[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.
kakchingtabam pawankumar sharma
pawan.mani2 at gmail.com
Mon Jan 16 10:14:21 EST 2012
So By using the if else conditon function, I have solve Frank.
I mean is there anyway in bioperl we can get directly using other
module! I hope u got it!
So my second Question have not replied that is
i have blastn report as below:
BLASTN 2.2.18 [Mar-02-2008]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= ORB_1210001_hsa-miR-548aa#5_1
(24 letters)
Database: hsa-mmu-rno_miRNA.fa
3524 sequences; 76,424 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
hsa-miR-548aa
48 2e-009
hsa-miR-548d-5p
36 9e-006
hsa-miR-548b-5p
36 9e-006
hsa-miR-548z
34 3e-005
hsa-miR-548q
30 5e-004
hsa-miR-548n
30 5e-004
hsa-miR-548ab
28 0.002
hsa-miR-548v
28 0.002
hsa-miR-548c-5p
28 0.002
hsa-miR-548ag
26 0.008
hsa-miR-548u
26 0.008
hsa-miR-548c-3p
26 0.008
hsa-miR-603
26 0.008
hsa-miR-548a-3p
26 0.008
hsa-miR-548ac
24 0.033
hsa-miR-548an
22 0.13
hsa-miR-548aj
22 0.13
hsa-miR-548i
22 0.13
hsa-miR-548g
22 0.13
hsa-miR-548j
22 0.13
hsa-miR-548a-5p
22 0.13
>hsa-miR-548aa
Length = 25
Score = 48.1 bits (24), Expect = 2e-009
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1 tggtgcaaaagtaattgtggtttt 24
||||||||||||||||||||||||
Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>hsa-miR-548d-5p
Length = 22
Score = 36.2 bits (18), Expect = 9e-006
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 7 aaaagtaattgtggtttt 24
||||||||||||||||||
Sbjct: 1 aaaagtaattgtggtttt 18
in this result i could not parse my code. i think my code does not
accept the Query header that is
"ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast output.
kindly help me out.
with regards,
Pawan.
On 1/16/12, Frank Schwach <fs5 at sanger.ac.uk> wrote:
> Hi Pawan ,
>
> Please always "reply to all", so that you keep the discussion on the
> bioperl mailing list and more people can help you.
> What you need is a very basic Perl command. I could give you the code
> but I think you get more out of it if you experiment with it on your own
> because it is very fundamental. I'll point you in the right direction:
> you want an if-then-else conditional construct.
>
> Perl's documentation about this is here:
> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
>
> if strand is 1 you want to print "PLUS" else if it is -1 you want to
> print "MINUS", or else you might want to print "no strand" or something,
> or even treat it as an error and make the script abort.
>
> Give it a go and let us know if you need help. For basic (non-bio) Perl
> question, please also check out the community at http://www.perlmonks.org/.
>
> Hope that helps,
>
> Frank
>
>
> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>> Hi frank,
>>
>> Thanks for your kind reply.
>> I could get the vale for query as 1 value if it is plus.
>> and for hit = -1 if it is minus.
>> But i would like to print out as PLUS or MINUS not 1 or -1 my friend.
>>
>> you can see my code as below:
>>
>> while ( my $result = $searchio->next_result() ) {
>> my $QueryName = $result->query_name(), my $QueryDescript =
>> $result->query_description();
>> my $QueryLength = $result->query_length;
>> my $NoHits = $result->num_hits;
>>
>> while( my $hit = $result->next_hit ) {
>> my $HitName = $hit->name();
>> my $HitDescrip = $hit->description();
>> my $HitLength = $hit->length;
>> my $Score = $hit->raw_score();
>> my $Bits = $hit->bits;
>>
>> my $hsp = $hit->next_hsp; # Only check first (= best) hsp
>> my $Evalue = $hsp->evalue();
>> my $AlnLen = $hsp->num_identical();
>> my $TotalLen = $hsp->hsp_length;
>> my $QueryStrand = $hsp->strand('query');
>> my $HitStrand = $hsp->strand('hit');
>>
>> if($Evalue< $cutoff){
>> print "$QueryName $QueryDescript\t";
>> print "$QueryLength\t";
>> print "$NoHits\t";
>> print "$HitName $HitDescrip\t";
>> print "$HitLength\t";
>> print "$Score\t";
>> print "$Bits\t";
>> print "$Evalue\t";
>> print "$AlnLen\t";
>> print "$TotalLen\t";
>> print "$QueryStrand\t";
>> print "$HitStrand\n";
>> }
>> }
>> print "\n";
>> }
>>
>>
>> This is a part of my code.
>>
>> i have blastn report as below:
>>
>> BLASTN 2.2.18 [Mar-02-2008]
>>
>>
>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>> programs", Nucleic Acids Res. 25:3389-3402.
>>
>> Query= ORB_1210001_hsa-miR-548aa#5_1
>> (24 letters)
>>
>> Database: hsa-mmu-rno_miRNA.fa
>> 3524 sequences; 76,424 total letters
>>
>> Searching..................................................done
>>
>>
>>
>> Score
>> E
>> Sequences producing significant alignments: (bits)
>> Value
>>
>> hsa-miR-548aa
>> 48 2e-009
>> hsa-miR-548d-5p
>> 36 9e-006
>> hsa-miR-548b-5p
>> 36 9e-006
>> hsa-miR-548z
>> 34 3e-005
>> hsa-miR-548q
>> 30 5e-004
>> hsa-miR-548n
>> 30 5e-004
>> hsa-miR-548ab
>> 28 0.002
>> hsa-miR-548v
>> 28 0.002
>> hsa-miR-548c-5p
>> 28 0.002
>> hsa-miR-548ag
>> 26 0.008
>> hsa-miR-548u
>> 26 0.008
>> hsa-miR-548c-3p
>> 26 0.008
>> hsa-miR-603
>> 26 0.008
>> hsa-miR-548a-3p
>> 26 0.008
>> hsa-miR-548ac
>> 24 0.033
>> hsa-miR-548an
>> 22 0.13
>> hsa-miR-548aj
>> 22 0.13
>> hsa-miR-548i
>> 22 0.13
>> hsa-miR-548g
>> 22 0.13
>> hsa-miR-548j
>> 22 0.13
>> hsa-miR-548a-5p
>> 22 0.13
>>
>>> hsa-miR-548aa
>> Length = 25
>>
>> Score = 48.1 bits (24), Expect = 2e-009
>> Identities = 24/24 (100%)
>> Strand = Plus / Minus
>>
>>
>> Query: 1 tggtgcaaaagtaattgtggtttt 24
>> ||||||||||||||||||||||||
>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>
>>
>>> hsa-miR-548d-5p
>> Length = 22
>>
>> Score = 36.2 bits (18), Expect = 9e-006
>> Identities = 18/18 (100%)
>> Strand = Plus / Plus
>>
>>
>> Query: 7 aaaagtaattgtggtttt 24
>> ||||||||||||||||||
>> Sbjct: 1 aaaagtaattgtggtttt 18
>>
>>
>>
>> in this result i could not parse my code. i think my code does not
>> accept the Query header that is
>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>> output.
>>
>> kindly help me out.
>>
>> with regards,
>> Pawan.
>>
>>
>> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk> wrote:
>>> Hi Pawan,
>>>
>>> Can you show your code? Is it basically following the structure shown in
>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>> ?
>>>
>>> If that is the case
>>>
>>> $hsp->strand('query')
>>>
>>>
>>> is exactly what you need.
>>> To check if hit and query are on different strands you can do:
>>>
>>> if ( $hsp->strand('query')
>>> * $hsp->strand('hit') == -1){
>>>
>>> # do whatever you need to do if they are on opposite strands
>>>
>>> }
>>>
>>> Hope that helps
>>>
>>> Frank
>>>
>>>
>>>
>>>
>>>
>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>> Hi,
>>>> Using Bio::SearchIO module I am parsing the following
>>>> Blast
>>>> result.
>>>> I have used the option- $hsp->strand('query').
>>>>
>>>> But I cannot get detail of alignment.
>>>>
>>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>>> or reverse ( Strand = Plus / Minus)...
>>>> Can anyone help me to get report as Plus or Minus for query or hit.
>>>>
>>>> thanks in advanced.
>>>>
>>>> With regards,
>>>> Pawan
>>>>
>>>>
>>>>
>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>
>>>>
>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>> Schaffer,
>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>>>> programs", Nucleic Acids Res. 25:3389-3402.
>>>>
>>>> Query= 000013_c10079-9984
>>>> (50 letters)
>>>>
>>>> Database: Cyano_Probe.fasta
>>>> 4760 sequences; 238,000 total letters
>>>>
>>>> Searching..................................................done
>>>>
>>>>
>>>>
>>>> Score
>>>> E
>>>> Sequences producing significant alignments: (bits)
>>>> Value
>>>>
>>>> 000013_c10079-9984
>>>> 100 7e-024
>>>> 002619_2689273-2690037
>>>> 24 0.36
>>>> 001126_c1123720-1123385
>>>> 24 0.36
>>>> 003211_c3326737-3326480
>>>> 22 1.4
>>>> 002415_2471082-2471420
>>>> 22 1.4
>>>> 002269_2321276-2322463
>>>> 22 1.4
>>>> 001328_c1326535-1326164
>>>> 22 1.4
>>>>
>>>>> 000013_c10079-9984
>>>> Length = 50
>>>>
>>>> Score = 99.6 bits (50), Expect = 7e-024
>>>> Identities = 50/50 (100%)
>>>> Strand = Plus / Plus
>>>>
>>>>
>>>> Query: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>> Sbjct: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at lists.open-bio.org
>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>
>>>
>>> --
>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>> Limited,
>>> a charity registered in England with number 1021457 and a company
>>> registered
>>> in England with number 2742969, whose registered office is 215 Euston
>>> Road,
>>> London, NW1 2BE.
>
>
> --
> The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a
> company registered in England with number 2742969, whose registered
> office is 215 Euston Road, London, NW1 2BE.
>
More information about the Bioperl-l
mailing list