[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

Frank Schwach fs5 at sanger.ac.uk
Mon Jan 16 10:35:04 EST 2012


Excellent, well done!
No, this is the way to do it. In BioPerl modules that use strand 
information you will find the values +1/-1 or undef. If you want to 
display those as PLUS/MINUS,+/-,Watson/Crick,Laurel/Hardy whatever, you 
have to convert it, but you know now how to do it.
You have a syntax error in your code where you retrieve the query name:

my $QueryName = $result->query_name(), my $QueryDescript =
$result->query_description();

should be two lines and the comma should be a semicolon.

Good luck!

Frank




On 16/01/12 15:14, kakchingtabam pawankumar sharma wrote:
> So By using the if else conditon function, I have solve Frank.
> I mean is there anyway in bioperl we can get directly using other
> module! I hope u got it!
>
>
> So my second Question have not replied that is
>
> i have blastn report as below:
>
> BLASTN 2.2.18 [Mar-02-2008]
>
>
> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> programs",  Nucleic Acids Res. 25:3389-3402.
>
> Query= ORB_1210001_hsa-miR-548aa#5_1
>          (24 letters)
>
> Database: hsa-mmu-rno_miRNA.fa
>            3524 sequences; 76,424 total letters
>
> Searching..................................................done
>
>
>
>                                                                  Score    E
> Sequences producing significant alignments:                      (bits) Value
>
> hsa-miR-548aa
> 48   2e-009
> hsa-miR-548d-5p
> 36   9e-006
> hsa-miR-548b-5p
> 36   9e-006
> hsa-miR-548z
> 34   3e-005
> hsa-miR-548q
> 30   5e-004
> hsa-miR-548n
> 30   5e-004
> hsa-miR-548ab
> 28   0.002
> hsa-miR-548v
> 28   0.002
> hsa-miR-548c-5p
> 28   0.002
> hsa-miR-548ag
> 26   0.008
> hsa-miR-548u
> 26   0.008
> hsa-miR-548c-3p
> 26   0.008
> hsa-miR-603
> 26   0.008
> hsa-miR-548a-3p
> 26   0.008
> hsa-miR-548ac
> 24   0.033
> hsa-miR-548an
> 22   0.13
> hsa-miR-548aj
> 22   0.13
> hsa-miR-548i
> 22   0.13
> hsa-miR-548g
> 22   0.13
> hsa-miR-548j
> 22   0.13
> hsa-miR-548a-5p
> 22   0.13
>
>> hsa-miR-548aa
>           Length = 25
>
>   Score = 48.1 bits (24), Expect = 2e-009
>   Identities = 24/24 (100%)
>   Strand = Plus / Minus
>
>
> Query: 1  tggtgcaaaagtaattgtggtttt 24
>           ||||||||||||||||||||||||
> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>
>
>> hsa-miR-548d-5p
>           Length = 22
>
>   Score = 36.2 bits (18), Expect = 9e-006
>   Identities = 18/18 (100%)
>   Strand = Plus / Plus
>
>
> Query: 7  aaaagtaattgtggtttt 24
>           ||||||||||||||||||
> Sbjct: 1  aaaagtaattgtggtttt 18
>
>
>
> in this result i could not parse my code. i think my code does not
> accept the Query header that is
> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast output.
>
> kindly help me out.
>
> with regards,
> Pawan.
>
> On 1/16/12, Frank Schwach<fs5 at sanger.ac.uk>  wrote:
>> Hi Pawan ,
>>
>> Please always "reply to all", so that you keep the discussion on the
>> bioperl mailing list and more people can help you.
>> What you need is a very basic Perl command. I could give you the code
>> but I think you get more out of it if you experiment with it on your own
>> because it is very fundamental. I'll point you in the right direction:
>> you want an if-then-else conditional construct.
>>
>> Perl's documentation about this is here:
>> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
>>
>> if strand is 1 you want to print "PLUS" else if it is -1 you want to
>> print "MINUS", or else you might want to print "no strand" or something,
>> or even treat it as an error and make the script abort.
>>
>> Give it a go and let us know if you need help. For basic (non-bio) Perl
>> question, please also check out the community at http://www.perlmonks.org/.
>>
>> Hope that helps,
>>
>> Frank
>>
>>
>> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>>> Hi frank,
>>>
>>> Thanks for your kind reply.
>>> I could get the vale for query as 1 value if it is plus.
>>> and for hit = -1 if it is minus.
>>> But i would like to print out as PLUS or MINUS not 1 or -1 my friend.
>>>
>>> you can see my code as below:
>>>
>>> while ( my $result = $searchio->next_result() ) {
>>>       my $QueryName = $result->query_name(), my $QueryDescript =
>>> $result->query_description();
>>>       my $QueryLength = $result->query_length;
>>>       my $NoHits = $result->num_hits;
>>>
>>>       while( my $hit = $result->next_hit ) {
>>>           my $HitName = $hit->name();
>>>           my $HitDescrip = $hit->description();
>>> 	my $HitLength = $hit->length;
>>>           my $Score = $hit->raw_score();
>>> 	my $Bits = $hit->bits;
>>>
>>>           my $hsp = $hit->next_hsp; # Only check first (= best) hsp
>>> 	my $Evalue =  $hsp->evalue();
>>> 	my $AlnLen = $hsp->num_identical();
>>> 	my $TotalLen = $hsp->hsp_length;
>>> 	my $QueryStrand = $hsp->strand('query');
>>> 	my $HitStrand = $hsp->strand('hit');
>>>
>>> 	if($Evalue<   $cutoff){
>>> 	    print "$QueryName $QueryDescript\t";
>>> 	    print "$QueryLength\t";
>>> 	    print "$NoHits\t";
>>> 	    print "$HitName $HitDescrip\t";
>>> 	    print "$HitLength\t";
>>> 	    print "$Score\t";
>>> 	    print "$Bits\t";
>>> 	    print "$Evalue\t";
>>> 	    print "$AlnLen\t";
>>> 	    print "$TotalLen\t";
>>> 	    print "$QueryStrand\t";
>>> 	    print "$HitStrand\n";
>>> 	}
>>>       }
>>>       print "\n";
>>> }
>>>
>>>
>>> This is a part of my code.
>>>
>>> i have blastn report as below:
>>>
>>> BLASTN 2.2.18 [Mar-02-2008]
>>>
>>>
>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>
>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>            (24 letters)
>>>
>>> Database: hsa-mmu-rno_miRNA.fa
>>>              3524 sequences; 76,424 total letters
>>>
>>> Searching..................................................done
>>>
>>>
>>>
>>>                                                                    Score
>>> E
>>> Sequences producing significant alignments:                      (bits)
>>> Value
>>>
>>> hsa-miR-548aa
>>> 48   2e-009
>>> hsa-miR-548d-5p
>>> 36   9e-006
>>> hsa-miR-548b-5p
>>> 36   9e-006
>>> hsa-miR-548z
>>> 34   3e-005
>>> hsa-miR-548q
>>> 30   5e-004
>>> hsa-miR-548n
>>> 30   5e-004
>>> hsa-miR-548ab
>>> 28   0.002
>>> hsa-miR-548v
>>> 28   0.002
>>> hsa-miR-548c-5p
>>> 28   0.002
>>> hsa-miR-548ag
>>> 26   0.008
>>> hsa-miR-548u
>>> 26   0.008
>>> hsa-miR-548c-3p
>>> 26   0.008
>>> hsa-miR-603
>>> 26   0.008
>>> hsa-miR-548a-3p
>>> 26   0.008
>>> hsa-miR-548ac
>>> 24   0.033
>>> hsa-miR-548an
>>> 22   0.13
>>> hsa-miR-548aj
>>> 22   0.13
>>> hsa-miR-548i
>>> 22   0.13
>>> hsa-miR-548g
>>> 22   0.13
>>> hsa-miR-548j
>>> 22   0.13
>>> hsa-miR-548a-5p
>>> 22   0.13
>>>
>>>> hsa-miR-548aa
>>>             Length = 25
>>>
>>>    Score = 48.1 bits (24), Expect = 2e-009
>>>    Identities = 24/24 (100%)
>>>    Strand = Plus / Minus
>>>
>>>
>>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>>             ||||||||||||||||||||||||
>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>
>>>
>>>> hsa-miR-548d-5p
>>>             Length = 22
>>>
>>>    Score = 36.2 bits (18), Expect = 9e-006
>>>    Identities = 18/18 (100%)
>>>    Strand = Plus / Plus
>>>
>>>
>>> Query: 7  aaaagtaattgtggtttt 24
>>>             ||||||||||||||||||
>>> Sbjct: 1  aaaagtaattgtggtttt 18
>>>
>>>
>>>
>>> in this result i could not parse my code. i think my code does not
>>> accept the Query header that is
>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>>> output.
>>>
>>> kindly help me out.
>>>
>>> with regards,
>>> Pawan.
>>>
>>>
>>> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk>   wrote:
>>>> Hi Pawan,
>>>>
>>>> Can you show your code? Is it basically following the structure shown in
>>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>>> ?
>>>>
>>>> If that is the case
>>>>
>>>> $hsp->strand('query')
>>>>
>>>>
>>>> is exactly what you need.
>>>> To check if hit and query are on different strands you can do:
>>>>
>>>> if ( $hsp->strand('query')
>>>> * $hsp->strand('hit') == -1){
>>>>
>>>>    # do whatever you need to do if they are on opposite strands
>>>>
>>>> }
>>>>
>>>> Hope that helps
>>>>
>>>> Frank
>>>>
>>>>
>>>>
>>>>
>>>>
>>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>>> Hi,
>>>>>                Using Bio::SearchIO module I am parsing the following
>>>>> Blast
>>>>> result.
>>>>> I have used the option- $hsp->strand('query').
>>>>>
>>>>> But I cannot get detail of alignment.
>>>>>
>>>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>>>> or reverse ( Strand = Plus / Minus)...
>>>>>    Can anyone help me to get report as Plus or Minus for query  or hit.
>>>>>
>>>>> thanks in advanced.
>>>>>
>>>>> With regards,
>>>>> Pawan
>>>>>
>>>>>
>>>>>
>>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>>
>>>>>
>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>> Schaffer,
>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database search
>>>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>>>
>>>>> Query= 000013_c10079-9984
>>>>>            (50 letters)
>>>>>
>>>>> Database: Cyano_Probe.fasta
>>>>>              4760 sequences; 238,000 total letters
>>>>>
>>>>> Searching..................................................done
>>>>>
>>>>>
>>>>>
>>>>>                                                                    Score
>>>>>    E
>>>>> Sequences producing significant alignments:                      (bits)
>>>>> Value
>>>>>
>>>>> 000013_c10079-9984
>>>>> 100   7e-024
>>>>> 002619_2689273-2690037
>>>>> 24   0.36
>>>>> 001126_c1123720-1123385
>>>>> 24   0.36
>>>>> 003211_c3326737-3326480
>>>>> 22   1.4
>>>>> 002415_2471082-2471420
>>>>> 22   1.4
>>>>> 002269_2321276-2322463
>>>>> 22   1.4
>>>>> 001328_c1326535-1326164
>>>>> 22   1.4
>>>>>
>>>>>> 000013_c10079-9984
>>>>>             Length = 50
>>>>>
>>>>>    Score = 99.6 bits (50), Expect = 7e-024
>>>>>    Identities = 50/50 (100%)
>>>>>    Strand = Plus / Plus
>>>>>
>>>>>
>>>>> Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>             ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>>> Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>
>>>>> _______________________________________________
>>>>> Bioperl-l mailing list
>>>>> Bioperl-l at lists.open-bio.org
>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>>>> --
>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>> Limited,
>>>> a charity registered in England with number 1021457 and a company
>>>> registered
>>>> in England with number 2742969, whose registered office is 215 Euston
>>>> Road,
>>>> London, NW1 2BE.
>>
>> --
>>   The Wellcome Trust Sanger Institute is operated by Genome Research
>>   Limited, a charity registered in England with number 1021457 and a
>>   company registered in England with number 2742969, whose registered
>>   office is 215 Euston Road, London, NW1 2BE.
>>


-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 


More information about the Bioperl-l mailing list