[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.
Frank Schwach
fs5 at sanger.ac.uk
Mon Jan 16 04:32:03 EST 2012
Hi Pawan ,
Please always "reply to all", so that you keep the discussion on the
bioperl mailing list and more people can help you.
What you need is a very basic Perl command. I could give you the code
but I think you get more out of it if you experiment with it on your own
because it is very fundamental. I'll point you in the right direction:
you want an if-then-else conditional construct.
Perl's documentation about this is here:
http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
if strand is 1 you want to print "PLUS" else if it is -1 you want to
print "MINUS", or else you might want to print "no strand" or something,
or even treat it as an error and make the script abort.
Give it a go and let us know if you need help. For basic (non-bio) Perl
question, please also check out the community at http://www.perlmonks.org/.
Hope that helps,
Frank
On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
> Hi frank,
>
> Thanks for your kind reply.
> I could get the vale for query as 1 value if it is plus.
> and for hit = -1 if it is minus.
> But i would like to print out as PLUS or MINUS not 1 or -1 my friend.
>
> you can see my code as below:
>
> while ( my $result = $searchio->next_result() ) {
> my $QueryName = $result->query_name(), my $QueryDescript =
> $result->query_description();
> my $QueryLength = $result->query_length;
> my $NoHits = $result->num_hits;
>
> while( my $hit = $result->next_hit ) {
> my $HitName = $hit->name();
> my $HitDescrip = $hit->description();
> my $HitLength = $hit->length;
> my $Score = $hit->raw_score();
> my $Bits = $hit->bits;
>
> my $hsp = $hit->next_hsp; # Only check first (= best) hsp
> my $Evalue = $hsp->evalue();
> my $AlnLen = $hsp->num_identical();
> my $TotalLen = $hsp->hsp_length;
> my $QueryStrand = $hsp->strand('query');
> my $HitStrand = $hsp->strand('hit');
>
> if($Evalue< $cutoff){
> print "$QueryName $QueryDescript\t";
> print "$QueryLength\t";
> print "$NoHits\t";
> print "$HitName $HitDescrip\t";
> print "$HitLength\t";
> print "$Score\t";
> print "$Bits\t";
> print "$Evalue\t";
> print "$AlnLen\t";
> print "$TotalLen\t";
> print "$QueryStrand\t";
> print "$HitStrand\n";
> }
> }
> print "\n";
> }
>
>
> This is a part of my code.
>
> i have blastn report as below:
>
> BLASTN 2.2.18 [Mar-02-2008]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs", Nucleic Acids Res. 25:3389-3402.
>
> Query= ORB_1210001_hsa-miR-548aa#5_1
> (24 letters)
>
> Database: hsa-mmu-rno_miRNA.fa
> 3524 sequences; 76,424 total letters
>
> Searching..................................................done
>
>
>
> Score E
> Sequences producing significant alignments: (bits) Value
>
> hsa-miR-548aa
> 48 2e-009
> hsa-miR-548d-5p
> 36 9e-006
> hsa-miR-548b-5p
> 36 9e-006
> hsa-miR-548z
> 34 3e-005
> hsa-miR-548q
> 30 5e-004
> hsa-miR-548n
> 30 5e-004
> hsa-miR-548ab
> 28 0.002
> hsa-miR-548v
> 28 0.002
> hsa-miR-548c-5p
> 28 0.002
> hsa-miR-548ag
> 26 0.008
> hsa-miR-548u
> 26 0.008
> hsa-miR-548c-3p
> 26 0.008
> hsa-miR-603
> 26 0.008
> hsa-miR-548a-3p
> 26 0.008
> hsa-miR-548ac
> 24 0.033
> hsa-miR-548an
> 22 0.13
> hsa-miR-548aj
> 22 0.13
> hsa-miR-548i
> 22 0.13
> hsa-miR-548g
> 22 0.13
> hsa-miR-548j
> 22 0.13
> hsa-miR-548a-5p
> 22 0.13
>
>> hsa-miR-548aa
> Length = 25
>
> Score = 48.1 bits (24), Expect = 2e-009
> Identities = 24/24 (100%)
> Strand = Plus / Minus
>
>
> Query: 1 tggtgcaaaagtaattgtggtttt 24
> ||||||||||||||||||||||||
> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>
>
>> hsa-miR-548d-5p
> Length = 22
>
> Score = 36.2 bits (18), Expect = 9e-006
> Identities = 18/18 (100%)
> Strand = Plus / Plus
>
>
> Query: 7 aaaagtaattgtggtttt 24
> ||||||||||||||||||
> Sbjct: 1 aaaagtaattgtggtttt 18
>
>
>
> in this result i could not parse my code. i think my code does not
> accept the Query header that is
> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast output.
>
> kindly help me out.
>
> with regards,
> Pawan.
>
>
> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk> wrote:
>> Hi Pawan,
>>
>> Can you show your code? Is it basically following the structure shown in
>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>> ?
>>
>> If that is the case
>>
>> $hsp->strand('query')
>>
>>
>> is exactly what you need.
>> To check if hit and query are on different strands you can do:
>>
>> if ( $hsp->strand('query')
>> * $hsp->strand('hit') == -1){
>>
>> # do whatever you need to do if they are on opposite strands
>>
>> }
>>
>> Hope that helps
>>
>> Frank
>>
>>
>>
>>
>>
>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>> Hi,
>>> Using Bio::SearchIO module I am parsing the following Blast
>>> result.
>>> I have used the option- $hsp->strand('query').
>>>
>>> But I cannot get detail of alignment.
>>>
>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>> or reverse ( Strand = Plus / Minus)...
>>> Can anyone help me to get report as Plus or Minus for query or hit.
>>>
>>> thanks in advanced.
>>>
>>> With regards,
>>> Pawan
>>>
>>>
>>>
>>> BLASTN 2.2.18 [Dec-23-2011]
>>>
>>>
>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>>> programs", Nucleic Acids Res. 25:3389-3402.
>>>
>>> Query= 000013_c10079-9984
>>> (50 letters)
>>>
>>> Database: Cyano_Probe.fasta
>>> 4760 sequences; 238,000 total letters
>>>
>>> Searching..................................................done
>>>
>>>
>>>
>>> Score
>>> E
>>> Sequences producing significant alignments: (bits)
>>> Value
>>>
>>> 000013_c10079-9984
>>> 100 7e-024
>>> 002619_2689273-2690037
>>> 24 0.36
>>> 001126_c1123720-1123385
>>> 24 0.36
>>> 003211_c3326737-3326480
>>> 22 1.4
>>> 002415_2471082-2471420
>>> 22 1.4
>>> 002269_2321276-2322463
>>> 22 1.4
>>> 001328_c1326535-1326164
>>> 22 1.4
>>>
>>>> 000013_c10079-9984
>>> Length = 50
>>>
>>> Score = 99.6 bits (50), Expect = 7e-024
>>> Identities = 50/50 (100%)
>>> Strand = Plus / Plus
>>>
>>>
>>> Query: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>> ||||||||||||||||||||||||||||||||||||||||||||||||||
>>> Sbjct: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>> --
>> The Wellcome Trust Sanger Institute is operated by Genome Research Limited,
>> a charity registered in England with number 1021457 and a company registered
>> in England with number 2742969, whose registered office is 215 Euston Road,
>> London, NW1 2BE.
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
More information about the Bioperl-l
mailing list