[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

kakchingtabam pawankumar sharma pawan.mani2 at gmail.com
Fri Jan 13 11:46:55 EST 2012


Hi,
             Using Bio::SearchIO module I am parsing the following Blast result.
I have used the option- $hsp->strand('query').

But I cannot get detail of alignment.

I need to know if my hit is forward (Strand = Plus / Plus)
or reverse ( Strand = Plus / Minus)...
 Can anyone help me to get report as Plus or Minus for query  or hit.

thanks in advanced.

With regards,
Pawan



BLASTN 2.2.18 [Dec-23-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 000013_c10079-9984
         (50 letters)

Database: Cyano_Probe.fasta
           4760 sequences; 238,000 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

000013_c10079-9984
100   7e-024
002619_2689273-2690037
24   0.36
001126_c1123720-1123385
24   0.36
003211_c3326737-3326480
22   1.4
002415_2471082-2471420
22   1.4
002269_2321276-2322463
22   1.4
001328_c1326535-1326164
22   1.4

>000013_c10079-9984
          Length = 50

 Score = 99.6 bits (50), Expect = 7e-024
 Identities = 50/50 (100%)
 Strand = Plus / Plus


Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
          ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50



More information about the Bioperl-l mailing list