[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

kakchingtabam pawankumar sharma pawan.mani2 at gmail.com
Wed Jan 25 09:41:39 EST 2012


Hi,

This is my script:-

my $searchio = new Bio::SearchIO( -format => 'blast', -file  =>
$blast_report, -best_hit_only =>  1);

while ( my $result = $searchio->next_result() ) {

    my $QueryName = $result->query_name(); my $QueryDescript =
$result->query_description();
    my $QueryLength = $result->query_length;
    my $NoHits = $result->num_hits;

    while( my $hit = $result->next_hit ) {
        my $HitName = $hit->name();
        my $HitDescrip = $hit->description();
	my $HitLength = $hit->length;
        my $Score = $hit->raw_score();
	my $Bits = $hit->bits;

        my $hsp = $hit->next_hsp; # Only check first (= best) hsp
	my $Evalue =  $hsp->evalue();
	my $AlnLen = $hsp->num_identical();
	my $TotalLen = $hsp->hsp_length;
	my $QueryStrand = $hsp->strand('query');
	my $HitStrand = $hsp->strand('hit');

	#if($Evalue < $cutoff){
	    print "$QueryName $QueryDescript\t";
	    print "$QueryLength\t";
	    print "$NoHits\t";
	    print "$HitName $HitDescrip\t";
	    print "$HitLength\t";
	    print "$Score\t";
	    print "$Bits\t";
	    print "$Evalue\n";
	    print "$AlnLen\t";
	    print "$TotalLen\t";
	    print "$QueryStrand\t";
	    print "$HitStrand\n";
	#}
    }
    #print "\n";
}


So Can You Predict where I need to modify This Script To get only
tophit of every Query.

With Regards,
Pawan

On 1/25/12, Frank Schwach <fs5 at sanger.ac.uk> wrote:
> can you post your script please?
>
> On 25/01/12 07:12, kakchingtabam pawankumar sharma wrote:
>> Hi Frank,
>> Thanks for your kind reply. I have done this in my script even though
>> i could get the top hit still for every query. Still all hits are
>> extracted by my script. So kindly help me to solve this problem.
>>
>> With best regards,
>> Pawan
>>
>> On Tue, Jan 24, 2012 at 5:13 PM, Frank Schwach<fs5 at sanger.ac.uk>  wrote:
>>> I think that's an option that you can set when you ask for a new BLAST
>>> parser:
>>> my $searchio = new Bio::SearchIO(
>>>   -format =>  'blast',
>>>   -file   =>  't/data/ecolitst.bls',
>>>   -best_hit_only =>  1,
>>> );
>>>
>>> now when you use the same script that you have been using so far (loop
>>> over
>>> all hits), there will only be one hit per result.
>>>
>>> Frank
>>>
>>>
>>>
>>> On 24/01/12 11:31, kakchingtabam pawankumar sharma wrote:
>>>>
>>>> Hi,
>>>>        Thanks a lot for help Frank. It works for every Blast output.
>>>> One more question is that i want to best hit only(top hit of every
>>>> query).
>>>> I show there is option called
>>>> $obj->best_hit_only; in Bio::SearchIO module.
>>>> So help to add this to my script.
>>>> I could not do. Its confusing.
>>>>
>>>> Thanks in Advanced.
>>>>
>>>> With best regards,
>>>> Pawan
>>>>
>>>>
>>>> On Mon, Jan 16, 2012 at 9:05 PM, Frank Schwach<fs5 at sanger.ac.uk>
>>>> wrote:
>>>>>
>>>>> Excellent, well done!
>>>>> No, this is the way to do it. In BioPerl modules that use strand
>>>>> information
>>>>> you will find the values +1/-1 or undef. If you want to display those
>>>>> as
>>>>> PLUS/MINUS,+/-,Watson/Crick,Laurel/Hardy whatever, you have to convert
>>>>> it,
>>>>> but you know now how to do it.
>>>>> You have a syntax error in your code where you retrieve the query name:
>>>>>
>>>>>
>>>>> my $QueryName = $result->query_name(), my $QueryDescript =
>>>>> $result->query_description();
>>>>>
>>>>> should be two lines and the comma should be a semicolon.
>>>>>
>>>>> Good luck!
>>>>>
>>>>> Frank
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> On 16/01/12 15:14, kakchingtabam pawankumar sharma wrote:
>>>>>>
>>>>>>
>>>>>> So By using the if else conditon function, I have solve Frank.
>>>>>> I mean is there anyway in bioperl we can get directly using other
>>>>>> module! I hope u got it!
>>>>>>
>>>>>>
>>>>>> So my second Question have not replied that is
>>>>>>
>>>>>> i have blastn report as below:
>>>>>>
>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>
>>>>>>
>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>> Schaffer,
>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>> search
>>>>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>>>>
>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>          (24 letters)
>>>>>>
>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>            3524 sequences; 76,424 total letters
>>>>>>
>>>>>> Searching..................................................done
>>>>>>
>>>>>>
>>>>>>
>>>>>>                                                                  Score
>>>>>>   E
>>>>>> Sequences producing significant alignments:
>>>>>> (bits)
>>>>>> Value
>>>>>>
>>>>>> hsa-miR-548aa
>>>>>> 48   2e-009
>>>>>> hsa-miR-548d-5p
>>>>>> 36   9e-006
>>>>>> hsa-miR-548b-5p
>>>>>> 36   9e-006
>>>>>> hsa-miR-548z
>>>>>> 34   3e-005
>>>>>> hsa-miR-548q
>>>>>> 30   5e-004
>>>>>> hsa-miR-548n
>>>>>> 30   5e-004
>>>>>> hsa-miR-548ab
>>>>>> 28   0.002
>>>>>> hsa-miR-548v
>>>>>> 28   0.002
>>>>>> hsa-miR-548c-5p
>>>>>> 28   0.002
>>>>>> hsa-miR-548ag
>>>>>> 26   0.008
>>>>>> hsa-miR-548u
>>>>>> 26   0.008
>>>>>> hsa-miR-548c-3p
>>>>>> 26   0.008
>>>>>> hsa-miR-603
>>>>>> 26   0.008
>>>>>> hsa-miR-548a-3p
>>>>>> 26   0.008
>>>>>> hsa-miR-548ac
>>>>>> 24   0.033
>>>>>> hsa-miR-548an
>>>>>> 22   0.13
>>>>>> hsa-miR-548aj
>>>>>> 22   0.13
>>>>>> hsa-miR-548i
>>>>>> 22   0.13
>>>>>> hsa-miR-548g
>>>>>> 22   0.13
>>>>>> hsa-miR-548j
>>>>>> 22   0.13
>>>>>> hsa-miR-548a-5p
>>>>>> 22   0.13
>>>>>>
>>>>>>> hsa-miR-548aa
>>>>>>
>>>>>>
>>>>>>           Length = 25
>>>>>>
>>>>>>   Score = 48.1 bits (24), Expect = 2e-009
>>>>>>   Identities = 24/24 (100%)
>>>>>>   Strand = Plus / Minus
>>>>>>
>>>>>>
>>>>>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>>>>>           ||||||||||||||||||||||||
>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>
>>>>>>
>>>>>>> hsa-miR-548d-5p
>>>>>>
>>>>>>
>>>>>>           Length = 22
>>>>>>
>>>>>>   Score = 36.2 bits (18), Expect = 9e-006
>>>>>>   Identities = 18/18 (100%)
>>>>>>   Strand = Plus / Plus
>>>>>>
>>>>>>
>>>>>> Query: 7  aaaagtaattgtggtttt 24
>>>>>>           ||||||||||||||||||
>>>>>> Sbjct: 1  aaaagtaattgtggtttt 18
>>>>>>
>>>>>>
>>>>>>
>>>>>> in this result i could not parse my code. i think my code does not
>>>>>> accept the Query header that is
>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>>>>>> output.
>>>>>>
>>>>>> kindly help me out.
>>>>>>
>>>>>> with regards,
>>>>>> Pawan.
>>>>>>
>>>>>> On 1/16/12, Frank Schwach<fs5 at sanger.ac.uk>      wrote:
>>>>>>>
>>>>>>>
>>>>>>> Hi Pawan ,
>>>>>>>
>>>>>>> Please always "reply to all", so that you keep the discussion on the
>>>>>>> bioperl mailing list and more people can help you.
>>>>>>> What you need is a very basic Perl command. I could give you the code
>>>>>>> but I think you get more out of it if you experiment with it on your
>>>>>>> own
>>>>>>> because it is very fundamental. I'll point you in the right
>>>>>>> direction:
>>>>>>> you want an if-then-else conditional construct.
>>>>>>>
>>>>>>> Perl's documentation about this is here:
>>>>>>>
>>>>>>> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
>>>>>>>
>>>>>>> if strand is 1 you want to print "PLUS" else if it is -1 you want to
>>>>>>> print "MINUS", or else you might want to print "no strand" or
>>>>>>> something,
>>>>>>> or even treat it as an error and make the script abort.
>>>>>>>
>>>>>>> Give it a go and let us know if you need help. For basic (non-bio)
>>>>>>> Perl
>>>>>>> question, please also check out the community at
>>>>>>> http://www.perlmonks.org/.
>>>>>>>
>>>>>>> Hope that helps,
>>>>>>>
>>>>>>> Frank
>>>>>>>
>>>>>>>
>>>>>>> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>> Hi frank,
>>>>>>>>
>>>>>>>> Thanks for your kind reply.
>>>>>>>> I could get the vale for query as 1 value if it is plus.
>>>>>>>> and for hit = -1 if it is minus.
>>>>>>>> But i would like to print out as PLUS or MINUS not 1 or -1 my
>>>>>>>> friend.
>>>>>>>>
>>>>>>>> you can see my code as below:
>>>>>>>>
>>>>>>>> while ( my $result = $searchio->next_result() ) {
>>>>>>>>       my $QueryName = $result->query_name(), my $QueryDescript =
>>>>>>>> $result->query_description();
>>>>>>>>       my $QueryLength = $result->query_length;
>>>>>>>>       my $NoHits = $result->num_hits;
>>>>>>>>
>>>>>>>>       while( my $hit = $result->next_hit ) {
>>>>>>>>           my $HitName = $hit->name();
>>>>>>>>           my $HitDescrip = $hit->description();
>>>>>>>>         my $HitLength = $hit->length;
>>>>>>>>           my $Score = $hit->raw_score();
>>>>>>>>         my $Bits = $hit->bits;
>>>>>>>>
>>>>>>>>           my $hsp = $hit->next_hsp; # Only check first (= best) hsp
>>>>>>>>         my $Evalue =  $hsp->evalue();
>>>>>>>>         my $AlnLen = $hsp->num_identical();
>>>>>>>>         my $TotalLen = $hsp->hsp_length;
>>>>>>>>         my $QueryStrand = $hsp->strand('query');
>>>>>>>>         my $HitStrand = $hsp->strand('hit');
>>>>>>>>
>>>>>>>>         if($Evalue<       $cutoff){
>>>>>>>>             print "$QueryName $QueryDescript\t";
>>>>>>>>             print "$QueryLength\t";
>>>>>>>>             print "$NoHits\t";
>>>>>>>>             print "$HitName $HitDescrip\t";
>>>>>>>>             print "$HitLength\t";
>>>>>>>>             print "$Score\t";
>>>>>>>>             print "$Bits\t";
>>>>>>>>             print "$Evalue\t";
>>>>>>>>             print "$AlnLen\t";
>>>>>>>>             print "$TotalLen\t";
>>>>>>>>             print "$QueryStrand\t";
>>>>>>>>             print "$HitStrand\n";
>>>>>>>>         }
>>>>>>>>       }
>>>>>>>>       print "\n";
>>>>>>>> }
>>>>>>>>
>>>>>>>>
>>>>>>>> This is a part of my code.
>>>>>>>>
>>>>>>>> i have blastn report as below:
>>>>>>>>
>>>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>>>
>>>>>>>>
>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>> Schaffer,
>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>>>> search
>>>>>>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>>>>>>
>>>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>>>            (24 letters)
>>>>>>>>
>>>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>>>              3524 sequences; 76,424 total letters
>>>>>>>>
>>>>>>>> Searching..................................................done
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> Score
>>>>>>>> E
>>>>>>>> Sequences producing significant alignments:
>>>>>>>>   (bits)
>>>>>>>> Value
>>>>>>>>
>>>>>>>> hsa-miR-548aa
>>>>>>>> 48   2e-009
>>>>>>>> hsa-miR-548d-5p
>>>>>>>> 36   9e-006
>>>>>>>> hsa-miR-548b-5p
>>>>>>>> 36   9e-006
>>>>>>>> hsa-miR-548z
>>>>>>>> 34   3e-005
>>>>>>>> hsa-miR-548q
>>>>>>>> 30   5e-004
>>>>>>>> hsa-miR-548n
>>>>>>>> 30   5e-004
>>>>>>>> hsa-miR-548ab
>>>>>>>> 28   0.002
>>>>>>>> hsa-miR-548v
>>>>>>>> 28   0.002
>>>>>>>> hsa-miR-548c-5p
>>>>>>>> 28   0.002
>>>>>>>> hsa-miR-548ag
>>>>>>>> 26   0.008
>>>>>>>> hsa-miR-548u
>>>>>>>> 26   0.008
>>>>>>>> hsa-miR-548c-3p
>>>>>>>> 26   0.008
>>>>>>>> hsa-miR-603
>>>>>>>> 26   0.008
>>>>>>>> hsa-miR-548a-3p
>>>>>>>> 26   0.008
>>>>>>>> hsa-miR-548ac
>>>>>>>> 24   0.033
>>>>>>>> hsa-miR-548an
>>>>>>>> 22   0.13
>>>>>>>> hsa-miR-548aj
>>>>>>>> 22   0.13
>>>>>>>> hsa-miR-548i
>>>>>>>> 22   0.13
>>>>>>>> hsa-miR-548g
>>>>>>>> 22   0.13
>>>>>>>> hsa-miR-548j
>>>>>>>> 22   0.13
>>>>>>>> hsa-miR-548a-5p
>>>>>>>> 22   0.13
>>>>>>>>
>>>>>>>>> hsa-miR-548aa
>>>>>>>>
>>>>>>>>
>>>>>>>>             Length = 25
>>>>>>>>
>>>>>>>>    Score = 48.1 bits (24), Expect = 2e-009
>>>>>>>>    Identities = 24/24 (100%)
>>>>>>>>    Strand = Plus / Minus
>>>>>>>>
>>>>>>>>
>>>>>>>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>>>>>>>             ||||||||||||||||||||||||
>>>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>>>
>>>>>>>>
>>>>>>>>> hsa-miR-548d-5p
>>>>>>>>
>>>>>>>>
>>>>>>>>             Length = 22
>>>>>>>>
>>>>>>>>    Score = 36.2 bits (18), Expect = 9e-006
>>>>>>>>    Identities = 18/18 (100%)
>>>>>>>>    Strand = Plus / Plus
>>>>>>>>
>>>>>>>>
>>>>>>>> Query: 7  aaaagtaattgtggtttt 24
>>>>>>>>             ||||||||||||||||||
>>>>>>>> Sbjct: 1  aaaagtaattgtggtttt 18
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> in this result i could not parse my code. i think my code does not
>>>>>>>> accept the Query header that is
>>>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>>>>>>>> output.
>>>>>>>>
>>>>>>>> kindly help me out.
>>>>>>>>
>>>>>>>> with regards,
>>>>>>>> Pawan.
>>>>>>>>
>>>>>>>>
>>>>>>>> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk>
>>>>>>>> wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Hi Pawan,
>>>>>>>>>
>>>>>>>>> Can you show your code? Is it basically following the structure
>>>>>>>>> shown
>>>>>>>>> in
>>>>>>>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>>>>>>>> ?
>>>>>>>>>
>>>>>>>>> If that is the case
>>>>>>>>>
>>>>>>>>> $hsp->strand('query')
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> is exactly what you need.
>>>>>>>>> To check if hit and query are on different strands you can do:
>>>>>>>>>
>>>>>>>>> if ( $hsp->strand('query')
>>>>>>>>> * $hsp->strand('hit') == -1){
>>>>>>>>>
>>>>>>>>>    # do whatever you need to do if they are on opposite strands
>>>>>>>>>
>>>>>>>>> }
>>>>>>>>>
>>>>>>>>> Hope that helps
>>>>>>>>>
>>>>>>>>> Frank
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Hi,
>>>>>>>>>>                Using Bio::SearchIO module I am parsing the
>>>>>>>>>> following
>>>>>>>>>> Blast
>>>>>>>>>> result.
>>>>>>>>>> I have used the option- $hsp->strand('query').
>>>>>>>>>>
>>>>>>>>>> But I cannot get detail of alignment.
>>>>>>>>>>
>>>>>>>>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>>>>>>>>> or reverse ( Strand = Plus / Minus)...
>>>>>>>>>>    Can anyone help me to get report as Plus or Minus for query  or
>>>>>>>>>> hit.
>>>>>>>>>>
>>>>>>>>>> thanks in advanced.
>>>>>>>>>>
>>>>>>>>>> With regards,
>>>>>>>>>> Pawan
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>>>> Schaffer,
>>>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman
>>>>>>>>>> (1997),
>>>>>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>>>>>> search
>>>>>>>>>> programs",  Nucleic Acids Res. 25:3389-3402.
>>>>>>>>>>
>>>>>>>>>> Query= 000013_c10079-9984
>>>>>>>>>>            (50 letters)
>>>>>>>>>>
>>>>>>>>>> Database: Cyano_Probe.fasta
>>>>>>>>>>              4760 sequences; 238,000 total letters
>>>>>>>>>>
>>>>>>>>>> Searching..................................................done
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Score
>>>>>>>>>>    E
>>>>>>>>>> Sequences producing significant alignments:
>>>>>>>>>>   (bits)
>>>>>>>>>> Value
>>>>>>>>>>
>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>> 100   7e-024
>>>>>>>>>> 002619_2689273-2690037
>>>>>>>>>> 24   0.36
>>>>>>>>>> 001126_c1123720-1123385
>>>>>>>>>> 24   0.36
>>>>>>>>>> 003211_c3326737-3326480
>>>>>>>>>> 22   1.4
>>>>>>>>>> 002415_2471082-2471420
>>>>>>>>>> 22   1.4
>>>>>>>>>> 002269_2321276-2322463
>>>>>>>>>> 22   1.4
>>>>>>>>>> 001328_c1326535-1326164
>>>>>>>>>> 22   1.4
>>>>>>>>>>
>>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>             Length = 50
>>>>>>>>>>
>>>>>>>>>>    Score = 99.6 bits (50), Expect = 7e-024
>>>>>>>>>>    Identities = 50/50 (100%)
>>>>>>>>>>    Strand = Plus / Plus
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>>>>>>             ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>>>>>>>> Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>>>>>>
>>>>>>>>>> _______________________________________________
>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> --
>>>>>>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>>>>>> Limited,
>>>>>>>>> a charity registered in England with number 1021457 and a company
>>>>>>>>> registered
>>>>>>>>> in England with number 2742969, whose registered office is 215
>>>>>>>>> Euston
>>>>>>>>> Road,
>>>>>>>>> London, NW1 2BE.
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> --
>>>>>>>   The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>>>>   Limited, a charity registered in England with number 1021457 and a
>>>>>>>   company registered in England with number 2742969, whose registered
>>>>>>>   office is 215 Euston Road, London, NW1 2BE.
>>>>>>>
>>>>>
>>>>>
>>>>> --
>>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>> Limited,
>>>>> a charity registered in England with number 1021457 and a company
>>>>> registered
>>>>> in England with number 2742969, whose registered office is 215 Euston
>>>>> Road,
>>>>> London, NW1 2BE.
>>>
>>>
>>>
>>> --
>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>> Limited,
>>> a charity registered in England with number 1021457 and a company
>>> registered
>>> in England with number 2742969, whose registered office is 215 Euston
>>> Road,
>>> London, NW1 2BE.
>
>
> --
>  The Wellcome Trust Sanger Institute is operated by Genome Research
>  Limited, a charity registered in England with number 1021457 and a
>  company registered in England with number 2742969, whose registered
>  office is 215 Euston Road, London, NW1 2BE.
>


More information about the Bioperl-l mailing list