[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

kakchingtabam pawankumar sharma pawan.mani2 at gmail.com
Mon Jan 16 10:14:21 EST 2012


So By using the if else conditon function, I have solve Frank.
I mean is there anyway in bioperl we can get directly using other
module! I hope u got it!


So my second Question have not replied that is

i have blastn report as below:

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= ORB_1210001_hsa-miR-548aa#5_1
        (24 letters)

Database: hsa-mmu-rno_miRNA.fa
          3524 sequences; 76,424 total letters

Searching..................................................done



                                                                Score    E
Sequences producing significant alignments:                      (bits) Value

hsa-miR-548aa
48   2e-009
hsa-miR-548d-5p
36   9e-006
hsa-miR-548b-5p
36   9e-006
hsa-miR-548z
34   3e-005
hsa-miR-548q
30   5e-004
hsa-miR-548n
30   5e-004
hsa-miR-548ab
28   0.002
hsa-miR-548v
28   0.002
hsa-miR-548c-5p
28   0.002
hsa-miR-548ag
26   0.008
hsa-miR-548u
26   0.008
hsa-miR-548c-3p
26   0.008
hsa-miR-603
26   0.008
hsa-miR-548a-3p
26   0.008
hsa-miR-548ac
24   0.033
hsa-miR-548an
22   0.13
hsa-miR-548aj
22   0.13
hsa-miR-548i
22   0.13
hsa-miR-548g
22   0.13
hsa-miR-548j
22   0.13
hsa-miR-548a-5p
22   0.13

>hsa-miR-548aa
         Length = 25

 Score = 48.1 bits (24), Expect = 2e-009
 Identities = 24/24 (100%)
 Strand = Plus / Minus


Query: 1  tggtgcaaaagtaattgtggtttt 24
         ||||||||||||||||||||||||
Sbjct: 25 tggtgcaaaagtaattgtggtttt 2


>hsa-miR-548d-5p
         Length = 22

 Score = 36.2 bits (18), Expect = 9e-006
 Identities = 18/18 (100%)
 Strand = Plus / Plus


Query: 7  aaaagtaattgtggtttt 24
         ||||||||||||||||||
Sbjct: 1  aaaagtaattgtggtttt 18



in this result i could not parse my code. i think my code does not
accept the Query header that is
"ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast output.

kindly help me out.

with regards,
Pawan.

On 1/16/12, Frank Schwach <fs5 at sanger.ac.uk> wrote:
> Hi Pawan ,
>
> Please always "reply to all", so that you keep the discussion on the
> bioperl mailing list and more people can help you.
> What you need is a very basic Perl command. I could give you the code
> but I think you get more out of it if you experiment with it on your own
> because it is very fundamental. I'll point you in the right direction:
> you want an if-then-else conditional construct.
>
> Perl's documentation about this is here:
> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
>
> if strand is 1 you want to print "PLUS" else if it is -1 you want to
> print "MINUS", or else you might want to print "no strand" or something,
> or even treat it as an error and make the script abort.
>
> Give it a go and let us know if you need help. For basic (non-bio) Perl
> question, please also check out the community at http://www.perlmonks.org/.
>
> Hope that helps,
>
> Frank
>
>
> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>> Hi frank,
>>
>> Thanks for your kind reply.
>> I could get the vale for query as 1 value if it is plus.
>> and for hit = -1 if it is minus.
>> But i would like to print out as PLUS or MINUS not 1 or -1 my friend.
>>
>> you can see my code as below:
>>
>> while ( my $result = $searchio->next_result() ) {
>>      my $QueryName = $result->query_name(), my $QueryDescript =
>> $result->query_description();
>>      my $QueryLength = $result->query_length;
>>      my $NoHits = $result->num_hits;
>>
>>      while( my $hit = $result->next_hit ) {
>>          my $HitName = $hit->name();
>>          my $HitDescrip = $hit->description();
>> 	my $HitLength = $hit->length;
>>          my $Score = $hit->raw_score();
>> 	my $Bits = $hit->bits;
>>
>>          my $hsp = $hit->next_hsp; # Only check first (= best) hsp
>> 	my $Evalue =  $hsp->evalue();
>> 	my $AlnLen = $hsp->num_identical();
>> 	my $TotalLen = $hsp->hsp_length;
>> 	my $QueryStrand = $hsp->strand('query');
>> 	my $HitStrand = $hsp->strand('hit');
>>
>> 	if($Evalue<  $cutoff){
>> 	    print "$QueryName $QueryDescript\t";
>> 	    print "$QueryLength\t";
>> 	    print "$NoHits\t";
>> 	    print "$HitName $HitDescrip\t";
>> 	    print "$HitLength\t";
>> 	    print "$Score\t";
>> 	    print "$Bits\t";
>> 	    print "$Evalue\t";
>> 	    print "$AlnLen\t";
>> 	    print "$TotalLen\t";
>> 	    print "$QueryStrand\t";
>> 	    print "$HitStrand\n";
>> 	}
>>      }
>>      print "\n";
>> }
>>
>>
>> This is a part of my code.
>>
>> i have blastn report as below:
>>
>> BLASTN 2.2.18 [Mar-02-2008]
>>
>>
>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>> programs",  Nucleic Acids Res. 25:3389-3402.
>>
>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>           (24 letters)
>>
>> Database: hsa-mmu-rno_miRNA.fa
>>             3524 sequences; 76,424 total letters
>>
>> Searching..................................................done
>>
>>
>>
>>                                                                   Score
>> E
>> Sequences producing significant alignments:                      (bits)
>> Value
>>
>> hsa-miR-548aa
>> 48   2e-009
>> hsa-miR-548d-5p
>> 36   9e-006
>> hsa-miR-548b-5p
>> 36   9e-006
>> hsa-miR-548z
>> 34   3e-005
>> hsa-miR-548q
>> 30   5e-004
>> hsa-miR-548n
>> 30   5e-004
>> hsa-miR-548ab
>> 28   0.002
>> hsa-miR-548v
>> 28   0.002
>> hsa-miR-548c-5p
>> 28   0.002
>> hsa-miR-548ag
>> 26   0.008
>> hsa-miR-548u
>> 26   0.008
>> hsa-miR-548c-3p
>> 26   0.008
>> hsa-miR-603
>> 26   0.008
>> hsa-miR-548a-3p
>> 26   0.008
>> hsa-miR-548ac
>> 24   0.033
>> hsa-miR-548an
>> 22   0.13
>> hsa-miR-548aj
>> 22   0.13
>> hsa-miR-548i
>> 22   0.13
>> hsa-miR-548g
>> 22   0.13
>> hsa-miR-548j
>> 22   0.13
>> hsa-miR-548a-5p
>> 22   0.13
>>
>>> hsa-miR-548aa
>>            Length = 25
>>
>>   Score = 48.1 bits (24), Expect = 2e-009
>>   Identities = 24/24 (100%)
>>   Strand = Plus / Minus
>>
>>
>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>            ||||||||||||||||||||||||
>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>
>>
>>> hsa-miR-548d-5p
>>            Length = 22
>>
>>   Score = 36.2 bits (18), Expect = 9e-006
>>   Identities = 18/18 (100%)
>>   Strand = Plus / Plus
>>
>>
>> Query: 7  aaaagtaattgtggtttt 24
>>            ||||||||||||||||||
>> Sbjct: 1  aaaagtaattgtggtttt 18
>>
>>
>>
>> in this result i could not parse my code. i think my code does not
>> accept the Query header that is
>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>> output.
>>
>> kindly help me out.
>>
>> with regards,
>> Pawan.
>>
>>
>> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk>  wrote:
>>> Hi Pawan,
>>>
>>> Can you show your code? Is it basically following the structure shown in
>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>> ?
>>>
>>> If that is the case
>>>
>>> $hsp->strand('query')
>>>
>>>
>>> is exactly what you need.
>>> To check if hit and query are on different strands you can do:
>>>
>>> if ( $hsp->strand('query')
>>> * $hsp->strand('hit') == -1){
>>>
>>>   # do whatever you need to do if they are on opposite strands
>>>
>>> }
>>>
>>> Hope that helps
>>>
>>> Frank
>>>
>>>
>>>
>>>
>>>
>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>> Hi,
>>>>               Using Bio::SearchIO module I am parsing the following
>>>> Blast
>>>> result.
>>>> I have used the option- $hsp->strand('query').
>>>>
>>>> But I cannot get detail of alignment.
>>>>
>>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>>> or reverse ( Strand = Plus / Minus)...
>>>>   Can anyone help me to get report as Plus or Minus for query  or hit.
>>>>
>>>> thanks in advanced.
>>>>
>>>> With regards,
>>>> Pawan
>>>>
>>>>
>>>>
>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>
>>>>
>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>> Schaffer,
>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>>
>>>> Query= 000013_c10079-9984
>>>>           (50 letters)
>>>>
>>>> Database: Cyano_Probe.fasta
>>>>             4760 sequences; 238,000 total letters
>>>>
>>>> Searching..................................................done
>>>>
>>>>
>>>>
>>>>                                                                   Score
>>>>   E
>>>> Sequences producing significant alignments:                      (bits)
>>>> Value
>>>>
>>>> 000013_c10079-9984
>>>> 100   7e-024
>>>> 002619_2689273-2690037
>>>> 24   0.36
>>>> 001126_c1123720-1123385
>>>> 24   0.36
>>>> 003211_c3326737-3326480
>>>> 22   1.4
>>>> 002415_2471082-2471420
>>>> 22   1.4
>>>> 002269_2321276-2322463
>>>> 22   1.4
>>>> 001328_c1326535-1326164
>>>> 22   1.4
>>>>
>>>>> 000013_c10079-9984
>>>>            Length = 50
>>>>
>>>>   Score = 99.6 bits (50), Expect = 7e-024
>>>>   Identities = 50/50 (100%)
>>>>   Strand = Plus / Plus
>>>>
>>>>
>>>> Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>            ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>> --
>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>> Limited,
>>> a charity registered in England with number 1021457 and a company
>>> registered
>>> in England with number 2742969, whose registered office is 215 Euston
>>> Road,
>>> London, NW1 2BE.
>
>
> --
>  The Wellcome Trust Sanger Institute is operated by Genome Research
>  Limited, a charity registered in England with number 1021457 and a
>  company registered in England with number 2742969, whose registered
>  office is 215 Euston Road, London, NW1 2BE.
>


More information about the Bioperl-l mailing list