Feb 21 11:14:38 2011
From: shalabh.sharma7 at gmail.com (shalabh sharma)
Date: Mon, 21 Feb 2011 11:14:38 -0500
Subject: [Bioperl-l] fasta to fastq
In-Reply-To: <AANLkTimKkwp4b-+ca5SgtN-3Gdhq8gmpsbDU2MXX0j_v@mail.gmail.com>
References: <AANLkTinTR1du8whSOjKf9WyHd7SDMqLu1fh+pkE5zKdD@mail.gmail.com>
	<AANLkTimKkwp4b-+ca5SgtN-3Gdhq8gmpsbDU2MXX0j_v@mail.gmail.com>
Message-ID: <AANLkTineUuGx-2=b1gsW=dt5TKgpUxy06fzLzuKfYBJ+@mail.gmail.com>

Hi,
  @Adam, Peter.
     Thanks a lot , "Merging with Bioperl worked".
Actually i was looking exactly something like this.

Thanks
Shalabh


On Mon, Feb 21, 2011 at 10:13 AM, Peter Cock <p.j.a.cock at googlemail.com>wrote:

> On Mon, Feb 21, 2011 at 2:44 PM, shalabh sharma
> <shalabh.sharma7 at gmail.com> wrote:
> > Hi,
> >    Is there any module that can convert fasta and qual files to FASTQ
> > format?
> > I found lot of programs that can do it the other way but not fasta to
> fastq.
> >
> > I would really appreciate your help.
> >
> > Thanks
> > Shalabh
>
> Hi,
>
> Yes, you can do FASTA+QUAL to FASTQ with BioPerl, see:
>
> http://www.bioperl.org/wiki/Merging_separate_sequence_and_quality_files_to_FASTQ
>
> For comparison the Biopython Tutorial has a Python example
> (section "Converting FASTA and QUAL files into FASTQ files"):
> http://biopython.org/DIST/docs/tutorial/Tutorial.html
> http://biopython.org/DIST/docs/tutorial/Tutorial.pdf
>
> Peter
>

From mm809 at cam.ac.uk  Mon Feb 21 15:23:20 2011
From: mm809 at cam.ac.uk (Mingwei Min)
Date: Mon, 21 Feb 2011 20:23:20 +0000
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <1298280381.4541.380.camel@deskpro15336.internal.sanger.ac.uk>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
	<AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
	<AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>
	<43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>
	<1298280381.4541.380.camel@deskpro15336.internal.sanger.ac.uk>
Message-ID: <AANLkTikek4NfSqgiD_jVg_R+kwpF1rK2nUtzVtQjxL+z@mail.gmail.com>

Hi Frank,

Yes, this is MS data for phosphorylation sites, as well as
ubiquitinlytion sites. I am now dealing with some published data---
some of which only show the peptide(and yes, some with the modifying
probabilities) without coordinates in the sequence. The way Chris
suggested is already very straightforward. I'll have a try. Thank you
very much for your help.

Cheer,

Mingwei

2011/2/21 Frank Schwach <fs5 at sanger.ac.uk>:
> Hi Mingwei,
>
> I guess this is MS data for phosphorylation sites? We are doing the same
> here. I don't know what software you are using in yuor MS pipeline but
> it may already map the peptides to the full-length protein for you. If
> not, you probably get peptide sequences with the probabilities of a site
> carrying a phosphate (or whatever post-translational modification)
> encoded in the string, e.g the data I'm working with will show me
> something like "..LKS[0.99]S[0.01]..." to indicate probabilities of 99%
> and 1% of those two serines being modified. You then have to extract
> that data from the peptide string using a regex. Then you can identifiy
> the most probable site within the string and map the peptide string to
> the full-length protein sequence using index (or a regex) as Chris
> suggested. You can then calculate the position of the actual modified
> site from the match position of the peptide and the position of the site
> within the peptide. I don't think there is any ready-made solution of
> this as it is basically just simply string-matching but please do let me
> knof if you are getting stuck and I can help you further.
>
> Cheers,
>
> Frank
>
>
>
> On Sun, 2011-02-20 at 20:57 -0600, Chris Fields wrote:
>> If this is a direct string match (no ambiguity), just use perl's index function:
>>
>> ? ? ? ?index STR,SUBSTR,POSITION
>> ? ? ? ?index STR,SUBSTR
>> ? ? ? ? ? ? ? ?The index function searches for one string within another, but
>> ? ? ? ? ? ? ? ?without the wildcard-like behavior of a full regular-expression
>> ? ? ? ? ? ? ? ?pattern match. ?It returns the position of the first occurrence
>> ? ? ? ? ? ? ? ?of SUBSTR in STR at or after POSITION. ?If POSITION is omitted,
>> ? ? ? ? ? ? ? ?starts searching from the beginning of the string. ?POSITION
>> ? ? ? ? ? ? ? ?before the beginning of the string or after its end is treated
>> ? ? ? ? ? ? ? ?as if it were the beginning or the end, respectively. ?POSITION
>> ? ? ? ? ? ? ? ?and the return value are based at 0 (or whatever you've set the
>> ? ? ? ? ? ? ? ?$[ variable to--but don't do that). ?If the substring is not
>> ? ? ? ? ? ? ? ?found, "index" returns one less than the base, ordinarily "-1".
>>
>> Also see here:
>>
>> http://perlmeme.org/howtos/perlfunc/index_function.html
>>
>> chris
>>
>> On Feb 20, 2011, at 4:28 PM, Mingwei Min wrote:
>>
>> > Hi Dave,
>> >
>> > Thank you for your suggestion. when I said "too comple for this simple
>> > job", I just thought that there might be some particular module that
>> > could do this straightforwardly. I'll have a try of BLAST anyway.
>> > Thank you.
>> >
>> > Mingwei
>> >
>> > 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>> >> Hi Mingwei,
>> >> Please remember to "reply all" so others on the mailing list can follow the
>> >> conversation.
>> >> Unless you have some way of other way of mapping the coordinates of the
>> >> sequence with the post-translational sites to the coordinates of the full
>> >> sequence, I think you'll have to do a similarity search of some form.
>> >> BLAST may not be best for this, given that it's sloppy with the ends of an
>> >> alignment, but there are plenty of options for BLAST that may improve your
>> >> results. Again, you'll need to be specific about your problem for us to
>> >> help. I don't what "too complex for this simple job" means. Is it too slow?
>> >> Are you getting too many hits?
>> >>
>> >>
>> >> Dave
>> >>
>> >>
>> >> On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:
>> >>>
>> >>> Hi Dave,
>> >>>
>> >>> Sorry for not making it clear. Yes, I just want to get the coordinates
>> >>> of the post-translational sites out of a protein sequence. And what I
>> >>> have now is the peptide sequence with marker on the post-translated
>> >>> residue... what should i do to map them to the whole protein sequence
>> >>> and get the coordinates? The only way I could come up with is blast.
>> >>> But it seems to be too complex for this simple job....
>> >>>
>> >>> Many thanks,
>> >>>
>> >>> Mingwei
>> >>>
>> >>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>> >>>> Hi Mingwei,
>> >>>> I'm not sure what you mean by "positioning" here. Do you want to get the
>> >>>> coordinates of the post-translational sites out of a protein sequence
>> >>>> database record? Or do you want to draw the post-translational sites on
>> >>>> a
>> >>>> picture of the protein sequence? Or something else entirely?
>> >>>>
>> >>>> Dave
>> >>>>
>> >>>>
>> >>>>
>> >>>> On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
>> >>>>>
>> >>>>> Hi,
>> >>>>>
>> >>>>> I am trying to positioning some post-tranlational modification sites,
>> >>>>> which is marked in peptides, in a full length protein sequence. Anyone
>> >>>>> would be kind to tell me the model I could use for this?
>> >>>>>
>> >>>>> Many thanks
>> >>>>>
>> >>>>> Mingwei
>> >>>>> _______________________________________________
>> >>>>> Bioperl-l mailing list
>> >>>>> Bioperl-l at lists.open-bio.org
>> >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> >>>>
>> >>>>
>> >>
>> >>
>> >
>> >
>> >
>> > --
>> > Mingwei Min ?PhD student
>> > University of Cambridge
>> > Department of Genetics
>> > Downing St
>> > CB2 3EH
>> > UK
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l at lists.open-bio.org
>> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> --
> ?The Wellcome Trust Sanger Institute is operated by Genome Research
> ?Limited, a charity registered in England with number 1021457 and a
> ?company registered in England with number 2742969, whose registered
> ?office is 215 Euston Road, London, NW1 2BE.


From snamln at unife.it  Mon Feb 21 15:25:41 2011
From: snamln at unife.it (Maria elena Sana)
Date: Mon, 21 Feb 2011 21:25:41 +0100
Subject: [Bioperl-l] bio::Db::sam bioperl version
Message-ID: <AANLkTinsmhXUk6EK9CKVvZUnVvWwHU_CATUY6kCraC3V@mail.gmail.com>

Hi All,
I'm using a perl script with Bioperl /Bio:DB::Sam object but it runs
differently on two server on which there are two different perl
version (5.8.8 and 5.10.1 respectively). On the first machine on which
there is the 5.8.8 perl version, the script runs correctly, on the
second it doesn't return errors but doesn't work perfectly. Any
elucidation?
I have specifically problem with calculation of query position in pileup
routine (Bio::DB::Bam::PILEUP)
Thanx a lot

-- 
Dott.ssa Maria Elena Sana
Universit? di Ferrara
Dipartimento di Morfologia ed Embriologia
Via Fossato di Mortara, 70
(Viale Eliporto presso CUBO)
44121 - Ferrara
Italy Phone 0532-455851
Mail mariaelena.sana at unife.it


From mm809 at cam.ac.uk  Mon Feb 21 15:11:59 2011
From: mm809 at cam.ac.uk (Mingwei Min)
Date: Mon, 21 Feb 2011 20:11:59 +0000
Subject: [Bioperl-l] question about positioning peptide in a full
	protein sequence
In-Reply-To: <43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>
References: <AANLkTinhTMOLMn=hPfXOOnn-Ltbb+4jG3JM0XaVOsK83@mail.gmail.com>
	<AANLkTi=Y6Ox2SEs-mqVQinokj2jKt7bGG0SAyZ9oVFHi@mail.gmail.com>
	<AANLkTikb3M0+nHh1GmE7wjLcx=jgKdp67hUR1LiudMeM@mail.gmail.com>
	<AANLkTi=pn6o0SYoyWaP9VQarver0_k2XpX9QeXr74+Uy@mail.gmail.com>
	<AANLkTi=vQFGvOC+kWw+1qxfMQKMFt3YeC9O0V7X9jtwD@mail.gmail.com>
	<43195C0D-159E-4658-B8ED-6F6E76F37F61@illinois.edu>
Message-ID: <AANLkTikY4EHaHjku9pyW1NQuWpkc=EOjgioG=q7Fbqhp@mail.gmail.com>

Many thanks, Chris, that's exactly what I need.

Mingwei

2011/2/21 Chris Fields <cjfields at illinois.edu>:
> If this is a direct string match (no ambiguity), just use perl's index function:
>
> ? ? ? index STR,SUBSTR,POSITION
> ? ? ? index STR,SUBSTR
> ? ? ? ? ? ? ? The index function searches for one string within another, but
> ? ? ? ? ? ? ? without the wildcard-like behavior of a full regular-expression
> ? ? ? ? ? ? ? pattern match. ?It returns the position of the first occurrence
> ? ? ? ? ? ? ? of SUBSTR in STR at or after POSITION. ?If POSITION is omitted,
> ? ? ? ? ? ? ? starts searching from the beginning of the string. ?POSITION
> ? ? ? ? ? ? ? before the beginning of the string or after its end is treated
> ? ? ? ? ? ? ? as if it were the beginning or the end, respectively. ?POSITION
> ? ? ? ? ? ? ? and the return value are based at 0 (or whatever you've set the
> ? ? ? ? ? ? ? $[ variable to--but don't do that). ?If the substring is not
> ? ? ? ? ? ? ? found, "index" returns one less than the base, ordinarily "-1".
>
> Also see here:
>
> http://perlmeme.org/howtos/perlfunc/index_function.html
>
> chris
>
> On Feb 20, 2011, at 4:28 PM, Mingwei Min wrote:
>
>> Hi Dave,
>>
>> Thank you for your suggestion. when I said "too comple for this simple
>> job", I just thought that there might be some particular module that
>> could do this straightforwardly. I'll have a try of BLAST anyway.
>> Thank you.
>>
>> Mingwei
>>
>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>>> Hi Mingwei,
>>> Please remember to "reply all" so others on the mailing list can follow the
>>> conversation.
>>> Unless you have some way of other way of mapping the coordinates of the
>>> sequence with the post-translational sites to the coordinates of the full
>>> sequence, I think you'll have to do a similarity search of some form.
>>> BLAST may not be best for this, given that it's sloppy with the ends of an
>>> alignment, but there are plenty of options for BLAST that may improve your
>>> results. Again, you'll need to be specific about your problem for us to
>>> help. I don't what "too complex for this simple job" means. Is it too slow?
>>> Are you getting too many hits?
>>>
>>>
>>> Dave
>>>
>>>
>>> On Sun, Feb 20, 2011 at 22:35, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>>>
>>>> Hi Dave,
>>>>
>>>> Sorry for not making it clear. Yes, I just want to get the coordinates
>>>> of the post-translational sites out of a protein sequence. And what I
>>>> have now is the peptide sequence with marker on the post-translated
>>>> residue... what should i do to map them to the whole protein sequence
>>>> and get the coordinates? The only way I could come up with is blast.
>>>> But it seems to be too complex for this simple job....
>>>>
>>>> Many thanks,
>>>>
>>>> Mingwei
>>>>
>>>> 2011/2/20 Dave Messina <David.Messina at sbc.su.se>:
>>>>> Hi Mingwei,
>>>>> I'm not sure what you mean by "positioning" here. Do you want to get the
>>>>> coordinates of the post-translational sites out of a protein sequence
>>>>> database record? Or do you want to draw the post-translational sites on
>>>>> a
>>>>> picture of the protein sequence? Or something else entirely?
>>>>>
>>>>> Dave
>>>>>
>>>>>
>>>>>
>>>>> On Sat, Feb 19, 2011 at 15:53, Mingwei Min <mm809 at cam.ac.uk> wrote:
>>>>>>
>>>>>> Hi,
>>>>>>
>>>>>> I am trying to positioning some post-tranlational modification sites,
>>>>>> which is marked in peptides, in a full length protein sequence. Anyone
>>>>>> would be kind to tell me the model I could use for this?
>>>>>>
>>>>>> Many thanks
>>>>>>
>>>>>> Mingwei
>>>>>> _______________________________________________
>>>>>> Bioperl-l mailing list
>>>>>> Bioperl-l at lists.open-bio.org
>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>
>>>>>
>>>
>>>
>>
>>
>>

>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


From scott at scottcain.net  Mon Feb 21 15:30:39 2011
From: scott at scottcain.net (Scott Cain)
Date: Mon, 21 Feb 2011 15:30:39 -0500
Subject: [Bioperl-l] bio::Db::sam bioperl version
In-Reply-To: <AANLkTinsmhXUk6EK9CKVvZUnVvWwHU_CATUY6kCraC3V@mail.gmail.com>
References: <AANLkTinsmhXUk6EK9CKVvZUnVvWwHU_CATUY6kCraC3V@mail.gmail.com>
Message-ID: <AANLkTi=L2jqHX6R16=GfgDHPC+gJd34Je_fochnMHaOj@mail.gmail.com>

Hi Maria,

I have no idea of the version of perl is an issue, but I would more
likely expect versions of either Bio::DB::Sam or BioPerl are
different.  If you are running BioPerl from a git checkout for
example, it could easily vary between the two servers.  In past
experience with people having similar problems with GBrowse, that is
usually what the problem is.

Scott


On Mon, Feb 21, 2011 at 3:25 PM, Maria elena Sana <snamln at unife.it> wrote:
> Hi All,
> I'm using a perl script with Bioperl /Bio:DB::Sam object but it runs
> differently on two server on which there are two different perl
> version (5.8.8 and 5.10.1 respectively). On the first machine on which
> there is the 5.8.8 perl version, the script runs correctly, on the
> second it doesn't return errors but doesn't work perfectly. Any
> elucidation?
> I have specifically problem with calculation of query position in pileup
> routine (Bio::DB::Bam::PILEUP)
> Thanx a lot
>
> --
> Dott.ssa Maria Elena Sana
> Universit? di Ferrara
> Dipartimento di Morfologia ed Embriologia
> Via Fossato di Mortara, 70
> (Viale Eliporto presso CUBO)
> 44121 - Ferrara
> Italy Phone 0532-455851
> Mail mariaelena.sana at unife.it
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?? scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)? ? ? ? ? ? ? ? ? ?? 216-392-3087
Ontario Institute for Cancer Research


From comp_sea at yahoo.com  Wed Feb 23 11:21:01 2011
From: comp_sea at yahoo.com (Syed Mustafa Hussain)
Date: Wed, 23 Feb 2011 08:21:01 -0800 (PST)
Subject: [Bioperl-l] Can't locate object method "attributes" via package
	"Bio::SeqFeature::Generic" at
	/usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line 703,
	<DATA> line 192.
Message-ID: <700273.28443.qm@web33605.mail.mud.yahoo.com>

> Hi,
> 
> We had recently updated BioPerl and Bio::Graphics and found
> some applications not working properly. As an example simple
> graphics script like:
> 
> #####################################################
> 
> use Bio::Graphics::Panel;
> use Bio::SeqFeature::Generic;
> 
> use CGI;? ? ? # or any other CGI:: form
> handler/decoder
> 
> print "Content-type: text/html\n\n";
> 
> my $panel = Bio::Graphics::Panel->new(-length =>
> 700,
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ? ?
> ? ? ? -width? => 700
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ? ?
> ? ? ? );
> 
> my $track = $panel->add_track(-glyph? ?
> ???=> 'generic',
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ?
> -label? ? ???=> 1
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ? );
> 
> my $feature = Bio::SeqFeature::Generic->new(-start?
> ? ? ? => 1,
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? -end? ?
> ? ? ? => 400
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? ? ?
> ? ? ? ? ? ? );
> $track->add_feature($feature);
> 
> print "<html><body>TEST IMAGE:<br>";
> 
> open GRAPH, "> /srv/www/htdocs/tmp/test.png" or die
> "could not open image file";
> print GRAPH $panel->png;
> close(GRAPH);
> 
> print "<img src=\"/tmp/test.png\">";
> print "</body></html>";
> 
> #####################################################
> 
> is giving following error when I debug:
> 
> ? DB<1> n
> Can't locate object method "attributes" via package
> "Bio::SeqFeature::Generic" at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line
> 703.
>  at /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm
> line 703
> ? ? ? ?
> Bio::Graphics::Glyph::bgcolor('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)')
> called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line
> 1299
> ? ? ? ?
> Bio::Graphics::Glyph::filled_box('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 400, 7) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line
> 1471
> ? ? ? ?
> Bio::Graphics::Glyph::draw_component('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/generic.pm
> line 347
> ? ? ? ?
> Bio::Graphics::Glyph::generic::draw_component('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph.pm line
> 1050
> ? ? ? ?
> Bio::Graphics::Glyph::draw('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/generic.pm
> line 338
> ? ? ? ?
> Bio::Graphics::Glyph::generic::draw('Bio::Graphics::Glyph::generic=HASH(0x1d62f90)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Glyph/track.pm
> line 35
> ? ? ? ?
> Bio::Graphics::Glyph::track::draw('Bio::Graphics::Glyph::track=HASH(0x1d5bb10)',
> 'GD::Image=SCALAR(0x2002460)', 0, 0, 0, 1) called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Panel.pm line
> 588
> ? ? ? ?
> Bio::Graphics::Panel::gd('Bio::Graphics::Panel=HASH(0x1b1f6b0)')
> called at
> /usr/lib/perl5/site_perl/5.8.8/Bio/Graphics/Panel.pm line
> 1067
> ? ? ? ?
> Bio::Graphics::Panel::png('Bio::Graphics::Panel=HASH(0x1b1f6b0)')
> called at test.cgi line 37
> Debugged program terminated.? Use q to quit or R to
> restart,
> ? use o inhibit_exit to avoid stopping after program
> termination,
> ? h q, h R or h o to get additional info.
> 
> #####################################################
> 
> Is it because of some incompatibility between version of
> bioperl and bio::Graphics or some thing else?
> 
> Thanks,
> Mustafa.
> 
> 
>  
> ____________________________________________________________________________________
> Finding fabulous fares is fun.? 
> Let Yahoo! FareChase search your favorite travel sites to
> find flight and hotel bargains.
> http://farechase.yahoo.com/promo-generic-14795097
> 


      


From chapmanb at 50mail.com  Thu Feb 24 13:25:48 2011
From: chapmanb at 50mail.com (Brad Chapman)
Date: Thu, 24 Feb 2011 13:25:48 -0500
Subject: [Bioperl-l] BOSC 2011 topic organizers and Codefest
Message-ID: <20110224182548.GK20125@sobchak.mgh.harvard.edu>

Hi all;
This year the Bioinformatics Open Source Conference (BOSC) will be taking
place in Vienna, Austria on July 15-16th. This is a yearly opportunity for
open source bioinformatics developers to get together in person and discuss
on-going projects. Nomi Harris, Peter Rice and the other organizing committee
members are already hard at work planning for the conference:

http://www.open-bio.org/wiki/BOSC_2011

The call for abstracts opens next Monday, and extends through April
18th, and we've been brainstorming potential session topics. This
year we've tried to focus each of the sessions around a particular
biological problem or computational approach. We hope this will draw
some interesting parallels between work being done in different groups,
and encourage even more collaboration.

We are actively looking for community members who are interested in heading up
the organization of a topic. The general idea is to build a cohesive set of talks
within a session. How you'd like to do this is completely flexible but some of
the ideas we've been discussing are:

- Having a short introductory talk to provide an overview of an area, framing
  the different talks within this context.
- Forgoing individual question/answer and instead combining this time into a
  longer panel-style discussion with all of the speakers. This would help
  stimulate back and forth between the different projects and the
  audience.

If you are interested in a particular topic and would like to help with the
organization, please send an e-mail to the BOSC mailing list: 
bosc at lists.open-bio.org. We're also open to new topic suggestions, and will
look to add one or two more topics to our current list.

Finally, there will be a two day coding session prior to BOSC as a follow up
to last year's fun and productive Codefest:

http://www.open-bio.org/wiki/Codefest_2011

The Metalab, a unique hacker space in Vienna, has kindly agreed to host
us for the two days. If you are at all interested, please add your name
to the attendees list on the wiki. Since the Metalab organizers don't
know us personally, we'd like to demonstrate there is interest and that we'll
really show up with a bunch of bioinformatics hackers. More details will be in
the works as the summer draws closer.

Looking forward to the sound of music,
Brad

From dan.kortschak at adelaide.edu.au  Sun Feb 27 21:52:50 2011
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Mon, 28 Feb 2011 13:22:50 +1030
Subject: [Bioperl-l] Bio::DB::Sam
Message-ID: <1298861570.30299.66.camel@sueno>

Sorry for a post not strictly bioperl related, but I figured this forum
will get the best appropriate coverage and Lincoln is often here.

I have just tried to install Bio::DB::Sam on a new server I have been
tasked with setting up, but it fails to build with:

cpan[2]> install LDS/Bio-SamTools-1.27.tar.gz
Running make for L/LD/LDS/Bio-SamTools-1.27.tar.gz

  CPAN: checksum security checks disabled because Digest::SHA not installed.
  Please consider installing the Digest::SHA module.

Scanning cache /root/.cpan/build for sizes
............................................................................DONE
CPAN: Archive::Tar loaded ok (v1.76)
Bio-SamTools-1.27
Bio-SamTools-1.27/Changes
Bio-SamTools-1.27/LICENSE
Bio-SamTools-1.27/DISCLAIMER
Bio-SamTools-1.27/Build.PL
Bio-SamTools-1.27/typemap
Bio-SamTools-1.27/META.yml
Bio-SamTools-1.27/README
Bio-SamTools-1.27/MANIFEST
Bio-SamTools-1.27/bin
Bio-SamTools-1.27/bin/bamToGBrowse.pl
Bio-SamTools-1.27/lib
Bio-SamTools-1.27/lib/Bio
Bio-SamTools-1.27/lib/Bio/DB
Bio-SamTools-1.27/lib/Bio/DB/Sam.pm
Bio-SamTools-1.27/lib/Bio/DB/Sam.xs
Bio-SamTools-1.27/lib/Bio/DB/Sam
Bio-SamTools-1.27/lib/Bio/DB/Sam/SamToGBrowse.pm
Bio-SamTools-1.27/lib/Bio/DB/Sam/Constants.pm
Bio-SamTools-1.27/lib/Bio/DB/Sam/Segment.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam
Bio-SamTools-1.27/lib/Bio/DB/Bam/Alignment.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/Target.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/FetchIterator.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/PileupWrapper.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/AlignWrapper.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/Query.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/Pileup.pm
Bio-SamTools-1.27/lib/Bio/DB/Bam/ReadIterator.pm
Bio-SamTools-1.27/t
Bio-SamTools-1.27/t/01sam.t
Bio-SamTools-1.27/t/data
Bio-SamTools-1.27/t/data/ex1.sam.gz
Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam.bam
Bio-SamTools-1.27/t/data/ex1.bam
Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam
Bio-SamTools-1.27/t/data/00README.txt
Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam.sorted.bam
Bio-SamTools-1.27/t/data/ex1.fa
CPAN: File::Temp loaded ok (v0.22)

  CPAN.pm: Going to build L/LD/LDS/Bio-SamTools-1.27.tar.gz

This module requires samtools 0.1.9 or higher (samtools.sourceforge.net).
                                                                                                                                                                        Can't ioctl TIOCGETP: Invalid argument
Consider installing Term::ReadKey from CPAN site nearby
	at http://www.perl.com/CPAN
Or use
	perl -MCPAN -e shell
to reach CPAN. Falling back to 'stty'.
	If you do not want to see this warning, set PERL_READLINE_NOWARN
in your environment.
Please enter the location of the bam.h and compiled libbam.a files: /usr/local/src/samtools_latest

Found /usr/local/src/samtools_latest/bam.h and /usr/local/src/samtools_latest/libbam.a.
Creating new 'MYMETA.yml' with configuration results
Creating new 'Build' script for 'Bio-SamTools' version '1.27'
CPAN: Module::Build loaded ok (v0.3624)
Building Bio-SamTools
gcc -I/usr/local/src/samtools_latest -I/usr/lib64/perl5/CORE -DXS_VERSION="1.27" -DVERSION="1.27" -fPIC -D_IOLIB=2 -D_FILE_OFFSET_BITS=64 -Wformat=0 -c -D_REENTRANT -D_GNU_SOURCE -fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -g -pipe -Wall -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -fstack-protector --param=ssp-buffer-size=4 -m64 -mtune=generic -o lib/Bio/DB/Sam.o lib/Bio/DB/Sam.c
lib/Bio/DB/Sam.xs: In function ?invoke_pileup_callback_fun?:
lib/Bio/DB/Sam.xs:106: warning: unused variable ?pileup_obj?
lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam_open?:
lib/Bio/DB/Sam.c:530: warning: unused variable ?packname?
lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam_index_build?:
lib/Bio/DB/Sam.c:590: warning: unused variable ?packname?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam_sort_core?:
lib/Bio/DB/Sam.xs:306: warning: implicit declaration of function ?bam_sort_core?
lib/Bio/DB/Sam.c:614: warning: unused variable ?packname?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam_tell?:
lib/Bio/DB/Sam.xs:350: warning: format ?%llu? expects type ?long long unsigned int?, but argument 3 has type ?int64_t?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_qseq?:
lib/Bio/DB/Sam.xs:500: warning: operation on ?seq? may be undefined
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment__qscore?:
lib/Bio/DB/Sam.xs:514: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
/usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_aux?:
lib/Bio/DB/Sam.xs:599: warning: pointer targets in passing argument 2 of ?strncat? differ in signedness
/usr/include/bits/string3.h:151: note: expected ?const char * __restrict__? but argument is of type ?uint8_t *?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_aux_keys?:
lib/Bio/DB/Sam.xs:671: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
/usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_data?:
lib/Bio/DB/Sam.xs:694: warning: pointer targets in assignment differ in signedness
lib/Bio/DB/Sam.xs:697: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
/usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Header_view1?:
lib/Bio/DB/Sam.xs:900: warning: implicit declaration of function ?bam_view1?
lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam__Index_coverage?:
lib/Bio/DB/Sam.xs:983: warning: unused variable ?cov?
lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Pileup_is_refskip?:
lib/Bio/DB/Sam.xs:1078: error: ?bam_pileup1_t? has no member named ?is_refskip?
error building lib/Bio/DB/Sam.o from 'lib/Bio/DB/Sam.c' at /usr/local/share/perl5/ExtUtils/CBuilder/Base.pm line 175.
  LDS/Bio-SamTools-1.27.tar.gz
  ./Build -- NOT OK
Running Build test
  Can't test without successful make
Running Build install
  Make had returned bad status, install seems impossible
Failed during this command:
 LDS/Bio-SamTools-1.27.tar.gz                 : make NO

Has anyone else seen this problem or have any idea about how to resolve
it?

thanks
Dan Kortschak




From cjfields at illinois.edu  Sun Feb 27 22:08:46 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Sun, 27 Feb 2011 21:08:46 -0600
Subject: [Bioperl-l] Bio::DB::Sam
In-Reply-To: <1298861570.30299.66.camel@sueno>
References: <1298861570.30299.66.camel@sueno>
Message-ID: <05DFC1BC-A13E-4E89-8571-E9163BCB73F3@illinois.edu>

Check the README; my guess is you need to compile samtools with the -fPIC flag:

http://cpansearch.perl.org/src/LDS/Bio-SamTools-1.27/README

Could also be an out-of-date version of samtools itself, the latest Bio-Samtools requires v.0.1.9 or higher.

chris

On Feb 27, 2011, at 8:52 PM, Dan Kortschak wrote:

> Sorry for a post not strictly bioperl related, but I figured this forum
> will get the best appropriate coverage and Lincoln is often here.
> 
> I have just tried to install Bio::DB::Sam on a new server I have been
> tasked with setting up, but it fails to build with:
> 
> cpan[2]> install LDS/Bio-SamTools-1.27.tar.gz
> Running make for L/LD/LDS/Bio-SamTools-1.27.tar.gz
> 
>  CPAN: checksum security checks disabled because Digest::SHA not installed.
>  Please consider installing the Digest::SHA module.
> 
> Scanning cache /root/.cpan/build for sizes
> ............................................................................DONE
> CPAN: Archive::Tar loaded ok (v1.76)
> Bio-SamTools-1.27
> Bio-SamTools-1.27/Changes
> Bio-SamTools-1.27/LICENSE
> Bio-SamTools-1.27/DISCLAIMER
> Bio-SamTools-1.27/Build.PL
> Bio-SamTools-1.27/typemap
> Bio-SamTools-1.27/META.yml
> Bio-SamTools-1.27/README
> Bio-SamTools-1.27/MANIFEST
> Bio-SamTools-1.27/bin
> Bio-SamTools-1.27/bin/bamToGBrowse.pl
> Bio-SamTools-1.27/lib
> Bio-SamTools-1.27/lib/Bio
> Bio-SamTools-1.27/lib/Bio/DB
> Bio-SamTools-1.27/lib/Bio/DB/Sam.pm
> Bio-SamTools-1.27/lib/Bio/DB/Sam.xs
> Bio-SamTools-1.27/lib/Bio/DB/Sam
> Bio-SamTools-1.27/lib/Bio/DB/Sam/SamToGBrowse.pm
> Bio-SamTools-1.27/lib/Bio/DB/Sam/Constants.pm
> Bio-SamTools-1.27/lib/Bio/DB/Sam/Segment.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam
> Bio-SamTools-1.27/lib/Bio/DB/Bam/Alignment.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/Target.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/FetchIterator.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/PileupWrapper.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/AlignWrapper.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/Query.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/Pileup.pm
> Bio-SamTools-1.27/lib/Bio/DB/Bam/ReadIterator.pm
> Bio-SamTools-1.27/t
> Bio-SamTools-1.27/t/01sam.t
> Bio-SamTools-1.27/t/data
> Bio-SamTools-1.27/t/data/ex1.sam.gz
> Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam.bam
> Bio-SamTools-1.27/t/data/ex1.bam
> Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam
> Bio-SamTools-1.27/t/data/00README.txt
> Bio-SamTools-1.27/t/data/dm3_3R_4766911_4767130.sam.sorted.bam
> Bio-SamTools-1.27/t/data/ex1.fa
> CPAN: File::Temp loaded ok (v0.22)
> 
>  CPAN.pm: Going to build L/LD/LDS/Bio-SamTools-1.27.tar.gz
> 
> This module requires samtools 0.1.9 or higher (samtools.sourceforge.net).
>                                                                                                                                                                        Can't ioctl TIOCGETP: Invalid argument
> Consider installing Term::ReadKey from CPAN site nearby
> 	at http://www.perl.com/CPAN
> Or use
> 	perl -MCPAN -e shell
> to reach CPAN. Falling back to 'stty'.
> 	If you do not want to see this warning, set PERL_READLINE_NOWARN
> in your environment.
> Please enter the location of the bam.h and compiled libbam.a files: /usr/local/src/samtools_latest
> 
> Found /usr/local/src/samtools_latest/bam.h and /usr/local/src/samtools_latest/libbam.a.
> Creating new 'MYMETA.yml' with configuration results
> Creating new 'Build' script for 'Bio-SamTools' version '1.27'
> CPAN: Module::Build loaded ok (v0.3624)
> Building Bio-SamTools
> gcc -I/usr/local/src/samtools_latest -I/usr/lib64/perl5/CORE -DXS_VERSION="1.27" -DVERSION="1.27" -fPIC -D_IOLIB=2 -D_FILE_OFFSET_BITS=64 -Wformat=0 -c -D_REENTRANT -D_GNU_SOURCE -fno-strict-aliasing -pipe -fstack-protector -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -g -pipe -Wall -Wp,-D_FORTIFY_SOURCE=2 -fexceptions -fstack-protector --param=ssp-buffer-size=4 -m64 -mtune=generic -o lib/Bio/DB/Sam.o lib/Bio/DB/Sam.c
> lib/Bio/DB/Sam.xs: In function ?invoke_pileup_callback_fun?:
> lib/Bio/DB/Sam.xs:106: warning: unused variable ?pileup_obj?
> lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam_open?:
> lib/Bio/DB/Sam.c:530: warning: unused variable ?packname?
> lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam_index_build?:
> lib/Bio/DB/Sam.c:590: warning: unused variable ?packname?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam_sort_core?:
> lib/Bio/DB/Sam.xs:306: warning: implicit declaration of function ?bam_sort_core?
> lib/Bio/DB/Sam.c:614: warning: unused variable ?packname?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam_tell?:
> lib/Bio/DB/Sam.xs:350: warning: format ?%llu? expects type ?long long unsigned int?, but argument 3 has type ?int64_t?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_qseq?:
> lib/Bio/DB/Sam.xs:500: warning: operation on ?seq? may be undefined
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment__qscore?:
> lib/Bio/DB/Sam.xs:514: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
> /usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_aux?:
> lib/Bio/DB/Sam.xs:599: warning: pointer targets in passing argument 2 of ?strncat? differ in signedness
> /usr/include/bits/string3.h:151: note: expected ?const char * __restrict__? but argument is of type ?uint8_t *?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_aux_keys?:
> lib/Bio/DB/Sam.xs:671: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
> /usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Alignment_data?:
> lib/Bio/DB/Sam.xs:694: warning: pointer targets in assignment differ in signedness
> lib/Bio/DB/Sam.xs:697: warning: pointer targets in passing argument 2 of ?Perl_newSVpv? differ in signedness
> /usr/lib64/perl5/CORE/proto.h:2210: note: expected ?const char *? but argument is of type ?uint8_t *?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Header_view1?:
> lib/Bio/DB/Sam.xs:900: warning: implicit declaration of function ?bam_view1?
> lib/Bio/DB/Sam.c: In function ?XS_Bio__DB__Bam__Index_coverage?:
> lib/Bio/DB/Sam.xs:983: warning: unused variable ?cov?
> lib/Bio/DB/Sam.xs: In function ?XS_Bio__DB__Bam__Pileup_is_refskip?:
> lib/Bio/DB/Sam.xs:1078: error: ?bam_pileup1_t? has no member named ?is_refskip?
> error building lib/Bio/DB/Sam.o from 'lib/Bio/DB/Sam.c' at /usr/local/share/perl5/ExtUtils/CBuilder/Base.pm line 175.
>  LDS/Bio-SamTools-1.27.tar.gz
>  ./Build -- NOT OK
> Running Build test
>  Can't test without successful make
> Running Build install
>  Make had returned bad status, install seems impossible
> Failed during this command:
> LDS/Bio-SamTools-1.27.tar.gz                 : make NO
> 
> Has anyone else seen this problem or have any idea about how to resolve
> it?
> 
> thanks
> Dan Kortschak
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From dan.kortschak at adelaide.edu.au  Sun Feb 27 22:30:14 2011
From: dan.kortschak at adelaide.edu.au (Dan Kortschak)
Date: Mon, 28 Feb 2011 14:00:14 +1030
Subject: [Bioperl-l] Bio::DB::Sam [resolved]
In-Reply-To: <05DFC1BC-A13E-4E89-8571-E9163BCB73F3@illinois.edu>
References: <1298861570.30299.66.camel@sueno>
	<05DFC1BC-A13E-4E89-8571-E9163BCB73F3@illinois.edu>
Message-ID: <1298863814.30299.82.camel@sueno>

Version discordance - it's been a long time since I built this. Thanks
Chris.

Dan

On Sun, 2011-02-27 at 21:08 -0600, Chris Fields wrote:
> Check the README; my guess is you need to compile samtools with the -fPIC flag:
> 
> http://cpansearch.perl.org/src/LDS/Bio-SamTools-1.27/README
> 
> Could also be an out-of-date version of samtools itself, the latest Bio-Samtools requires v.0.1.9 or higher.
> 
> chris



From awitney at sgul.ac.uk  Mon Feb 28 06:06:42 2011
From: awitney at sgul.ac.uk (Adam Witney)
Date: Mon, 28 Feb 2011 11:06:42 +0000
Subject: [Bioperl-l] building NGS pipeline
Message-ID: <86D567CE-1735-4D85-B40F-B67823749FB7@sgul.ac.uk>

Hi,

I'm trying to put together a set of steps to runs some analysis on NGS data we have. I have found modules that wrap alignment software such as bowtie/bwa/maq, but are there any packages to calculate RPKM's etc? what are people using for this?

thanks for any help

adam

From sdavis2 at mail.nih.gov  Mon Feb 28 07:04:32 2011
From: sdavis2 at mail.nih.gov (Sean Davis)
Date: Mon, 28 Feb 2011 07:04:32 -0500
Subject: [Bioperl-l] building NGS pipeline
In-Reply-To: <86D567CE-1735-4D85-B40F-B67823749FB7@sgul.ac.uk>
References: <86D567CE-1735-4D85-B40F-B67823749FB7@sgul.ac.uk>
Message-ID: <AANLkTi=eU0f=GuHE=zLfLoc5LhaiHBG_A2mjmMybQeNH@mail.gmail.com>

On Mon, Feb 28, 2011 at 6:06 AM, Adam Witney <awitney at sgul.ac.uk> wrote:

> Hi,
>
> I'm trying to put together a set of steps to runs some analysis on NGS data
> we have. I have found modules that wrap alignment software such as
> bowtie/bwa/maq, but are there any packages to calculate RPKM's etc? what are
> people using for this?
>
>
scripture, cufflinks/cuffdiff, bioconductor (GenomicFeatures package, for
example), ERANGE (wold lab), and several others.  I don't know of perl
wrappers for these, but they are all command-line applications, generally
speaking.

This is an interesting site to follow for RNA-seq analysis and applications:

http://rna-seqblog.com/

Sean

From cjfields at illinois.edu  Mon Feb 28 10:03:18 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 28 Feb 2011 09:03:18 -0600
Subject: [Bioperl-l] building NGS pipeline
In-Reply-To: <AANLkTi=eU0f=GuHE=zLfLoc5LhaiHBG_A2mjmMybQeNH@mail.gmail.com>
References: <86D567CE-1735-4D85-B40F-B67823749FB7@sgul.ac.uk>
	<AANLkTi=eU0f=GuHE=zLfLoc5LhaiHBG_A2mjmMybQeNH@mail.gmail.com>
Message-ID: <0FF71A5D-F5F6-4AAD-9501-4F4911DB40D8@illinois.edu>

On Feb 28, 2011, at 6:04 AM, Sean Davis wrote:

> On Mon, Feb 28, 2011 at 6:06 AM, Adam Witney <awitney at sgul.ac.uk> wrote:
> 
>> Hi,
>> 
>> I'm trying to put together a set of steps to runs some analysis on NGS data
>> we have. I have found modules that wrap alignment software such as
>> bowtie/bwa/maq, but are there any packages to calculate RPKM's etc? what are
>> people using for this?
>> 
>> 
> scripture, cufflinks/cuffdiff, bioconductor (GenomicFeatures package, for
> example), ERANGE (wold lab), and several others.  I don't know of perl
> wrappers for these, but they are all command-line applications, generally
> speaking.
> 
> This is an interesting site to follow for RNA-seq analysis and applications:
> 
> http://rna-seqblog.com/
> 
> Sean

BioPerl does have wrappers and interfaces for some packages, particularly Lincoln's Bio::DB::Sam (samtools package) and wrappers for bowtie, tophat, and bwa.  Locally, for comparative gene expression analyses we use bioconductor (many packages to choose from) as well as the command-line tools Sean mentions.

chris 

From wangwl at mail.whu.edu.cn  Mon Feb 28 09:57:19 2011
From: wangwl at mail.whu.edu.cn (Wenliang Wang)
Date: Mon, 28 Feb 2011 22:57:19 +0800
Subject: [Bioperl-l]  Bio::Tools::Run::TribeMCL
Message-ID: <000d01cbd757$d03aeb80$70b0c280$@whu.edu.cn>

Hello,

         I??m trying to use TribeMCL to cluster a group of protein sequence
with the following code:

 

use Bio::Tools::Run::TribeMCL;

use Bio::SearchIO;

 

my $usage = "run_tribe.pl blastfile";

my $blastfile = $ARGV[0];

 

my $sio = Bio::SearchIO->new(-format=>'blast',

                        -file=>$blastfile);

 

my @params=('inputtype'=>'searchio',I=>'2.0',

        'mcl'=>'/home/sean/tribemcl/src/shmcl/mcl',

        'matrix'=>'/home/sean/tribemcl/src/contrib/tribe/tribe-matrix');

 

my $fact = Bio::Tools::Run::TribeMCL->new(@params);

 

my $fam = $fact->run($sio);

 

for (my $i = 0; $i <scalar(@{$fam}); $i++){

        print "Cluster $i \t ".scalar(@{$fam->[$i]})." members\n";

        foreach my $member (@{$fam->[$i]}){

                print "\t$member\n";

        }

}

 

But it came out with some wrong message:

 

------------- EXCEPTION: Bio::Root::Exception -------------

MSG: Need inputs for running tribe mcl, nothing provided

STACK: Error::throw

STACK: Bio::Root::Root::throw
/usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:368

STACK: Bio::Tools::Run::TribeMCL::_setup_input /usr/lib/perl5/site_perl/5.8.
8/Bio/Tools/Run/TribeMCL.pm:765

STACK: Bio::Tools::Run::TribeMCL::run
/usr/lib/perl5/site_perl/5.8.8/Bio/Tools/Run/TribeMCL.pm:346

STACK: test.pl:16

 

 

I??m wondering if you can help me with this.

 

Sorry for the long email.

 

 

Best regards??

 

Wenliang Wang

College of Life Science,Wuhan University,Wuhan,Hubei,China.

email:wangwl at mail.whu.edu.cn

MSN:lvxiaopohai at hotmail.com

 



From cjfields at illinois.edu  Mon Feb 28 10:43:33 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 28 Feb 2011 09:43:33 -0600
Subject: [Bioperl-l] Bio::Tools::Run::TribeMCL
In-Reply-To: <000d01cbd757$d03aeb80$70b0c280$@whu.edu.cn>
References: <000d01cbd757$d03aeb80$70b0c280$@whu.edu.cn>
Message-ID: <E6B5C751-5AC6-49A1-90B7-32E484B48E94@illinois.edu>

Not sure of it's status , but I don't think TribeMCL is maintained anymore (maybe we should deprecate it?).  You should really look at other tools besides TribeMCL, in particular OrthoMCL, which is essentially a more up-to-date TribeMCL.  Also, a recent set of posts mentioned other tools such as blastclust (comes with NCBI's BLAST tools).

chris

On Feb 28, 2011, at 8:57 AM, Wenliang Wang wrote:

> Hello,
> 
>         I??m trying to use TribeMCL to cluster a group of protein sequence
> with the following code:
> 
> 
> 
> use Bio::Tools::Run::TribeMCL;
> 
> use Bio::SearchIO;
> 
> 
> 
> my $usage = "run_tribe.pl blastfile";
> 
> my $blastfile = $ARGV[0];
> 
> 
> 
> my $sio = Bio::SearchIO->new(-format=>'blast',
> 
>                        -file=>$blastfile);
> 
> 
> 
> my @params=('inputtype'=>'searchio',I=>'2.0',
> 
>        'mcl'=>'/home/sean/tribemcl/src/shmcl/mcl',
> 
>        'matrix'=>'/home/sean/tribemcl/src/contrib/tribe/tribe-matrix');
> 
> 
> 
> my $fact = Bio::Tools::Run::TribeMCL->new(@params);
> 
> 
> 
> my $fam = $fact->run($sio);
> 
> 
> 
> for (my $i = 0; $i <scalar(@{$fam}); $i++){
> 
>        print "Cluster $i \t ".scalar(@{$fam->[$i]})." members\n";
> 
>        foreach my $member (@{$fam->[$i]}){
> 
>                print "\t$member\n";
> 
>        }
> 
> }
> 
> 
> 
> But it came out with some wrong message:
> 
> 
> 
> ------------- EXCEPTION: Bio::Root::Exception -------------
> 
> MSG: Need inputs for running tribe mcl, nothing provided
> 
> STACK: Error::throw
> 
> STACK: Bio::Root::Root::throw
> /usr/lib/perl5/site_perl/5.8.8/Bio/Root/Root.pm:368
> 
> STACK: Bio::Tools::Run::TribeMCL::_setup_input /usr/lib/perl5/site_perl/5.8.
> 8/Bio/Tools/Run/TribeMCL.pm:765
> 
> STACK: Bio::Tools::Run::TribeMCL::run
> /usr/lib/perl5/site_perl/5.8.8/Bio/Tools/Run/TribeMCL.pm:346
> 
> STACK: test.pl:16
> 
> 
> 
> 
> 
> I??m wondering if you can help me with this.
> 
> 
> 
> Sorry for the long email.
> 
> 
> 
> 
> 
> Best regards??
> 
> 
> 
> Wenliang Wang
> 
> College of Life Science,Wuhan University,Wuhan,Hubei,China.
> 
> email:wangwl at mail.whu.edu.cn
> 
> MSN:lvxiaopohai at hotmail.com
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From lincoln.stein at gmail.com  Mon Feb 28 13:05:44 2011
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Mon, 28 Feb 2011 13:05:44 -0500
Subject: [Bioperl-l] Next release?
Message-ID: <AANLkTinBKXHs6peoUoan0aCM4JmZd2CC2TcPXdTgNdV3@mail.gmail.com>

Hi,

There are some bug fixes in Bio::DB::SeqFeature that I'd like to release to
CPAN. What are the plans for the next CPAN release of BioPerl?

Lincoln


-- 
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa at oicr.on.ca>

From cjfields at illinois.edu  Mon Feb 28 13:16:10 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 28 Feb 2011 12:16:10 -0600
Subject: [Bioperl-l] Next release?
In-Reply-To: <AANLkTinBKXHs6peoUoan0aCM4JmZd2CC2TcPXdTgNdV3@mail.gmail.com>
References: <AANLkTinBKXHs6peoUoan0aCM4JmZd2CC2TcPXdTgNdV3@mail.gmail.com>
Message-ID: <57651D25-6D5D-40EB-A336-D565076626E5@illinois.edu>

I've been holding off for some fixes going on in Bio::Tree, but if it's pressing we can push one out sooner.  Next few weeks?

chris

On Feb 28, 2011, at 12:05 PM, Lincoln Stein wrote:

> Hi,
> 
> There are some bug fixes in Bio::DB::SeqFeature that I'd like to release to
> CPAN. What are the plans for the next CPAN release of BioPerl?
> 
> Lincoln
> 
> 
> -- 
> Lincoln D. Stein
> Director, Informatics and Biocomputing Platform
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Renata Musa <Renata.Musa at oicr.on.ca>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l



From lincoln.stein at gmail.com  Mon Feb 28 13:19:46 2011
From: lincoln.stein at gmail.com (Lincoln Stein)
Date: Mon, 28 Feb 2011 13:19:46 -0500
Subject: [Bioperl-l] Next release?
In-Reply-To: <57651D25-6D5D-40EB-A336-D565076626E5@illinois.edu>
References: <AANLkTinBKXHs6peoUoan0aCM4JmZd2CC2TcPXdTgNdV3@mail.gmail.com>
	<57651D25-6D5D-40EB-A336-D565076626E5@illinois.edu>
Message-ID: <AANLkTik2u+QP_WneUaokC=-ijE+WPgx4pfxK9=ZeNoL_@mail.gmail.com>

It would be great to have a CPAN release by the end of March. Is that
doable?

Lincoln

On Mon, Feb 28, 2011 at 1:16 PM, Chris Fields <cjfields at illinois.edu> wrote:

> I've been holding off for some fixes going on in Bio::Tree, but if it's
> pressing we can push one out sooner.  Next few weeks?
>
> chris
>
> On Feb 28, 2011, at 12:05 PM, Lincoln Stein wrote:
>
> > Hi,
> >
> > There are some bug fixes in Bio::DB::SeqFeature that I'd like to release
> to
> > CPAN. What are the plans for the next CPAN release of BioPerl?
> >
> > Lincoln
> >
> >
> > --
> > Lincoln D. Stein
> > Director, Informatics and Biocomputing Platform
> > Ontario Institute for Cancer Research
> > 101 College St., Suite 800
> > Toronto, ON, Canada M5G0A3
> > 416 673-8514
> > Assistant: Renata Musa <Renata.Musa at oicr.on.ca>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>


-- 
Lincoln D. Stein
Director, Informatics and Biocomputing Platform
Ontario Institute for Cancer Research
101 College St., Suite 800
Toronto, ON, Canada M5G0A3
416 673-8514
Assistant: Renata Musa <Renata.Musa at oicr.on.ca>

From cjfields at illinois.edu  Mon Feb 28 13:23:40 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 28 Feb 2011 12:23:40 -0600
Subject: [Bioperl-l] Next release?
In-Reply-To: <AANLkTik2u+QP_WneUaokC=-ijE+WPgx4pfxK9=ZeNoL_@mail.gmail.com>
References: <AANLkTinBKXHs6peoUoan0aCM4JmZd2CC2TcPXdTgNdV3@mail.gmail.com>
	<57651D25-6D5D-40EB-A336-D565076626E5@illinois.edu>
	<AANLkTik2u+QP_WneUaokC=-ijE+WPgx4pfxK9=ZeNoL_@mail.gmail.com>
Message-ID: <D3D24823-FF19-491D-9175-597661285B72@illinois.edu>

Sure, let's aim for that or sooner.  Deadlines are always an incentive :)

Let's see how master looks; I have a 1.6.2 branch I am merging things to, I can pull in any changes and push out an initial test release sometime this week.

chris

On Feb 28, 2011, at 12:19 PM, Lincoln Stein wrote:

> It would be great to have a CPAN release by the end of March. Is that doable?
> 
> Lincoln
> 
> On Mon, Feb 28, 2011 at 1:16 PM, Chris Fields <cjfields at illinois.edu> wrote:
> I've been holding off for some fixes going on in Bio::Tree, but if it's pressing we can push one out sooner.  Next few weeks?
> 
> chris
> 
> On Feb 28, 2011, at 12:05 PM, Lincoln Stein wrote:
> 
> > Hi,
> >
> > There are some bug fixes in Bio::DB::SeqFeature that I'd like to release to
> > CPAN. What are the plans for the next CPAN release of BioPerl?
> >
> > Lincoln
> >
> >
> > --
> > Lincoln D. Stein
> > Director, Informatics and Biocomputing Platform
> > Ontario Institute for Cancer Research
> > 101 College St., Suite 800
> > Toronto, ON, Canada M5G0A3
> > 416 673-8514
> > Assistant: Renata Musa <Renata.Musa at oicr.on.ca>
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> 
> 
> -- 
> Lincoln D. Stein
> Director, Informatics and Biocomputing Platform
> Ontario Institute for Cancer Research
> 101 College St., Suite 800
> Toronto, ON, Canada M5G0A3
> 416 673-8514
> Assistant: Renata Musa <Renata.Musa at oicr.on.ca>



From cjfields at illinois.edu  Mon Feb 28 13:59:06 2011
From: cjfields at illinois.edu (Chris Fields)
Date: Mon, 28 Feb 2011 12:59:06 -0600
Subject: [Bioperl-l] Plans for the next release (and beyond)
Message-ID: <11F5BA8C-D4F4-419B-870B-D4B5180F4D7D@illinois.edu>

There is a pressing need to get a 1.6.2 core release out as soon as possible, based on Lincoln's need to get the latest Bio::DB::SeqFeature fixes out to CPAN.  We had been waiting on a few changes are currently lingering on branches that could be merged in when necessary (the GMOD hackathon changes primary among them), but the need isn't immediately pressing to merge them back in prior to a release.  I would also like to avoid the 'commit-frenzy' that sometimes occurs prior to a release if possible, particularly cutting-edge changes, etc.  

My suggestion is, after this release, we start actually working on a few items that will very likely effectively end the 1.6.x release series.

1) Make packaging releases a much less painful process.  Tools already exist to do this (Dist::Zilla, ShipIt), we should definitely take advantage of them.

2) Work on de-monolithizing BioPerl, maybe towards a 1.7 or even a 2.0 release.  We've long talked about doing so, I talked about it at the last BOSC meeting, 'bout time to actually work on it.  This will also address some of the problems Lincoln has been facing with the rapid development cycle of GBrowse v2 vs BioPerl, as was previously experienced with Bio::Graphics, which is a good example of how development of BioPerl-related modules can occur successfully outside the core.

3) I would like to work on moving the HOWTO's and other relevant documentation (Tutorial) back into the distributions, maybe in a particular namespace (Bio::Manual or similar).  The reason is simple: maintaining possibly discordant versions of documentation is unsustainable.  We could possibly set up a way of converting POD->wiki for on-line documentation, but I would like the documentation be tied to the version of the code it comes with, and the only easy way to do so is to package them all together.

Any others?  Concerns, etc?  

chris