From p.j.a.cock at googlemail.com Mon Oct 1 10:12:49 2012 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Mon, 1 Oct 2012 15:12:49 +0100 Subject: [Bioperl-l] Update of SeqIO:: fastq Module for PacBio In-Reply-To: <8F090585-216B-49B7-B574-277D300DC6FA@gmail.com> References: <58001297-BD1D-460C-8749-B9DCA683A557@gmail.com> <002159B2-0A4A-4B7B-863C-EE26D21088DE@gmail.com> <8F090585-216B-49B7-B574-277D300DC6FA@gmail.com> Message-ID: On Mon, Oct 1, 2012 at 3:09 PM, Dan Nasko wrote: > Hi Peter, > > They haven't empaled me regarding it in about a week. That is such a strange typo it must be the work of auto-correct *grin* > We had a meeting with PacBio's CSO last week and brought it up with > him - so he's aware now as well. No word on their course of action to fix it. That's good. > Thanks for all of your help with this. > Dan Thank you for following up on this. Regards, Peter From dan.nasko at gmail.com Mon Oct 1 10:09:07 2012 From: dan.nasko at gmail.com (Dan Nasko) Date: Mon, 1 Oct 2012 10:09:07 -0400 Subject: [Bioperl-l] Update of SeqIO:: fastq Module for PacBio In-Reply-To: References: <58001297-BD1D-460C-8749-B9DCA683A557@gmail.com> <002159B2-0A4A-4B7B-863C-EE26D21088DE@gmail.com> Message-ID: <8F090585-216B-49B7-B574-277D300DC6FA@gmail.com> Hi Peter, They haven't empaled me regarding it in about a week. We had a meeting with PacBio's CSO last week and brought it up with him - so he's aware now as well. No word on their course of action to fix it. Thanks for all of your help with this. Dan On Sep 30, 2012, at 6:38 PM, Peter Cock wrote: > Hi Dan, > > Did you get any reply from PacBio? > > Re: http://lists.open-bio.org/pipermail/bioperl-l/2012-September/036778.html > > Thanks, > > Peter > > On Thu, Sep 20, 2012 at 7:00 PM, Dan Nasko wrote: >> Peter, >> >> Here is Frank Boellmann's email, he's a Field Application Specialist and >> Bioinformatician at PacBio who is generally great at resolving these issues: >> fboellmann at pacificbiosciences.com >> >> I've gone ahead and contacted another one of their software engineers and am >> waiting for a response from him. >> >> Dan From dan.nasko at gmail.com Mon Oct 1 10:14:32 2012 From: dan.nasko at gmail.com (Dan Nasko) Date: Mon, 1 Oct 2012 10:14:32 -0400 Subject: [Bioperl-l] Update of SeqIO:: fastq Module for PacBio In-Reply-To: References: <58001297-BD1D-460C-8749-B9DCA683A557@gmail.com> <002159B2-0A4A-4B7B-863C-EE26D21088DE@gmail.com> <8F090585-216B-49B7-B574-277D300DC6FA@gmail.com> Message-ID: Haha wow, Mountain Lion is killing me? but yes "They haven't emailed* me regarding it in about a week." Apologies, Dan On Oct 1, 2012, at 10:12 AM, Peter Cock wrote: > On Mon, Oct 1, 2012 at 3:09 PM, Dan Nasko wrote: >> Hi Peter, >> >> They haven't empaled me regarding it in about a week. > > That is such a strange typo it must be the work of auto-correct *grin* > >> We had a meeting with PacBio's CSO last week and brought it up with >> him - so he's aware now as well. No word on their course of action to fix it. > > That's good. > >> Thanks for all of your help with this. >> Dan > > Thank you for following up on this. > > Regards, > > Peter From rondonbio at yahoo.com.br Thu Oct 4 17:30:37 2012 From: rondonbio at yahoo.com.br (Rondon Neto) Date: Thu, 4 Oct 2012 14:30:37 -0700 (PDT) Subject: [Bioperl-l] extract nt positions from Hit Message-ID: <1349386237.47154.YahooMailNeo@web120403.mail.ne1.yahoo.com> Hi there! I would like to know if there is a way to recover the nucleotides and their positions in the database sequences that are divergent from query, by Search::IO. What I need are: - the nucleotides - their positions in DB sequences - the positions of mismatches and gaps that they are related. thank you very much, Rondon From jason.stajich at gmail.com Fri Oct 5 12:12:54 2012 From: jason.stajich at gmail.com (Jason Stajich) Date: Fri, 5 Oct 2012 09:12:54 -0700 Subject: [Bioperl-l] extract nt positions from Hit In-Reply-To: <1349386237.47154.YahooMailNeo@web120403.mail.ne1.yahoo.com> References: <1349386237.47154.YahooMailNeo@web120403.mail.ne1.yahoo.com> Message-ID: This sounds a little like homework - did you try to read the SearchIO HOWTO and give the example code in there a whirl? http://bioperl.org/wiki/HOWTO:SearchIO On Oct 4, 2012, at 2:30 PM, Rondon Neto wrote: > Hi there! > I would like to know if there is a way to recover the nucleotides and their positions in the database sequences that are divergent from query, by Search::IO. > What I need are: > - the nucleotides > - their positions in DB sequences > - the positions of mismatches and gaps that they are related. > > thank you very much, > > Rondon > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason.stajich at gmail.com jason at bioperl.org From gwo at well.ox.ac.uk Fri Oct 5 17:06:29 2012 From: gwo at well.ox.ac.uk (Georg Otto) Date: Fri, 05 Oct 2012 22:06:29 +0100 Subject: [Bioperl-l] Bio::DB::Sam error: undefined symbol: Perl_Gthr_key_ptr Message-ID: Hi I have a problem using Bio::DB::Sam Like other perl modules I installed Bio-SamTools-1.36 in my home directory, since I do not have administration rights to the server I am using. When I call use Bio::DB::Sam I get the following error: /usr/local/bin/perl: symbol lookup error: /home/gwo/perl/modules/lib/perl/5.10.1/auto/Clone/Clone.so: undefined symbol: Perl_Gthr_key_ptr Both Bio::DB::Sam and Clone.pm were installed under the same version of perl (perl v5.10.1, Ubuntu 11.04) Any idea what is going on? Best wishes, Georg From dan.nasko at gmail.com Mon Oct 8 13:45:00 2012 From: dan.nasko at gmail.com (Dan Nasko) Date: Mon, 8 Oct 2012 13:45:00 -0400 Subject: [Bioperl-l] Update of SeqIO:: fastq Module for PacBio In-Reply-To: References: <58001297-BD1D-460C-8749-B9DCA683A557@gmail.com> <002159B2-0A4A-4B7B-863C-EE26D21088DE@gmail.com> Message-ID: <498530C9-2426-4BC0-A088-367625255C0A@gmail.com> Peter, One of the folks at PacBio got back to me this weekend saying that the FASTQ encoding bug will be fixed in an upcoming software release. When I asked him how they were fixing it he said "The QVs are now being clipped at 89." Needless to say I'm extremely skeptical of these quality values. Dan On Sep 30, 2012, at 6:38 PM, Peter Cock wrote: > Hi Dan, > > Did you get any reply from PacBio? > > Re: http://lists.open-bio.org/pipermail/bioperl-l/2012-September/036778.html > > Thanks, > > Peter > > On Thu, Sep 20, 2012 at 7:00 PM, Dan Nasko wrote: >> Peter, >> >> Here is Frank Boellmann's email, he's a Field Application Specialist and >> Bioinformatician at PacBio who is generally great at resolving these issues: >> fboellmann at pacificbiosciences.com >> >> I've gone ahead and contacted another one of their software engineers and am >> waiting for a response from him. >> >> Dan From l.m.timmermans at students.uu.nl Mon Oct 8 14:40:49 2012 From: l.m.timmermans at students.uu.nl (Leon Timmermans) Date: Mon, 8 Oct 2012 20:40:49 +0200 Subject: [Bioperl-l] Bio::DB::Sam error: undefined symbol: Perl_Gthr_key_ptr In-Reply-To: References: Message-ID: On Fri, Oct 5, 2012 at 11:06 PM, Georg Otto wrote: > Hi > > I have a problem using Bio::DB::Sam > > > Like other perl modules I installed Bio-SamTools-1.36 in my home > directory, since I do not have administration rights to the server I am > using. When I call > > use Bio::DB::Sam > > I get the following error: > > /usr/local/bin/perl: symbol lookup error: /home/gwo/perl/modules/lib/perl/5.10.1/auto/Clone/Clone.so: undefined symbol: Perl_Gthr_key_ptr > > Both Bio::DB::Sam and Clone.pm were installed under the same version of > perl (perl v5.10.1, Ubuntu 11.04) > > Any idea what is going on? > > Best wishes, > > Georg This is definitely a mixup of perls.I guess you have compiled Bio-SamTools for your system's perl (which is threaded), but try to run in on the perl in /usr/local (which is apparently unthreaded. That doesn't work. The easiest fix may be to change ?#! /usr/local/bin/perl? in your script to ?/usr/bin/perl?. Leon From gwo at well.ox.ac.uk Mon Oct 8 16:23:56 2012 From: gwo at well.ox.ac.uk (Georg Otto) Date: Mon, 08 Oct 2012 21:23:56 +0100 Subject: [Bioperl-l] Bio::DB::Sam error: undefined symbol: Perl_Gthr_key_ptr References: Message-ID: Leon Timmermans writes: > On Fri, Oct 5, 2012 at 11:06 PM, Georg Otto wrote: >> I get the following error: >> >> /usr/local/bin/perl: symbol lookup error: >> /home/gwo/perl/modules/lib/perl/5.10.1/auto/Clone/Clone.so: >> undefined symbol: Perl_Gthr_key_ptr >> >> Both Bio::DB::Sam and Clone.pm were installed under the same version of >> perl (perl v5.10.1, Ubuntu 11.04) >> > > This is definitely a mixup of perls.I guess you have compiled > Bio-SamTools for your system's perl (which is threaded), but try to > run in on the perl in /usr/local (which is apparently unthreaded. That > doesn't work. The easiest fix may be to change ?#! > /usr/local/bin/perl? in your script to ?/usr/bin/perl?. > thanks a lot, that did the trick! georg -- Georg Otto The Wellcome Trust Centre for Human Genetics From p.j.a.cock at googlemail.com Tue Oct 9 04:29:56 2012 From: p.j.a.cock at googlemail.com (Peter Cock) Date: Tue, 9 Oct 2012 09:29:56 +0100 Subject: [Bioperl-l] Update of SeqIO:: fastq Module for PacBio In-Reply-To: <498530C9-2426-4BC0-A088-367625255C0A@gmail.com> References: <58001297-BD1D-460C-8749-B9DCA683A557@gmail.com> <002159B2-0A4A-4B7B-863C-EE26D21088DE@gmail.com> <498530C9-2426-4BC0-A088-367625255C0A@gmail.com> Message-ID: On Mon, Oct 8, 2012 at 6:45 PM, Dan Nasko wrote: > Peter, > > One of the folks at PacBio got back to me this weekend saying > that the FASTQ encoding bug will be fixed in an upcoming software > release. > > When I asked him how they were fixing it he said "The QVs are now > being clipped at 89." Needless to say I'm extremely skeptical of these > quality values. Me too - but great to hear they're fixing their FASTQ :) Thanks! Peter From maurya_shailesh at network.lilly.com Tue Oct 9 09:02:22 2012 From: maurya_shailesh at network.lilly.com (Shailesh Maurya - Network) Date: Tue, 9 Oct 2012 13:02:22 +0000 Subject: [Bioperl-l] Please help me on the piece of code throwing exception Message-ID: <66724E5AB9FBF2459C26FCEFC7012314020B90B7@USTLMLLYC102.rf.lilly.com> Hi, I'm trying to execute a script for downloading rna sequences of Cricetulus griseus from NCBI site using eutils. But while execution I'm stuck up with the exceptions. Here's the script and the exception it is throwing - ***** #!/usr/local/bin/perl use Bio::DB::EUtilities; use Error qw(:try); try { # set optional history queue my $factory = Bio::DB::EUtilities->new(-eutil => 'esearch', -email => 'maurya_shailesh at network.lilly.com', -db => 'nuccore', -term => 'Cricetulus griseus[porgn:__txid10029] AND mrna', -usehistory => 'y'); my $count = $factory->get_count; # get history from queue my $hist = $factory->next_History || die 'No history data returned'; print "History returned\n"; # note db carries over from above $factory->set_parameters(-eutil => 'efetch', -rettype => 'fasta', -history => $hist); my $retry = 0; my ($retmax, $retstart) = (500,0); open (my $out, '>', 'seqs_rna') || die "Can't open file:$!"; RETRIEVE_SEQS: while ($retstart < $count) { $factory->set_parameters(-retmax => $retmax, -retstart => $retstart); eval{ $factory->get_Response(-cb => sub {my ($data) = @_; print $out $data} ); }; if ($@) { die "Server error: $@. Try again later" if $retry == 5; print STDERR "Server error, redo #$retry\n"; $retry++ && redo RETRIEVE_SEQS; } print "Retrieved $retstart"; $retstart += $retmax; } close $out; } catch Bio::Root::Exception with { my $err = shift; print "A Bioperl exception has occured:\n$err\n"; }; ***** And the exception is - A Bioperl exception has occured: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Response Error Can't connect to eutils.ncbi.nlm.nih.gov:80 (timeout) STACK: Error::throw STACK: Bio::Root::Root::throw /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/Root/Root.pm:368 STACK: Bio::DB::GenericWebAgent::get_Response /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/GenericWebAgent.pm:215 STACK: Bio::DB::EUtilities::get_Parser /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:222 STACK: Bio::DB::EUtilities::get_count /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:580 STACK: load.pl:15 ----------------------------------------------------------- Please help me on this piece of code. Also there is humble request to suggest some other logic or script to perform the task. Hope for a positive response. -- Thanks and Regards, Shailesh Maurya LRL IT COE Eli Lilly ODC @ TCS, Noida 2, India Work :+91-9911666572 EMail: maurya_shailesh at network.lilly.com From stefan.kirov at bms.com Tue Oct 9 09:45:21 2012 From: stefan.kirov at bms.com (Stefan Kirov) Date: Tue, 09 Oct 2012 09:45:21 -0400 Subject: [Bioperl-l] Position at Bristol Myers Squibb Message-ID: <50742A71.9040506@bms.com> I apologise for spamming the list. We need a person with expert knowledge in Perl, Javascript, HTML, CSS and relational databases (preferably Oracle or PG). Knowledge of bioperl is also required (obviously ;-) ). If you are interested or know anyone who is interested- please send a CV (to stefan\.kirov at bms\.com) and I will send you the full details about the position. This position is located in Pennington, NJ, USA. Cheers! Stefan KIrov From jason.stajich at gmail.com Tue Oct 9 12:23:02 2012 From: jason.stajich at gmail.com (Jason Stajich) Date: Tue, 9 Oct 2012 09:23:02 -0700 Subject: [Bioperl-l] Please help me on the piece of code throwing exception In-Reply-To: References: <66724E5AB9FBF2459C26FCEFC7012314020B90B7@USTLMLLYC102.rf.lilly.com> Message-ID: Do you have a proxy server at your network connection? It appears you cannot reach website - you can set proxy server with the http_proxy environment variable I believe. http://www.bioperl.org/wiki/Installing_BioPerl_on_Unix Do other simple queries with Bio::DB::GenBank work for you that do not use eutils? Jason Stajich > jason at bioperl.org > http://bioperl.org/wiki/User:Jason > > > > On Tue, Oct 9, 2012 at 6:02 AM, Shailesh Maurya - Network < > maurya_shailesh at network.lilly.com> wrote: > >> Hi, >> >> >> >> I'm trying to execute a script for downloading rna sequences of >> Cricetulus griseus from NCBI site using eutils. But while execution I'm >> stuck up with the exceptions. Here's the script and the exception it is >> throwing - >> >> >> >> ***** >> >> #!/usr/local/bin/perl >> use Bio::DB::EUtilities; >> use Error qw(:try); >> >> >> >> try { >> # set optional history queue >> my $factory = Bio::DB::EUtilities->new(-eutil => 'esearch', >> -email => ' >> maurya_shailesh at network.lilly.com'> maurya_shailesh at network.lilly.com'>, >> -db => 'nuccore', >> -term => 'Cricetulus >> griseus[porgn:__txid10029] AND mrna', >> -usehistory => 'y'); >> >> my $count = $factory->get_count; >> # get history from queue >> my $hist = $factory->next_History || die 'No history data returned'; >> print "History returned\n"; >> # note db carries over from above >> $factory->set_parameters(-eutil => 'efetch', >> -rettype => 'fasta', >> -history => $hist); >> >> my $retry = 0; >> my ($retmax, $retstart) = (500,0); >> >> open (my $out, '>', 'seqs_rna') || die "Can't open file:$!"; >> >> RETRIEVE_SEQS: >> while ($retstart < $count) { >> $factory->set_parameters(-retmax => $retmax, >> -retstart => $retstart); >> eval{ >> $factory->get_Response(-cb => sub {my ($data) = @_; print $out >> $data} ); >> }; >> if ($@) { >> die "Server error: $@. Try again later" if $retry == 5; >> print STDERR "Server error, redo #$retry\n"; >> $retry++ && redo RETRIEVE_SEQS; >> } >> print "Retrieved $retstart"; >> $retstart += $retmax; >> } >> >> close $out; >> } >> catch Bio::Root::Exception with { >> my $err = shift; >> print "A Bioperl exception has occured:\n$err\n"; >> }; >> >> ***** >> >> And the exception is - >> >> >> >> A Bioperl exception has occured: >> >> ------------- EXCEPTION: Bio::Root::Exception ------------- >> MSG: Response Error >> Can't connect to eutils.ncbi.nlm.nih.gov:80 (timeout) >> STACK: Error::throw >> STACK: Bio::Root::Root::throw >> /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/Root/Root.pm:368 >> STACK: Bio::DB::GenericWebAgent::get_Response >> /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/GenericWebAgent.pm:215 >> STACK: Bio::DB::EUtilities::get_Parser >> /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:222 >> STACK: Bio::DB::EUtilities::get_count >> /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:580 >> STACK: load.pl:15 >> ----------------------------------------------------------- >> >> >> >> Please help me on this piece of code. Also there is humble request to >> suggest some other logic or script to perform the task. >> >> >> >> Hope for a positive response. >> >> >> >> -- >> >> Thanks and Regards, >> >> Shailesh Maurya >> LRL IT COE >> Eli Lilly ODC @ TCS, Noida 2, India >> Work :+91-9911666572 >> EMail: maurya_shailesh at network.lilly.com> maurya_shailesh at network.lilly.com> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > From cjfields at illinois.edu Tue Oct 9 15:13:28 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 9 Oct 2012 19:13:28 +0000 Subject: [Bioperl-l] Please help me on the piece of code throwing exception In-Reply-To: <66724E5AB9FBF2459C26FCEFC7012314020B90B7@USTLMLLYC102.rf.lilly.com> References: <66724E5AB9FBF2459C26FCEFC7012314020B90B7@USTLMLLYC102.rf.lilly.com> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC51DB4@CHIMBX5.ad.uillinois.edu> The error returned indicates this may be an intermittent issue on NCBI's end, but it could also be a proxy issue as Jason pointed out (so try it again, and try it with proxy settings as Jason indicated). Locally this is working for me at the moment, though I admittedly removed the Error stuff (I try to avoid using that particular module). chris On Oct 9, 2012, at 8:02 AM, Shailesh Maurya - Network wrote: > Hi, > > > > I'm trying to execute a script for downloading rna sequences of Cricetulus griseus from NCBI site using eutils. But while execution I'm stuck up with the exceptions. Here's the script and the exception it is throwing - > > > > ***** > > #!/usr/local/bin/perl > use Bio::DB::EUtilities; > use Error qw(:try); > > > > try { > # set optional history queue > my $factory = Bio::DB::EUtilities->new(-eutil => 'esearch', > -email => 'maurya_shailesh at network.lilly.com', > -db => 'nuccore', > -term => 'Cricetulus griseus[porgn:__txid10029] AND mrna', > -usehistory => 'y'); > > my $count = $factory->get_count; > # get history from queue > my $hist = $factory->next_History || die 'No history data returned'; > print "History returned\n"; > # note db carries over from above > $factory->set_parameters(-eutil => 'efetch', > -rettype => 'fasta', > -history => $hist); > > my $retry = 0; > my ($retmax, $retstart) = (500,0); > > open (my $out, '>', 'seqs_rna') || die "Can't open file:$!"; > > RETRIEVE_SEQS: > while ($retstart < $count) { > $factory->set_parameters(-retmax => $retmax, > -retstart => $retstart); > eval{ > $factory->get_Response(-cb => sub {my ($data) = @_; print $out $data} ); > }; > if ($@) { > die "Server error: $@. Try again later" if $retry == 5; > print STDERR "Server error, redo #$retry\n"; > $retry++ && redo RETRIEVE_SEQS; > } > print "Retrieved $retstart"; > $retstart += $retmax; > } > > close $out; > } > catch Bio::Root::Exception with { > my $err = shift; > print "A Bioperl exception has occured:\n$err\n"; > }; > > ***** > > And the exception is - > > > > A Bioperl exception has occured: > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: Response Error > Can't connect to eutils.ncbi.nlm.nih.gov:80 (timeout) > STACK: Error::throw > STACK: Bio::Root::Root::throw /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/Root/Root.pm:368 > STACK: Bio::DB::GenericWebAgent::get_Response /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/GenericWebAgent.pm:215 > STACK: Bio::DB::EUtilities::get_Parser /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:222 > STACK: Bio::DB::EUtilities::get_count /usr/local/perl-5.12.1/lib/site_perl/5.12.1/Bio/DB/EUtilities.pm:580 > STACK: load.pl:15 > ----------------------------------------------------------- > > > > Please help me on this piece of code. Also there is humble request to suggest some other logic or script to perform the task. > > > > Hope for a positive response. > > > > -- > > Thanks and Regards, > > Shailesh Maurya > LRL IT COE > Eli Lilly ODC @ TCS, Noida 2, India > Work :+91-9911666572 > EMail: maurya_shailesh at network.lilly.com > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From e.osimo at gmail.com Wed Oct 10 04:30:02 2012 From: e.osimo at gmail.com (Emanuele F. Osimo) Date: Wed, 10 Oct 2012 10:30:02 +0200 Subject: [Bioperl-l] Best BLAT Message-ID: Dear all, which is the best BLAT Perl wrapper? Thanks Emanuele F Osimo From hlapp at drycafe.net Wed Oct 10 16:31:04 2012 From: hlapp at drycafe.net (Hilmar Lapp) Date: Wed, 10 Oct 2012 16:31:04 -0400 Subject: [Bioperl-l] Fwd: [Announce] Call for Proposals for Doc Sprint Summit v2.0 References: Message-ID: If you've been a Google Summer of Code mentor this year or last year, you will have already seen this. I wanted to make sure everybody is aware, and this may provide the opportunity for the kind of concerted effort that could finally get a BioPerl, Biopython, Bioruby, or Biojava (or a combined??) off the ground. -hilmar Begin forwarded message: From: Carol Smith Subject: [GSoC Mentors] [Announce] Call for Proposals for Doc Sprint Summit v2.0 Date: October 10, 2012 2:44:50 PM EDT To: Google Summer of Code Mentors List Cc: adam at flossmanuals.net Dear GSoC mentors and org admins, Google Summer of Code in collaboration with Aspiration and FLOSS Manuals is hosting a "Doc Sprint Camp" at Google's Mountain View headquarters (California) Dec 3 - 7, 2012. The 2012 Doc Camp will feature: 1) An unconference on free software documentation topics - facilitated by Aspiration 2) 2-5 Book Sprints to produce books on free softwares - facilitated by FLOSS Manuals Building on the success of the 2011 GSoC Doc Camp we are proud to bring you the 2012 GSoC Doc Camp. Like the previous event the 2012 GSoC Doc Camp is a place for free software communities to meet, create a book for their project, attract new people to their efforts, and share their documentation experiences. The camp aims to improve free documentation materials and skills in free software projects and individuals and help form the identity of the emergent free documentation sector. Individuals and projects can apply. Food and accommodation for all individuals will be provided and travel support (full or partial) can also be applied for. Be a part of this exciting event ? propose a Book Sprint on your favorite free software or come and help others write a book on their favorite project. Guaranteed to be a lot of fun, productive, and a fantastic place to advance your documentation efforts and experiences. For more information or to register to take part, please see https://sites.google.com/site/docsprintsummitv2/. Please note proposals are due by October 26, so get yours in ASAP! Cheers, Carol Smith, Allen Gunn, Adam Hyde -- You received this message because you are subscribed to the Google Groups "Google Summer of Code Mentors List" group. To post to this group, send email to google-summer-of-code-mentors-list at googlegroups.com. To unsubscribe from this group, send email to google-summer-of-code-mentors-list+unsubscribe at googlegroups.com. For more options, visit this group at http://groups.google.com/group/google-summer-of-code-mentors-list?hl=en. -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- informatics.nescent.org : =========================================================== -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at drycafe dot net : =========================================================== From amiranda65 at gmail.com Tue Oct 9 16:15:39 2012 From: amiranda65 at gmail.com (Alexandre Miranda) Date: Tue, 9 Oct 2012 22:15:39 +0200 Subject: [Bioperl-l] Fitch methode Message-ID: Hello, I desperately try to implement the methode Fitch from the library Bio:Tree:Statistics. But I cannot understand what kind of parameter I should used for the $key value : fitch($tree, $key, $node); Can you please send me a sample of code using that methode ? thanks for your quick reply. Best Regards, Alexandre From jason.stajich at gmail.com Thu Oct 11 01:24:29 2012 From: jason.stajich at gmail.com (Jason Stajich) Date: Wed, 10 Oct 2012 22:24:29 -0700 Subject: [Bioperl-l] Fitch methode In-Reply-To: References: Message-ID: It assumes that you have assigned trait values to all nodes in the tree, the key is assigned when you do an add_trait on a tree. You can see how to add traits and some sample data if you look in the t/Tree/Statistics.t code and you'll see the assignment of the $key my $key = $tree->add_trait(test_input_file('traits.tab')); >From the documentation: Tree?Trait statistics The following methods produce descriptors of trait distribution among leaf nodes within the trees. They require that a trait has been set for each leaf node. The tag methods of Bio::Tree::Node are used to store them as key/value pairs. In this way, one tree can store more than one trait. Trees have method add_traits() to set trait values from a file. See the add_trait() method in Bio::Tree::TreeFunctionsI. fitch Example : fitch($tree, $key, $node); Description: Calculates Parsimony Score (PS) and internal trait values using the Fitch 1971 parsimony algorithm for the subtree a defined by the (internal) node. Node defaults to the root. Returns : true on success Exceptions : leaf nodes have to have the trait defined Args : 1. Bio::Tree::TreeI object 2. trait name string 3. Bio::Tree::NodeI object within the tree, optional Runs first fitch_up that calculates parsimony scores and then fitch_down that should resolve most of the trait/character state ambiguities. Fitch, W.M., 1971. Toward defining the course of evolution: minimal change for a specific tree topology. Syst. Zool. 20, 406?416. You can access calculated parsimony values using: $score = $node?>?>get_tag_values('ps_score'); and the trait value with: $traitvalue = $node?>?>get_tag_values('ps_trait'); # only the first @traitvalues = $node?>?>get_tag_values('ps_trait'); Note that there can be more that one trait value, especially for the root node. Documentation rendered in Pdoc: http://docs.bioperl.org/bioperl-live/Bio/Tree/Statistics.html#POD3 Here is the documentation for add_traits from the add_trait Title : add_trait Usage : my $key = $tree?>add_trait($trait_file, 3); Function: Add traits to the leaf nodes of a Bio::Tree:Tree from a file. The trait file is a tab?delimited text file and needs to have a header line giving names to traits. The first column contains the leaf node ids. Subsequent columns contain different trait value sets. Single or double quotes are removed from the trait values. Traits are added to leaf nodes as a tag named $key using the add_tag_value() method. This means that you can retrieve the trait values using the get_tag_values() method (see the documentation for Bio::Tree::Node). Returns : Trait name (a scalar) on success, undef on failure (for example, if the column index requested was too large). Args : * Name of trait file (scalar string). * Index of trait file column (scalar int). Note that numbering starts at 0. Default: 1 (second column). * Ignore missing values. Typically, if a leaf node has no value in the trait file, an exception is thrown. If you set this option to 1, then no trait will be given to the node (no exception thrown). also see the documentation rendered in Pdoc: http://docs.bioperl.org/bioperl-live/Bio/Tree/TreeFunctionsI.html#POD19 On Oct 9, 2012, at 1:15 PM, Alexandre Miranda wrote: > Hello, > > I desperately try to implement the methode Fitch from the library > Bio:Tree:Statistics. > > But I cannot understand what kind of parameter I should used for the $key > value : fitch($tree, $key, $node); > > Can you please send me a sample of code using that methode ? > > thanks for your quick reply. > > Best Regards, > > Alexandre > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason.stajich at gmail.com jason at bioperl.org From cmacken at lanl.gov Mon Oct 15 14:54:21 2012 From: cmacken at lanl.gov (Catherine Macken) Date: Mon, 15 Oct 2012 12:54:21 -0600 Subject: [Bioperl-l] Posting job announcement Message-ID: <507C5BDD.5030509@lanl.gov> Hello: I am seeking a graduate intern with strong perl skills in a genetic sequence analysis context. It was suggested to me that I post my job announcement to the bioperl listserv. I am attaching an announcement here and would appreciate your posting it for me. Thank you, Catherine Macken ___________________________________ Catherine Macken, Ph.D. Staff member Theoretical Biology and Biophysics Los Alamos National Laboratory PH: (505)665-6464 FAX: (505)665-3493 -------------- next part -------------- A non-text attachment was scrubbed... Name: JobAnnouncement_101512.pdf Type: application/pdf Size: 49236 bytes Desc: not available URL: From thomas.sharpton at gmail.com Mon Oct 15 16:26:26 2012 From: thomas.sharpton at gmail.com (Thomas Sharpton) Date: Mon, 15 Oct 2012 13:26:26 -0700 Subject: [Bioperl-l] More job spam: Gladstone Institutes at UCSF Message-ID: Dear BioPerlers, My postdoctoral advisor - Dr. Katherine Pollard - and I are looking for a talented bioinformatician to join her group at the Gladstone Institutes at the University of California, San Francisco. Details about the position can be found via the following link: http://gladstone.interviewexchange.com/jobofferdetails.jsp?JOBID=35377 I have also pasted the announcement below my signature. Please free to distribute this announcement. Best (and sorry for the spam), Tom Postdoctoral Fellow Pollard Lab Gladstone Institutes at UCSF ----- The Gladstone Institutes is an independent, not-for-profit research institution affiliated with the University of California San Francisco (UCSF), contributing to the health and well being of all people through medical research, education, and outreach in the areas of heart disease, HIV/AIDS, and neurological disease. Gladstone is composed of three separate institutes and approximately 350 employees. Our employees receive exceptional benefits. We are located in an award winning building adjacent to UCSF's Mission Bay Campus. Gladstone has consistently ranked as one of the top places to work in academia in the United States. The Gladstone Bioinformatics group provides an active environment for developing solutions from experimental design to analysis and visualization. ** ** Job Description: We are recruiting a staff scientist to support the bioinformatics needs at Gladstone. Main duties will involve developing and maintaining scientific databases and performing data analysis of large-scale genomic data. Primary projects will include developing tools for analysis of metagenomics data (from human body sites and environmental samples) and designing pipelines for next-generation human genomics and epigenomics research. The candidate will interact with labs spanning all Gladstone Institutes. ** ** Requirements: The candidate should have a BS/MS in Bioinformatics, Computer Science or similar field and at least 2 years experience with MySQL or other relational database software and scripting languages (e.g., Perl, Python, shell scripting). Experience with analysis of large biological datasets, including developing pipelines for analysis using a scripting language in a Linux environment is required. Knowledge of programming languages (e.g., Java, C/C++) and best practices is also important. Additional useful experience includes the ability to work in a distributed computing environment using a queuing system such as SGE or PBS and a demonstrated ability to create data visualization tools. We need a good communicator who can work across disciplines, and a self-starter who can work effectively on projects with long development times. Please address how your experience fulfills these requirements in a cover letter and/or resume.**** ** ** Candidates with relevant expertise who wish to join Gladstone?s mission of preventing, treating and curing some of the world?s most relentless diseases should send their curriculum vitae and contact information for three references. From maj at fortinbras.us Mon Oct 15 22:51:56 2012 From: maj at fortinbras.us (Mark A. Jensen) Date: Tue, 16 Oct 2012 02:51:56 +0000 Subject: [Bioperl-l] More job spam: Gladstone Institutes at UCSF Message-ID: IMO, no post that offers legitimate cash could possibly be spam-MAJ -------------------------- Mark A. Jensen, PhD Senior Consultant Fortinbras Research http://www.fortinbras.us >-----Original Message----- >From: Thomas Sharpton [mailto:thomas.sharpton at gmail.com] >Sent: Monday, October 15, 2012 04:26 PM >To: 'BioPerl List' >Subject: [Bioperl-l] More job spam: Gladstone Institutes at UCSF > >Dear BioPerlers, > >My postdoctoral advisor - Dr. Katherine Pollard - and I are looking for a >talented bioinformatician to join her group at the Gladstone Institutes at >the University of California, San Francisco. Details about the position can >be found via the following link: > >http://gladstone.interviewexchange.com/jobofferdetails.jsp?JOBID=35377 > >I have also pasted the announcement below my signature. > >Please free to distribute this announcement. > >Best (and sorry for the spam), >Tom > >Postdoctoral Fellow >Pollard Lab >Gladstone Institutes at UCSF >----- > > >The Gladstone Institutes is an independent, not-for-profit research >institution affiliated with the University of California San Francisco (UCSF), >contributing to the health and well being of all people through medical >research, education, and outreach in the areas of heart disease, HIV/AIDS, >and neurological disease. Gladstone is composed of three separate >institutes and approximately 350 employees. Our employees receive >exceptional benefits. We are located in an award winning building adjacent >to UCSF's Mission Bay Campus. Gladstone has consistently ranked as one of >the top places to work in academia in the United States. The Gladstone >Bioinformatics group provides an active environment for developing >solutions from experimental design to analysis and visualization. > >** ** > >Job Description: > >We are recruiting a staff scientist to support the bioinformatics needs at >Gladstone. Main duties will involve developing and maintaining scientific >databases and performing data analysis of large-scale genomic data. Primary >projects will include developing tools for analysis of metagenomics data >(from human body sites and environmental samples) and designing pipelines >for next-generation human genomics and epigenomics research. The candidate >will interact with labs spanning all Gladstone Institutes. > >** ** > >Requirements: > >The candidate should have a BS/MS in Bioinformatics, Computer Science or >similar field and at least 2 years experience with MySQL or other >relational database software and scripting languages (e.g., Perl, Python, >shell scripting). Experience with analysis of large biological datasets, >including developing pipelines for analysis using a scripting language in a >Linux environment is required. Knowledge of programming languages (e.g., >Java, C/C++) and best practices is also important. Additional useful >experience includes the ability to work in a distributed computing >environment using a queuing system such as SGE or PBS and a demonstrated >ability to create data visualization tools. We need a good communicator who >can work across disciplines, and a self-starter who can work effectively on >projects with long development times. Please address how your experience >fulfills these requirements in a cover letter and/or resume.**** > >** ** > >Candidates with relevant expertise who wish to join Gladstone?s mission of >preventing, treating and curing some of the world?s most relentless >diseases should send their curriculum vitae and contact information for >three references. > >_______________________________________________ >Bioperl-l mailing list >Bioperl-l at lists.open-bio.org >http://lists.open-bio.org/mailman/listinfo/bioperl-l > From thomas.sharpton at gmail.com Mon Oct 15 23:13:02 2012 From: thomas.sharpton at gmail.com (Thomas Sharpton) Date: Mon, 15 Oct 2012 20:13:02 -0700 Subject: [Bioperl-l] More job spam: Gladstone Institutes at UCSF In-Reply-To: References: Message-ID: I appreciate hearing that, Mark. As our group relies heavily on BioPerl, I figure this position is particularly relevant to the list. All the best, Tom On Mon, Oct 15, 2012 at 7:51 PM, Mark A. Jensen wrote: > IMO, no post that offers legitimate cash could possibly be spam-MAJ > -------------------------- > Mark A. Jensen, PhD > Senior Consultant > Fortinbras Research > http://www.fortinbras.us > > >-----Original Message----- > >From: Thomas Sharpton [mailto:thomas.sharpton at gmail.com] > >Sent: Monday, October 15, 2012 04:26 PM > >To: 'BioPerl List' > >Subject: [Bioperl-l] More job spam: Gladstone Institutes at UCSF > > > >Dear BioPerlers, > > > >My postdoctoral advisor - Dr. Katherine Pollard - and I are looking for a > >talented bioinformatician to join her group at the Gladstone Institutes at > >the University of California, San Francisco. Details about the position > can > >be found via the following link: > > > >http://gladstone.interviewexchange.com/jobofferdetails.jsp?JOBID=35377 > > > >I have also pasted the announcement below my signature. > > > >Please free to distribute this announcement. > > > >Best (and sorry for the spam), > >Tom > > > >Postdoctoral Fellow > >Pollard Lab > >Gladstone Institutes at UCSF > >----- > > > > > >The Gladstone Institutes is an independent, not-for-profit research > >institution affiliated with the University of California San Francisco > (UCSF), > >contributing to the health and well being of all people through medical > >research, education, and outreach in the areas of heart disease, HIV/AIDS, > >and neurological disease. Gladstone is composed of three separate > >institutes and approximately 350 employees. Our employees receive > >exceptional benefits. We are located in an award winning building adjacent > >to UCSF's Mission Bay Campus. Gladstone has consistently ranked as one of > >the top places to work in academia in the United States. The Gladstone > >Bioinformatics group provides an active environment for developing > >solutions from experimental design to analysis and visualization. > > > >** ** > > > >Job Description: > > > >We are recruiting a staff scientist to support the bioinformatics needs at > >Gladstone. Main duties will involve developing and maintaining scientific > >databases and performing data analysis of large-scale genomic data. > Primary > >projects will include developing tools for analysis of metagenomics data > >(from human body sites and environmental samples) and designing pipelines > >for next-generation human genomics and epigenomics research. The candidate > >will interact with labs spanning all Gladstone Institutes. > > > >** ** > > > >Requirements: > > > >The candidate should have a BS/MS in Bioinformatics, Computer Science or > >similar field and at least 2 years experience with MySQL or other > >relational database software and scripting languages (e.g., Perl, Python, > >shell scripting). Experience with analysis of large biological datasets, > >including developing pipelines for analysis using a scripting language in > a > >Linux environment is required. Knowledge of programming languages (e.g., > >Java, C/C++) and best practices is also important. Additional useful > >experience includes the ability to work in a distributed computing > >environment using a queuing system such as SGE or PBS and a demonstrated > >ability to create data visualization tools. We need a good communicator > who > >can work across disciplines, and a self-starter who can work effectively > on > >projects with long development times. Please address how your experience > >fulfills these requirements in a cover letter and/or resume.**** > > > >** ** > > > >Candidates with relevant expertise who wish to join Gladstone?s mission of > >preventing, treating and curing some of the world?s most relentless > >diseases should send their curriculum vitae and contact information for > >three references. > > > >_______________________________________________ > >Bioperl-l mailing list > >Bioperl-l at lists.open-bio.org > >http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > From wrp at virginia.edu Wed Oct 17 09:30:21 2012 From: wrp at virginia.edu (William Pearson) Date: Wed, 17 Oct 2012 09:30:21 -0400 Subject: [Bioperl-l] PAM30 with remoteBlast searches Message-ID: I diagnosed the problem with BLASTP searches using PAM30. When I copied the $request->as_string and sent it directly to the NCBI Blast server, I received the following error message: Message ID#35 Error: Cannot validate the Blast options: Gap existence and extension values of 11 and 1 not supported for PAM30 supported values are: 32767, 32767 7, 2 6, 2 5, 2 10, 1 9, 1 8, 1 Thus, when setting: $Bio::Tools::Run::RemoteBlast::HEADER{'MATRIX_NAME'} = "PAM30"; one must also adjust the gap penalties: $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'} = "9 1"; Bill Pearson From wrp at virginia.edu Wed Oct 17 09:31:58 2012 From: wrp at virginia.edu (William Pearson) Date: Wed, 17 Oct 2012 09:31:58 -0400 Subject: [Bioperl-l] PAM30 with remoteBlast searches References: Message-ID: I diagnosed the problem with BLASTP searches using PAM30. When I copied the $request->as_string and sent it directly to the NCBI Blast server, I received the following error message: Message ID#35 Error: Cannot validate the Blast options: Gap existence and extension values of 11 and 1 not supported for PAM30 supported values are: 32767, 32767 7, 2 6, 2 5, 2 10, 1 9, 1 8, 1 Thus, when setting: $Bio::Tools::Run::RemoteBlast::HEADER{'MATRIX_NAME'} = "PAM30"; one must also adjust the gap penalties: $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'} = "9 1"; Bill Pearson From campbell.malachy at gmail.com Wed Oct 17 21:47:20 2012 From: campbell.malachy at gmail.com (Malachy Campbell) Date: Wed, 17 Oct 2012 20:47:20 -0500 Subject: [Bioperl-l] Remote Blast against RefSeq_mrna db (Bio::Tools::Run::RemoteBlast) Message-ID: <507F5FA8.6060704@gmail.com> Hello all, I would like to run a remote blast search against the RefSeq_mrna database using the script below. Everything seems to work smoothly if I use nt or other databases, however if I search against the RefSeq_mrna db (typing refseq_rna when prompted) my output file cannot be opened. Is there a specific designation for the RefSeq_mrna db in Bio::Tools::Run::RemoteBlast? The link http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html is no longer available. Any suggestions would be appreciated, Mack From cjfields at illinois.edu Wed Oct 17 23:25:52 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Thu, 18 Oct 2012 03:25:52 +0000 Subject: [Bioperl-l] Remote Blast against RefSeq_mrna db (Bio::Tools::Run::RemoteBlast) In-Reply-To: <507F5FA8.6060704@gmail.com> References: <507F5FA8.6060704@gmail.com> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC5CAEE@CHIMBX5.ad.uillinois.edu> The below script using Bio::DB::EUtilities will get you some results, all in nice readable XML output. Unfortunately at the moment this is only given in NCBI's DocSum v2.0 (which we don't actively parse), so you will have to munge out the path for the database of interest. (BTW, I think NCBI doing this is a great thing, at least it's searchable and kept up-to-date, we just need to actively start supporting it) chris --------------------------------------- #!/usr/bin/env perl use Modern::Perl; use Bio::DB::EUtilities; my $eutil = Bio::DB::EUtilities->new(-eutil => 'esearch', -term => '"refseq rna"', -email => 'cjfields at bioperl.org', -db => 'blastdbinfo', -usehistory => 'y'); my $hist = $eutil->next_History || die "No history returned"; $eutil->set_parameters(-eutil => 'esummary', -history => $hist, -version => '1.0'); say $eutil->get_Response->content; On Oct 17, 2012, at 8:47 PM, Malachy Campbell wrote: > Hello all, > I would like to run a remote blast search against the RefSeq_mrna database using the script below. Everything seems to work smoothly if I use nt or other databases, however if I search against the RefSeq_mrna db (typing refseq_rna when prompted) my output file cannot be opened. Is there a specific designation for the RefSeq_mrna db in Bio::Tools::Run::RemoteBlast? The link http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html is no longer available. > > Any suggestions would be appreciated, > Mack > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From yang.liu0508 at gmail.com Sat Oct 20 01:23:15 2012 From: yang.liu0508 at gmail.com (yang liu) Date: Sat, 20 Oct 2012 01:23:15 -0400 Subject: [Bioperl-l] how to rename genbank header in fasta file? Message-ID: Hello, I am a new user of BioPerl, can anyone help with this? I have multiple sequences in a fasta file like the following, >lcl|NC_014487.1_cdsid_YP_003875479.1 [gene=cox1] [protein=cytochrome c oxidase subunit 1] [protein_id=YP_003875479.1] [location=1..1575] ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >lcl|NC_014487.1_cdsid_YP_003875480.1 [gene=cox3] [protein=cytochrome c oxidase subunit 3] [protein_id=YP_003875480.1] [location=complement(13218..14015)] ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG >lcl|NC_014487.1_cdsid_YP_003875481.1 [gene=atp8] [protein=ATPase subunit 8] [protein_id=YP_003875481.1] [location=complement(15042..15548)] ATGCCTCAACTGGATAAATTTACTTATTTCACACAATTCTTCTGGTCATGCCTTTTTTTCTTTACTTTCT ATATTCTAATATGCAATGATAGAGATGGAGTACTTGGGATCAGCAGAATTCTAAAACTACGAAATCAACT I hope to rename the sequences by gene name,such as: >cox1 ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >cox3 ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG any one can help? Thanks. Yang. From jason.stajich at gmail.com Sat Oct 20 01:43:29 2012 From: jason.stajich at gmail.com (Jason Stajich) Date: Fri, 19 Oct 2012 23:43:29 -0600 Subject: [Bioperl-l] how to rename genbank header in fasta file? In-Reply-To: References: Message-ID: <5611663A-0073-4D26-9DDF-D01BAFDCDC5D@gmail.com> are you parsing exactly this file - it is in FASTA format not genbank. You don't need bioperl for this: perl -i -p -s 's/>.+\[gene=([^\]]+)\].+/>$1/' file.fa I'd read up on regular expressions and perl to learn more about how to do string replacement to learn how to do this better. On Oct 19, 2012, at 11:23 PM, yang liu wrote: > Hello, > > I am a new user of BioPerl, can anyone help with this? I have multiple > sequences in a fasta file like the following, > >> lcl|NC_014487.1_cdsid_YP_003875479.1 [gene=cox1] [protein=cytochrome c > oxidase subunit 1] [protein_id=YP_003875479.1] [location=1..1575] > ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG > GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >> lcl|NC_014487.1_cdsid_YP_003875480.1 [gene=cox3] [protein=cytochrome c > oxidase subunit 3] [protein_id=YP_003875480.1] > [location=complement(13218..14015)] > ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG > GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG > >> lcl|NC_014487.1_cdsid_YP_003875481.1 [gene=atp8] [protein=ATPase subunit > 8] [protein_id=YP_003875481.1] [location=complement(15042..15548)] > ATGCCTCAACTGGATAAATTTACTTATTTCACACAATTCTTCTGGTCATGCCTTTTTTTCTTTACTTTCT > ATATTCTAATATGCAATGATAGAGATGGAGTACTTGGGATCAGCAGAATTCTAAAACTACGAAATCAACT > > I hope to rename the sequences by gene name,such as: > >> cox1 > ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG > GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >> cox3 > ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG > GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG > > any one can help? Thanks. > > Yang. > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason.stajich at gmail.com jason at bioperl.org From kellert at ohsu.edu Sat Oct 20 13:16:15 2012 From: kellert at ohsu.edu (Tom Keller) Date: Sat, 20 Oct 2012 10:16:15 -0700 Subject: [Bioperl-l] Bioperl-l Digest, Vol 114, Issue 11 regex in message 2 In-Reply-To: References: Message-ID: <24873656-24FF-45EE-A2FF-CE54FA108AC5@ohsu.edu> The regex is clever and shows the power of regular expressions and perl. Basically, the capturing parens include a negation so it says "after gene=" save any characters except ']' until the next ']', which is exactly what you said you wanted. But I think there is a typo: the -s should be -e thanks for the nice help Jason. Tom OHSU, Portland OR On Oct 20, 2012, at 9:00 AM, > wrote: Message: 2 Date: Fri, 19 Oct 2012 23:43:29 -0600 From: Jason Stajich > Subject: Re: [Bioperl-l] how to rename genbank header in fasta file? To: yang liu > Cc: bioperl-l at lists.open-bio.org Message-ID: <5611663A-0073-4D26-9DDF-D01BAFDCDC5D at gmail.com> Content-Type: text/plain; charset=us-ascii are you parsing exactly this file - it is in FASTA format not genbank. You don't need bioperl for this: perl -i -p -s 's/>.+\[gene=([^\]]+)\].+/>$1/' file.fa I'd read up on regular expressions and perl to learn more about how to do string replacement to learn how to do this better. From jason.stajich at gmail.com Sat Oct 20 20:15:01 2012 From: jason.stajich at gmail.com (Jason Stajich) Date: Sat, 20 Oct 2012 18:15:01 -0600 Subject: [Bioperl-l] how to rename genbank header in fasta file? In-Reply-To: References: <5611663A-0073-4D26-9DDF-D01BAFDCDC5D@gmail.com> Message-ID: <88A7EE01-B74B-40AC-B943-4A0477E9AEEE@gmail.com> > perl -i -p -e 's/>.+\[gene=([^\]]+)\].+/>$1/' file.fa should have been -e not -s in my example. you can name the file whatever you want just replace that part in the command above-- it sounds like you are really new to Perl in general so I would recommend some basic books first if you are this new to programming and running scripts - try Unix and Perl to the Rescue at http://unixandperl.com Jason On Oct 20, 2012, at 5:56 PM, yang liu wrote: > Hello Jason, > > Thanks for your help. I tried the script, it returned: > Can't open perl script "s/>.+\[gene=([^\]]+)\].+/>$1/": No such file or directory > > Don't know why. > > I named the fasta file as file.fa > > Yang. > > On Sat, Oct 20, 2012 at 1:43 AM, Jason Stajich wrote: > are you parsing exactly this file - it is in FASTA format not genbank. > > You don't need bioperl for this: > perl -i -p -s 's/>.+\[gene=([^\]]+)\].+/>$1/' file.fa > > I'd read up on regular expressions and perl to learn more about how to do string replacement to learn how to do this better. > > > On Oct 19, 2012, at 11:23 PM, yang liu wrote: > >> Hello, >> >> I am a new user of BioPerl, can anyone help with this? I have multiple >> sequences in a fasta file like the following, >> >>> lcl|NC_014487.1_cdsid_YP_003875479.1 [gene=cox1] [protein=cytochrome c >> oxidase subunit 1] [protein_id=YP_003875479.1] [location=1..1575] >> ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG >> GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >>> lcl|NC_014487.1_cdsid_YP_003875480.1 [gene=cox3] [protein=cytochrome c >> oxidase subunit 3] [protein_id=YP_003875480.1] >> [location=complement(13218..14015)] >> ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG >> GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG >> >>> lcl|NC_014487.1_cdsid_YP_003875481.1 [gene=atp8] [protein=ATPase subunit >> 8] [protein_id=YP_003875481.1] [location=complement(15042..15548)] >> ATGCCTCAACTGGATAAATTTACTTATTTCACACAATTCTTCTGGTCATGCCTTTTTTTCTTTACTTTCT >> ATATTCTAATATGCAATGATAGAGATGGAGTACTTGGGATCAGCAGAATTCTAAAACTACGAAATCAACT >> >> I hope to rename the sequences by gene name,such as: >> >>> cox1 >> ATGACAAATCTGATTCGATGGCTCTTCTCTACTAATCACAAGGATATAGGGACTCTCTATTTCATCTTCG >> GCGCCATTGCTGGAGTGATGGGCACATGCTTTTCAGTACTGATTCGTATGGAATTAGCACGCCCCGGCGA >>> cox3 >> ATGATTGAATCTCAACGGCATTCTTTTCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCG >> GAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACTCATTTCAAGGGGGTGCAACACTTCTCAG >> >> any one can help? Thanks. >> >> Yang. >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > Jason Stajich > jason.stajich at gmail.com > jason at bioperl.org > > Jason Stajich jason.stajich at gmail.com jason at bioperl.org From maj at fortinbras.us Sun Oct 21 17:24:03 2012 From: maj at fortinbras.us (Mark A. Jensen) Date: Sun, 21 Oct 2012 21:24:03 +0000 Subject: [Bioperl-l] neo4j + Perl shameless promotion department Message-ID: All, The dudes at Neo4j have posted my tutorial for REST::Neo4p on their blog; check it out for tips and examples: http://blog.neo4j.org/2012/10/restneo4p-perl-ogm.html enjoy MAJ From hartzell at alerce.com Sun Oct 21 13:45:29 2012 From: hartzell at alerce.com (George Hartzell) Date: Sun, 21 Oct 2012 10:45:29 -0700 Subject: [Bioperl-l] Talk about a better way to handle CPAN dependencies. Message-ID: <20612.13497.852051.446096@gargle.gargle.HOWL> If you're in the San Francisco area this Oct. 30 you should think about catching Jeff's presentation (disclosure: we're skiing buddies, etc...) about StratoPAN, his cloud-based [bonus points for folks playing buzzword bingo] tool set for bringing sanity to Perl module dependency management. Please forward this to anyone you think might be interested. There's more info at the SF.pm page: http://www.meetup.com/San-Francisco-Perl-Mongers/events/84572172/ Hope to see you there. g. From alexeymorozov1991 at gmail.com Mon Oct 22 04:46:45 2012 From: alexeymorozov1991 at gmail.com (Alexey Morozov) Date: Mon, 22 Oct 2012 17:46:45 +0900 Subject: [Bioperl-l] (no subject) Message-ID: Dear colleagues, need help. I have this little snippet of code: ....more code.... my @names; foreach(1..$taxa_amount) { push @names, "Taxa$_"; } my $dataset=RandomOrders::generate(\@names,$avg_length,100); ....more code.... And it throws an exception: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Must specify a valid ARRAY reference to the parameter -TAXA, did you forget a leading '\'? for 5 STACK: Error::throw STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 STACK: Bio::Tree::RandomFactory::new /usr/share/perl5/Bio/Tree/RandomFactory.pm:170 STACK: RandomOrders::generate RandomOrders.pm:38 STACK: ./simulator:145 ----------------------------------------------------------- OK, so it must be fault of RandomOrders.pm. Let's look there: sub generate { #Generates random Order_set objects. Is a class method my ($class, $names, $mean, $seq_length)=@_; my $factory=Bio::Tree::RandomFactory->new(-samples=>$names); my $tree=$factory->next_tree; .....more code.... } So main script passes an arrayref to &generate, &generate puts it to scalar and passes said scalar (ie arrayref) to Bio::Tree::RandomFactory. It must all work perfectly, but it does not. Where am I wrong? Alexey Morozov LIN SB RAS Irkutsk, Russia From roy.chaudhuri at gmail.com Mon Oct 22 05:21:53 2012 From: roy.chaudhuri at gmail.com (Roy Chaudhuri) Date: Mon, 22 Oct 2012 10:21:53 +0100 Subject: [Bioperl-l] (no subject) In-Reply-To: References: Message-ID: <50851031.6070508@gmail.com> Hi Alexey, I think the problem here is that you're calling the sub directly using RandomOrders::generate, but the sub expects to be called as a method, which implicitly puts the class name as the first argument in @_. So try something like: my $dataset=RandomOrders->generate(\@names, $avg_length, 100); which is equivalent to: my $dataset=RandomOrders::generate('RandomOrders', \@names, $avg_length, 100); See perldoc perlobj for full details. Cheers, Roy. On 22/10/12 09:46, Alexey Morozov wrote: > Dear colleagues, need help. I have this little snippet of code: > > ....more code.... my @names; foreach(1..$taxa_amount) { push @names, > "Taxa$_"; } my > $dataset=RandomOrders::generate(\@names,$avg_length,100); ....more > code.... > > And it throws an exception: > > ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Must > specify a valid ARRAY reference to the parameter -TAXA, did you > forget a leading '\'? for 5 STACK: Error::throw STACK: > Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 STACK: > Bio::Tree::RandomFactory::new > /usr/share/perl5/Bio/Tree/RandomFactory.pm:170 STACK: > RandomOrders::generate RandomOrders.pm:38 STACK: ./simulator:145 > ----------------------------------------------------------- > > OK, so it must be fault of RandomOrders.pm. Let's look there: > > sub generate { #Generates random Order_set objects. Is a class > method my ($class, $names, $mean, $seq_length)=@_; my > $factory=Bio::Tree::RandomFactory->new(-samples=>$names); my > $tree=$factory->next_tree; .....more code.... } > > So main script passes an arrayref to &generate, &generate puts it to > scalar and passes said scalar (ie arrayref) to > Bio::Tree::RandomFactory. It must all work perfectly, but it does > not. Where am I wrong? > > Alexey Morozov LIN SB RAS Irkutsk, Russia > _______________________________________________ Bioperl-l mailing > list Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From alexeymorozov1991 at gmail.com Mon Oct 22 06:07:53 2012 From: alexeymorozov1991 at gmail.com (Alexey Morozov) Date: Mon, 22 Oct 2012 19:07:53 +0900 Subject: [Bioperl-l] (no subject) In-Reply-To: <50851031.6070508@gmail.com> References: <50851031.6070508@gmail.com> Message-ID: 2012/10/22 Roy Chaudhuri > Hi Alexey, > > I think the problem here is that you're calling the sub directly using > RandomOrders::generate, but the sub expects to be called as a method, > which implicitly puts the class name as the first argument in @_. So try > something like: > > my $dataset=RandomOrders->**generate(\@names, $avg_length, 100); > > which is equivalent to: > > my $dataset=RandomOrders::**generate('RandomOrders', \@names, $avg_length, > 100); > > See perldoc perlobj for full details. > > Cheers, > Roy. > > > On 22/10/12 09:46, Alexey Morozov wrote: > >> Dear colleagues, need help. I have this little snippet of code: >> >> ....more code.... my @names; foreach(1..$taxa_amount) { push @names, >> "Taxa$_"; } my >> $dataset=RandomOrders::**generate(\@names,$avg_length,**100); ....more >> code.... >> >> And it throws an exception: >> >> ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Must >> specify a valid ARRAY reference to the parameter -TAXA, did you >> forget a leading '\'? for 5 STACK: Error::throw STACK: >> Bio::Root::Root::throw /usr/share/perl5/Bio/Root/**Root.pm:472 STACK: >> Bio::Tree::RandomFactory::new >> /usr/share/perl5/Bio/Tree/**RandomFactory.pm:170 STACK: >> RandomOrders::generate RandomOrders.pm:38 STACK: ./simulator:145 >> ------------------------------**----------------------------- >> >> OK, so it must be fault of RandomOrders.pm. Let's look there: >> >> sub generate { #Generates random Order_set objects. Is a class >> method my ($class, $names, $mean, $seq_length)=@_; my >> $factory=Bio::Tree::**RandomFactory->new(-samples=>$**names); my >> $tree=$factory->next_tree; .....more code.... } >> >> So main script passes an arrayref to &generate, &generate puts it to >> scalar and passes said scalar (ie arrayref) to >> Bio::Tree::RandomFactory. It must all work perfectly, but it does >> not. Where am I wrong? >> >> Alexey Morozov LIN SB RAS Irkutsk, Russia >> ______________________________**_________________ Bioperl-l mailing >> list Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/**mailman/listinfo/bioperl-l >> >> Thanks, Roy. Now it works. Alexey From freire at ime.usp.br Tue Oct 23 07:33:33 2012 From: freire at ime.usp.br (Caio Freire) Date: Tue, 23 Oct 2012 09:33:33 -0200 Subject: [Bioperl-l] Problems when retrieve sequences from GenBank Message-ID: Hi BioPerl users, A couple of year ago, I wrote a script to retrieve sequences from GenBank, using Bio::DB::GenBank module and it worked very well in my machine on Ubuntu 10.04. Now, I'm having some problems to do this job on Ubuntu 12.04, since my script returns a warning like this "MSG: Unrecognized DBSOURCE data: BioProject: PRJNA37833". I don't find an obvious solution in Google. Could anyone help me? My script is in the bottom of this mail. Sometimes the message is: ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: WebDBSeqI Request Error: HTTP/1.1 502 Bad Gateway Connection: close Date: Tue, 23 Oct 2012 11:08:47 GMT Accept-Ranges: bytes Server: Apache Vary: accept-language,accept-charset Content-Language: en Content-Type: text/html; charset=iso-8859-1 Client-Date: Tue, 23 Oct 2012 11:09:25 GMT Client-Peer: 165.112.7.20:80 Client-Response-Num: 1 Client-Transfer-Encoding: chunked Link: ; rev="made" Title: Bad Gateway! Bad Gateway!

Bad Gateway!

The proxy server received an invalid response from an upstream server.

The proxy server could not handle the request GET /entrez/eutils/efetch.fcgi.

Reason: Error reading from remote server

If you think this is a server error, please contact the webmaster.

Error 502

eutils.ncbi.nlm.nih.gov
Tue Oct 23 07:08:47 2012
Apache
STACK: Error::throw STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 STACK: Bio::DB::WebDBSeqI::_stream_request /usr/share/perl5/Bio/DB/WebDBSeqI.pm:773 STACK: Bio::DB::WebDBSeqI::get_seq_stream /usr/share/perl5/Bio/DB/WebDBSeqI.pm:467 STACK: Bio::DB::WebDBSeqI::get_Stream_by_id /usr/share/perl5/Bio/DB/WebDBSeqI.pm:288 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id /usr/share/perl5/Bio/DB/WebDBSeqI.pm:158 STACK: check.pl:28 ----------------------------------------------------------- ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: id does not exist STACK: Error::throw STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 STACK: Bio::DB::WebDBSeqI::get_Seq_by_id /usr/share/perl5/Bio/DB/WebDBSeqI.pm:167 STACK: check.pl:28 ----------------------------------------------------------- My script: #!/usr/bin/perl -w use Bio::DB::GenBank; $file = shift @ARGV; open FH, "<$file"; @content = ; $cont1=0; foreach $line (@content){ if ($line =~ /^>.+/g){ $name = $line; $name =~ s/>//g; push (@names, $name); $seq = ''; $cont++; }#close if elsif($line !~ /^>/){ $seq .= $line; $seq =~ s/\s//g; $seq = uc($seq); }#close elsif $hash1{$name} = $seq; } ###################################################### $db_obj = Bio::DB::GenBank->new; foreach $name(@names){ @split = split (/_/, $name); $ident = $split[-1]; $Bio::Seq::seq_obj = $db_obj->get_Seq_by_id($ident); $GBsequencia = $Bio::Seq::seq_obj->seq(); $GBsequencia =~ s/\n+//g; $seq = $hash1{$name}; if ($GBsequencia ne $seq){ $cont1++; print "Problems: $name\n" } } print "Total: $cont\tProblems: $cont1\n"; Best, =============================================================== Caio C?sar de Melo Freire, BSc Biomedicine PhD candidate - Bioinformatics Laboratory of Molecular Evolution and Bioinformatics Institute of Biomedical Sciences - II University of Sao Paulo +551130918453 Av. Prof. Lineu Prestes, 1374 - Cidade Universit?ria "Armando Salles Oliveira", Butant? - S?o Paulo - SP - CEP 05508-900 ================================================================ From Shahana.Hadi at osumc.edu Tue Oct 23 08:58:44 2012 From: Shahana.Hadi at osumc.edu (Hadi, Shahana) Date: Tue, 23 Oct 2012 08:58:44 -0400 Subject: [Bioperl-l] Posting: Post Doctoral Researcher - Bioinformatician Message-ID: <75EC0F908D944E40A0EBDAF071C63218082932E8D1@EXMBOX-VP03.OSUMC.EDU> Hi, I sent the incorrect position description earlier today so I'm sending the correct one that I would like to see if you could post on your page so your members can review. Thanks so much and please let me know if you have questions. Post Doctoral Researcher Organization: The Ohio State University Comprehensive Cancer Center Job Location: Columbus, Ohio - can possibly work remotely and travel to Ohio a few times per year Job Description: Post Doctoral Researcher (Job Opening 370397) - Post-doctoral researcher to pursue specialized research training and experience by performing complex mathematical modeling on genome-wide 3C (chromosome conformation capture) assay generated by laboratory members; collaborates with lab members to analyze other types of high throughput data generated by next generation sequencing, including ChIP-seq and RNA-seq data; identify driver oncogenes for castration-resistant prostate cancer; collaborates with other biostatisticians to generate statistical analyses for manuscript and grant preparations; produces on average one first-author journal article per year; contributes to other lab members' manuscripts as a co-author. Requirements: Doctoral Degree in Applied Mathematics required. Requires successful completion of a background check. Contact Information: For further consideration, applicants need to submit their current curriculum vitae with cover letter to sameek.roychowdhury at osumc.edu. Please indicate "Post Doctoral Researcher - Bioinformatician" in the title of the email. We offer a competitive salary with outstanding benefits. EEO/AA Employer Shahana Hadi Sr. Human Resources Associate The Ohio State University Comprehensive Cancer Center 650 Ackerman Rd. Building 1 Room 325C Columbus, OH 43202 Phone: 614.293.2968 Fax: 614.293.6190 mailto: shahana.hadi at osumc.edu CCCHR website: http://go.osu.edu/CCC_HR Creating a cancer-free world. One person, one discovery at a time. [cid:image001.jpg at 01CDB0FB.A95062F0] CONFIDENTIALITY NOTICE: This e-mail message is confidential and intended only for the person or entity to which it is addressed. If you are not the intended recipient of this e-mail message or if it appears that you have received it in error, please notify the sender immediately by reply e-mail and delete this e-mail message. -------------- next part -------------- A non-text attachment was scrubbed... Name: image001.jpg Type: image/jpeg Size: 6705 bytes Desc: image001.jpg URL: From cjfields at illinois.edu Tue Oct 23 10:47:04 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 23 Oct 2012 14:47:04 +0000 Subject: [Bioperl-l] Problems when retrieve sequences from GenBank In-Reply-To: References: Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC71979@CHIMBX5.ad.uillinois.edu> The 'Bad Gateway' error may very well be a server-side issue (see the HTML output, which gives a NCBI email). The other issue with the BioProject should be addressed in the latest bipoperl code. However, I'm really not sure how you managed to get the script working correctly to begin with; are you sure this script is complete? I gave up testing just b/c there are too many fundamental problems I was correcting (my limit is usually 2-3 corrections, I went past that in this case): 1) Missing variables, arrays, hashes ($seq, @names, %hash) 2) Possibly mislabeled variable, $cont1 -> $cont? 3) No localization I want to point out (and I hate to be the grammar police) but adding 'use strict; use warnings;' would have caught pretty much all of these issues. chris On Oct 23, 2012, at 6:33 AM, Caio Freire wrote: > Hi BioPerl users, > > A couple of year ago, I wrote a script to retrieve sequences from GenBank, > using Bio::DB::GenBank module and it worked very well in my machine on > Ubuntu 10.04. Now, I'm having some problems to do this job on Ubuntu 12.04, > since my script returns a warning like this "MSG: Unrecognized DBSOURCE > data: BioProject: PRJNA37833". I don't find an obvious solution in Google. > Could anyone help me? My script is in the bottom of this mail. > > > > Sometimes the message is: > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: WebDBSeqI Request Error: > HTTP/1.1 502 Bad Gateway > Connection: close > Date: Tue, 23 Oct 2012 11:08:47 GMT > Accept-Ranges: bytes > Server: Apache > Vary: accept-language,accept-charset > Content-Language: en > Content-Type: text/html; charset=iso-8859-1 > Client-Date: Tue, 23 Oct 2012 11:09:25 GMT > Client-Peer: 165.112.7.20:80 > Client-Response-Num: 1 > Client-Transfer-Encoding: chunked > Link: ; rev="made" > Title: Bad Gateway! > > > "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> > > > Bad Gateway! > > > > > >

Bad Gateway!

>

> > > The proxy server received an invalid > response from an upstream server. > > >

>

> > The proxy server could not handle the request href="/entrez/eutils/efetch.fcgi">GET /entrez/eutils/efetch.fcgi.

> Reason: Error reading from remote server

> > >

>

> If you think this is a server error, please contact > the webmaster. > >

> >

Error 502

>
> eutils.ncbi.nlm.nih.gov
> > Tue Oct 23 07:08:47 2012
> Apache >
> > > > > STACK: Error::throw > STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 > STACK: Bio::DB::WebDBSeqI::_stream_request > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:773 > STACK: Bio::DB::WebDBSeqI::get_seq_stream > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:467 > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:288 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:158 > STACK: check.pl:28 > ----------------------------------------------------------- > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: id does not exist > STACK: Error::throw > STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:167 > STACK: check.pl:28 > ----------------------------------------------------------- > > > > > My script: > > #!/usr/bin/perl -w > > use Bio::DB::GenBank; > > $file = shift @ARGV; > open FH, "<$file"; > @content = ; > $cont1=0; > foreach $line (@content){ > if ($line =~ /^>.+/g){ > $name = $line; > $name =~ s/>//g; > push (@names, $name); > $seq = ''; > $cont++; > }#close if > elsif($line !~ /^>/){ > $seq .= $line; > $seq =~ s/\s//g; > $seq = uc($seq); > }#close elsif > $hash1{$name} = $seq; > } > > ###################################################### > $db_obj = Bio::DB::GenBank->new; > foreach $name(@names){ > @split = split (/_/, $name); > $ident = $split[-1]; > $Bio::Seq::seq_obj = $db_obj->get_Seq_by_id($ident); > $GBsequencia = $Bio::Seq::seq_obj->seq(); > $GBsequencia =~ s/\n+//g; > $seq = $hash1{$name}; > if ($GBsequencia ne $seq){ > $cont1++; > print "Problems: $name\n" > } > } > print "Total: $cont\tProblems: $cont1\n"; > > > > > > Best, > =============================================================== > Caio C?sar de Melo Freire, BSc Biomedicine > > PhD candidate - Bioinformatics > > Laboratory of Molecular Evolution and Bioinformatics > Institute of Biomedical Sciences - II > > University of Sao Paulo > +551130918453 > Av. Prof. Lineu Prestes, 1374 - Cidade Universit?ria "Armando Salles > Oliveira", Butant? - S?o Paulo - SP - CEP 05508-900 > ================================================================ > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From gvogler at sanfordburnham.org Tue Oct 23 20:42:09 2012 From: gvogler at sanfordburnham.org (Georg Vogler) Date: Tue, 23 Oct 2012 17:42:09 -0700 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root Message-ID: Hi! I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here is the excerpt (I removed some lines from tests that passed) from the build.log after running "sudo cpanm Bio::Perl": Searching Bio::Perl on cpanmetadb ... --> Working on Bio::Perl Fetching http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz -> OK Unpacking BioPerl-1.6.901.tar.gz Entering BioPerl-1.6.901 Checking configure dependencies from META.yml Checking if you have Module::Build 0.38 ... Yes (0.4003) Configuring BioPerl-1.006901 Running Build.PL Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature live database t ests Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? [a] - will install all scripts Do you want to run tests that require connection to servers across the internet (likely to cause some failures)? y/n [n] - will not run internet-requiring tests Created MYMETA.yml and MYMETA.json Creating new 'Build' script for 'BioPerl' version '1.006901' -> OK Checking dependencies from MYMETA.json ... Checking if you have Test::More 0 ... Yes (0.98) Checking if you have Test::Harness 2.62 ... Yes (3.25) Checking if you have CPAN 1.81 ... Yes (1.9800) Checking if you have Module::Build 0.2805 ... Yes (0.4003) Checking if you have Scalar::Util 0 ... Yes (1.23) Checking if you have IO::String 0 ... Yes (1.08) Checking if you have Data::Stag 0.11 ... Yes (0.11) Checking if you have DB_File 0 ... Yes (1.821) Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) Building and testing BioPerl-1.006901 Building BioPerl t/Align/AlignStats.t ......................... ok t/Align/AlignUtil.t .......................... ok t/Align/Graphics.t ........................... ok t/Align/SimpleAlign.t ........................ ok t/Align/TreeBuild.t .......................... ok ? t/Assembly/IO/bowtie.t ....................... skipped: The optional module Bio::Tools::Run::Samtools (or dependencies thereof) was not installed t/Assembly/IO/sam.t .......................... skipped: The optional module Bio::DB::Sam (or dependencies thereof) was not installed ? t/Restriction/Analysis-refac.t ............... ok t/Restriction/Analysis.t ..................... ok t/Restriction/Gel.t .......................... ok t/Restriction/IO.t ........................... ok t/Root/Exception.t ........................... ok t/Root/HTTPget.t ............................. skipped: Network tests have not been requested Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. # Looks like you planned 63 tests but ran 51. # Looks like your test exited with 255 just after 51. t/Root/RootI.t ............................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 12/63 subtests ? ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Unallowed parameter: clone ! STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 STACK: t/Tools/Primer3.t:26 ----------------------------------------------------------- ? Test Summary Report ------------------- t/Root/RootI.t (Wstat: 65280 Tests: 51 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 63 tests but ran 51. t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 17 tests but ran 0. t/Tools/Primer3.t (Wstat: 65280 Tests: 8 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 14 tests but ran 8. Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 cusr 9.30 csys = 155.30 CPU) Result: FAIL Failed 3/349 test programs. 0/22654 subtests failed. -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log for details. Any suggestions are greatly appreciated! Many thanks, Geo From longbow0 at gmail.com Tue Oct 23 21:31:06 2012 From: longbow0 at gmail.com (longbow leo) Date: Wed, 24 Oct 2012 09:31:06 +0800 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: References: Message-ID: Hi, There is a "bioperl" package in ubuntu repository. It is not need to compile and install it. Best, Haizhou On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler wrote: > Hi! > > I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here is > the excerpt (I removed some lines from tests that passed) from the > build.log after running "sudo cpanm Bio::Perl": > > Searching Bio::Perl on cpanmetadb ... > --> Working on Bio::Perl > Fetching > http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz > -> OK > Unpacking BioPerl-1.6.901.tar.gz > Entering BioPerl-1.6.901 > Checking configure dependencies from META.yml > Checking if you have Module::Build 0.38 ... Yes (0.4003) > Configuring BioPerl-1.006901 > Running Build.PL > Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live > database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature > live database t > ests > > Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? > [a] - will install all scripts > > Do you want to run tests that require connection to servers across the > internet > (likely to cause some failures)? y/n [n] - will not run > internet-requiring tests > Created MYMETA.yml and MYMETA.json > Creating new 'Build' script for 'BioPerl' version '1.006901' > -> OK > Checking dependencies from MYMETA.json ... > Checking if you have Test::More 0 ... Yes (0.98) > Checking if you have Test::Harness 2.62 ... Yes (3.25) > Checking if you have CPAN 1.81 ... Yes (1.9800) > Checking if you have Module::Build 0.2805 ... Yes (0.4003) > Checking if you have Scalar::Util 0 ... Yes (1.23) > Checking if you have IO::String 0 ... Yes (1.08) > Checking if you have Data::Stag 0.11 ... Yes (0.11) > Checking if you have DB_File 0 ... Yes (1.821) > Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) > Building and testing BioPerl-1.006901 > Building BioPerl > t/Align/AlignStats.t ......................... ok > t/Align/AlignUtil.t .......................... ok > t/Align/Graphics.t ........................... ok > t/Align/SimpleAlign.t ........................ ok > t/Align/TreeBuild.t .......................... ok > > ? > > t/Assembly/IO/bowtie.t ....................... skipped: The optional > module Bio::Tools::Run::Samtools (or dependencies thereof) was not installed > t/Assembly/IO/sam.t .......................... skipped: The optional > module Bio::DB::Sam (or dependencies thereof) was not installed > > ? > > t/Restriction/Analysis-refac.t ............... ok > t/Restriction/Analysis.t ..................... ok > t/Restriction/Gel.t .......................... ok > t/Restriction/IO.t ........................... ok > t/Root/Exception.t ........................... ok > t/Root/HTTPget.t ............................. skipped: Network tests have > not been requested > Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. > # Looks like you planned 63 tests but ran 51. > # Looks like your test exited with 255 just after 51. > t/Root/RootI.t ............................... > Dubious, test returned 255 (wstat 65280, 0xff00) > Failed 12/63 subtests > > ? > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: Unallowed parameter: clone ! > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 > STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 > STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 > STACK: t/Tools/Primer3.t:26 > ----------------------------------------------------------- > > ? > > Test Summary Report > ------------------- > t/Root/RootI.t (Wstat: 65280 Tests: 51 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 63 tests but ran 51. > t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 17 tests but ran 0. > t/Tools/Primer3.t (Wstat: 65280 Tests: 8 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 14 tests but ran 8. > Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 > cusr 9.30 csys = 155.30 CPU) > Result: FAIL > Failed 3/349 test programs. 0/22654 subtests failed. > -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log > for details. > > > Any suggestions are greatly appreciated! > > Many thanks, > > Geo > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From longbow0 at gmail.com Tue Oct 23 21:31:06 2012 From: longbow0 at gmail.com (longbow leo) Date: Wed, 24 Oct 2012 09:31:06 +0800 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: References: Message-ID: Hi, There is a "bioperl" package in ubuntu repository. It is not need to compile and install it. Best, Haizhou On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler wrote: > Hi! > > I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here is > the excerpt (I removed some lines from tests that passed) from the > build.log after running "sudo cpanm Bio::Perl": > > Searching Bio::Perl on cpanmetadb ... > --> Working on Bio::Perl > Fetching > http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz > -> OK > Unpacking BioPerl-1.6.901.tar.gz > Entering BioPerl-1.6.901 > Checking configure dependencies from META.yml > Checking if you have Module::Build 0.38 ... Yes (0.4003) > Configuring BioPerl-1.006901 > Running Build.PL > Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live > database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature > live database t > ests > > Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? > [a] - will install all scripts > > Do you want to run tests that require connection to servers across the > internet > (likely to cause some failures)? y/n [n] - will not run > internet-requiring tests > Created MYMETA.yml and MYMETA.json > Creating new 'Build' script for 'BioPerl' version '1.006901' > -> OK > Checking dependencies from MYMETA.json ... > Checking if you have Test::More 0 ... Yes (0.98) > Checking if you have Test::Harness 2.62 ... Yes (3.25) > Checking if you have CPAN 1.81 ... Yes (1.9800) > Checking if you have Module::Build 0.2805 ... Yes (0.4003) > Checking if you have Scalar::Util 0 ... Yes (1.23) > Checking if you have IO::String 0 ... Yes (1.08) > Checking if you have Data::Stag 0.11 ... Yes (0.11) > Checking if you have DB_File 0 ... Yes (1.821) > Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) > Building and testing BioPerl-1.006901 > Building BioPerl > t/Align/AlignStats.t ......................... ok > t/Align/AlignUtil.t .......................... ok > t/Align/Graphics.t ........................... ok > t/Align/SimpleAlign.t ........................ ok > t/Align/TreeBuild.t .......................... ok > > ? > > t/Assembly/IO/bowtie.t ....................... skipped: The optional > module Bio::Tools::Run::Samtools (or dependencies thereof) was not installed > t/Assembly/IO/sam.t .......................... skipped: The optional > module Bio::DB::Sam (or dependencies thereof) was not installed > > ? > > t/Restriction/Analysis-refac.t ............... ok > t/Restriction/Analysis.t ..................... ok > t/Restriction/Gel.t .......................... ok > t/Restriction/IO.t ........................... ok > t/Root/Exception.t ........................... ok > t/Root/HTTPget.t ............................. skipped: Network tests have > not been requested > Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. > # Looks like you planned 63 tests but ran 51. > # Looks like your test exited with 255 just after 51. > t/Root/RootI.t ............................... > Dubious, test returned 255 (wstat 65280, 0xff00) > Failed 12/63 subtests > > ? > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: Unallowed parameter: clone ! > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 > STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 > STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 > STACK: t/Tools/Primer3.t:26 > ----------------------------------------------------------- > > ? > > Test Summary Report > ------------------- > t/Root/RootI.t (Wstat: 65280 Tests: 51 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 63 tests but ran 51. > t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 17 tests but ran 0. > t/Tools/Primer3.t (Wstat: 65280 Tests: 8 Failed: > 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 14 tests but ran 8. > Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 > cusr 9.30 csys = 155.30 CPU) > Result: FAIL > Failed 3/349 test programs. 0/22654 subtests failed. > -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log > for details. > > > Any suggestions are greatly appreciated! > > Many thanks, > > Geo > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From cjfields at illinois.edu Tue Oct 23 22:10:56 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Wed, 24 Oct 2012 02:10:56 +0000 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: References: Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu> If this package represents the latest CPAN release, then that works. Otherwise it may be quite out of date. The error in question is a bit odd, as it hasn't popped up before with testing (at least that I have seen). The clone() method will alias to Storable's dclone() if Clone isn't installed; somehow it thinks Clone is present when it isn't (or there is a Clone module installed w/o the clone() method). Can you run 'perldoc Clone' to see if Clone is installed? chris On Oct 23, 2012, at 8:31 PM, longbow leo wrote: > Hi, > > There is a "bioperl" package in ubuntu repository. It is not need to > compile and install it. > > Best, > > Haizhou > > On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler wrote: > >> Hi! >> >> I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here is >> the excerpt (I removed some lines from tests that passed) from the >> build.log after running "sudo cpanm Bio::Perl": >> >> Searching Bio::Perl on cpanmetadb ... >> --> Working on Bio::Perl >> Fetching >> http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz >> -> OK >> Unpacking BioPerl-1.6.901.tar.gz >> Entering BioPerl-1.6.901 >> Checking configure dependencies from META.yml >> Checking if you have Module::Build 0.38 ... Yes (0.4003) >> Configuring BioPerl-1.006901 >> Running Build.PL >> Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live >> database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature >> live database t >> ests >> >> Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? >> [a] - will install all scripts >> >> Do you want to run tests that require connection to servers across the >> internet >> (likely to cause some failures)? y/n [n] - will not run >> internet-requiring tests >> Created MYMETA.yml and MYMETA.json >> Creating new 'Build' script for 'BioPerl' version '1.006901' >> -> OK >> Checking dependencies from MYMETA.json ... >> Checking if you have Test::More 0 ... Yes (0.98) >> Checking if you have Test::Harness 2.62 ... Yes (3.25) >> Checking if you have CPAN 1.81 ... Yes (1.9800) >> Checking if you have Module::Build 0.2805 ... Yes (0.4003) >> Checking if you have Scalar::Util 0 ... Yes (1.23) >> Checking if you have IO::String 0 ... Yes (1.08) >> Checking if you have Data::Stag 0.11 ... Yes (0.11) >> Checking if you have DB_File 0 ... Yes (1.821) >> Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) >> Building and testing BioPerl-1.006901 >> Building BioPerl >> t/Align/AlignStats.t ......................... ok >> t/Align/AlignUtil.t .......................... ok >> t/Align/Graphics.t ........................... ok >> t/Align/SimpleAlign.t ........................ ok >> t/Align/TreeBuild.t .......................... ok >> >> ? >> >> t/Assembly/IO/bowtie.t ....................... skipped: The optional >> module Bio::Tools::Run::Samtools (or dependencies thereof) was not installed >> t/Assembly/IO/sam.t .......................... skipped: The optional >> module Bio::DB::Sam (or dependencies thereof) was not installed >> >> ? >> >> t/Restriction/Analysis-refac.t ............... ok >> t/Restriction/Analysis.t ..................... ok >> t/Restriction/Gel.t .......................... ok >> t/Restriction/IO.t ........................... ok >> t/Root/Exception.t ........................... ok >> t/Root/HTTPget.t ............................. skipped: Network tests have >> not been requested >> Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. >> # Looks like you planned 63 tests but ran 51. >> # Looks like your test exited with 255 just after 51. >> t/Root/RootI.t ............................... >> Dubious, test returned 255 (wstat 65280, 0xff00) >> Failed 12/63 subtests >> >> ? >> >> >> ------------- EXCEPTION: Bio::Root::Exception ------------- >> MSG: Unallowed parameter: clone ! >> STACK: Error::throw >> STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 >> STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 >> STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 >> STACK: t/Tools/Primer3.t:26 >> ----------------------------------------------------------- >> >> ? >> >> Test Summary Report >> ------------------- >> t/Root/RootI.t (Wstat: 65280 Tests: 51 Failed: >> 0) >> Non-zero exit status: 255 >> Parse errors: Bad plan. You planned 63 tests but ran 51. >> t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 Failed: >> 0) >> Non-zero exit status: 255 >> Parse errors: Bad plan. You planned 17 tests but ran 0. >> t/Tools/Primer3.t (Wstat: 65280 Tests: 8 Failed: >> 0) >> Non-zero exit status: 255 >> Parse errors: Bad plan. You planned 14 tests but ran 8. >> Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 >> cusr 9.30 csys = 155.30 CPU) >> Result: FAIL >> Failed 3/349 test programs. 0/22654 subtests failed. >> -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log >> for details. >> >> >> Any suggestions are greatly appreciated! >> >> Many thanks, >> >> Geo >> >> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From longbow0 at gmail.com Tue Oct 23 22:20:39 2012 From: longbow0 at gmail.com (longbow leo) Date: Wed, 24 Oct 2012 10:20:39 +0800 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu> References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu> Message-ID: The versions of the bioperl and bioperl-run packages in ubuntu 12.04 are 1.6.901. I think it is up-to-date. haizhou On Wed, Oct 24, 2012 at 10:10 AM, Fields, Christopher J < cjfields at illinois.edu> wrote: > If this package represents the latest CPAN release, then that works. > Otherwise it may be quite out of date. > > The error in question is a bit odd, as it hasn't popped up before with > testing (at least that I have seen). The clone() method will alias to > Storable's dclone() if Clone isn't installed; somehow it thinks Clone is > present when it isn't (or there is a Clone module installed w/o the clone() > method). Can you run 'perldoc Clone' to see if Clone is installed? > > chris > > On Oct 23, 2012, at 8:31 PM, longbow leo > wrote: > > > Hi, > > > > There is a "bioperl" package in ubuntu repository. It is not need to > > compile and install it. > > > > Best, > > > > Haizhou > > > > On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler < > gvogler at sanfordburnham.org>wrote: > > > >> Hi! > >> > >> I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here > is > >> the excerpt (I removed some lines from tests that passed) from the > >> build.log after running "sudo cpanm Bio::Perl": > >> > >> Searching Bio::Perl on cpanmetadb ... > >> --> Working on Bio::Perl > >> Fetching > >> http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz > >> -> OK > >> Unpacking BioPerl-1.6.901.tar.gz > >> Entering BioPerl-1.6.901 > >> Checking configure dependencies from META.yml > >> Checking if you have Module::Build 0.38 ... Yes (0.4003) > >> Configuring BioPerl-1.006901 > >> Running Build.PL > >> Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live > >> database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature > >> live database t > >> ests > >> > >> Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? > >> [a] - will install all scripts > >> > >> Do you want to run tests that require connection to servers across the > >> internet > >> (likely to cause some failures)? y/n [n] - will not run > >> internet-requiring tests > >> Created MYMETA.yml and MYMETA.json > >> Creating new 'Build' script for 'BioPerl' version '1.006901' > >> -> OK > >> Checking dependencies from MYMETA.json ... > >> Checking if you have Test::More 0 ... Yes (0.98) > >> Checking if you have Test::Harness 2.62 ... Yes (3.25) > >> Checking if you have CPAN 1.81 ... Yes (1.9800) > >> Checking if you have Module::Build 0.2805 ... Yes (0.4003) > >> Checking if you have Scalar::Util 0 ... Yes (1.23) > >> Checking if you have IO::String 0 ... Yes (1.08) > >> Checking if you have Data::Stag 0.11 ... Yes (0.11) > >> Checking if you have DB_File 0 ... Yes (1.821) > >> Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) > >> Building and testing BioPerl-1.006901 > >> Building BioPerl > >> t/Align/AlignStats.t ......................... ok > >> t/Align/AlignUtil.t .......................... ok > >> t/Align/Graphics.t ........................... ok > >> t/Align/SimpleAlign.t ........................ ok > >> t/Align/TreeBuild.t .......................... ok > >> > >> ? > >> > >> t/Assembly/IO/bowtie.t ....................... skipped: The optional > >> module Bio::Tools::Run::Samtools (or dependencies thereof) was not > installed > >> t/Assembly/IO/sam.t .......................... skipped: The optional > >> module Bio::DB::Sam (or dependencies thereof) was not installed > >> > >> ? > >> > >> t/Restriction/Analysis-refac.t ............... ok > >> t/Restriction/Analysis.t ..................... ok > >> t/Restriction/Gel.t .......................... ok > >> t/Restriction/IO.t ........................... ok > >> t/Root/Exception.t ........................... ok > >> t/Root/HTTPget.t ............................. skipped: Network tests > have > >> not been requested > >> Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. > >> # Looks like you planned 63 tests but ran 51. > >> # Looks like your test exited with 255 just after 51. > >> t/Root/RootI.t ............................... > >> Dubious, test returned 255 (wstat 65280, 0xff00) > >> Failed 12/63 subtests > >> > >> ? > >> > >> > >> ------------- EXCEPTION: Bio::Root::Exception ------------- > >> MSG: Unallowed parameter: clone ! > >> STACK: Error::throw > >> STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 > >> STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 > >> STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 > >> STACK: t/Tools/Primer3.t:26 > >> ----------------------------------------------------------- > >> > >> ? > >> > >> Test Summary Report > >> ------------------- > >> t/Root/RootI.t (Wstat: 65280 Tests: 51 > Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 63 tests but ran 51. > >> t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 > Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 17 tests but ran 0. > >> t/Tools/Primer3.t (Wstat: 65280 Tests: 8 > Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 14 tests but ran 8. > >> Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 > >> cusr 9.30 csys = 155.30 CPU) > >> Result: FAIL > >> Failed 3/349 test programs. 0/22654 subtests failed. > >> -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log > >> for details. > >> > >> > >> Any suggestions are greatly appreciated! > >> > >> Many thanks, > >> > >> Geo > >> > >> > >> > >> _______________________________________________ > >> Bioperl-l mailing list > >> Bioperl-l at lists.open-bio.org > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >> > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From cjfields at illinois.edu Tue Oct 23 22:47:04 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Wed, 24 Oct 2012 02:47:04 +0000 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC743A6@CHIMBX5.ad.uillinois.edu> The Clone issue is still puzzling. It's a bit reminiscent of what Red Hat used to do with Scalar::Utils and ActiveState with DB_File on Windows (release a dummy or crippled module). My guess is this may cause problems at some point regardless of the Bioperl install, so would be worth checking out. chris On Oct 23, 2012, at 9:20 PM, longbow leo wrote: > The versions of the bioperl and bioperl-run packages in ubuntu 12.04 are 1.6.901. I think it is up-to-date. > > haizhou > > On Wed, Oct 24, 2012 at 10:10 AM, Fields, Christopher J wrote: > If this package represents the latest CPAN release, then that works. Otherwise it may be quite out of date. > > The error in question is a bit odd, as it hasn't popped up before with testing (at least that I have seen). The clone() method will alias to Storable's dclone() if Clone isn't installed; somehow it thinks Clone is present when it isn't (or there is a Clone module installed w/o the clone() method). Can you run 'perldoc Clone' to see if Clone is installed? > > chris > > On Oct 23, 2012, at 8:31 PM, longbow leo > wrote: > > > Hi, > > > > There is a "bioperl" package in ubuntu repository. It is not need to > > compile and install it. > > > > Best, > > > > Haizhou > > > > On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler wrote: > > > >> Hi! > >> > >> I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here is > >> the excerpt (I removed some lines from tests that passed) from the > >> build.log after running "sudo cpanm Bio::Perl": > >> > >> Searching Bio::Perl on cpanmetadb ... > >> --> Working on Bio::Perl > >> Fetching > >> http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz > >> -> OK > >> Unpacking BioPerl-1.6.901.tar.gz > >> Entering BioPerl-1.6.901 > >> Checking configure dependencies from META.yml > >> Checking if you have Module::Build 0.38 ... Yes (0.4003) > >> Configuring BioPerl-1.006901 > >> Running Build.PL > >> Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live > >> database tests? y/n [n] - will not run the BioDBGFF or BioDBSeqFeature > >> live database t > >> ests > >> > >> Install [a]ll BioPerl scripts, [n]one, or choose groups [i]nteractively? > >> [a] - will install all scripts > >> > >> Do you want to run tests that require connection to servers across the > >> internet > >> (likely to cause some failures)? y/n [n] - will not run > >> internet-requiring tests > >> Created MYMETA.yml and MYMETA.json > >> Creating new 'Build' script for 'BioPerl' version '1.006901' > >> -> OK > >> Checking dependencies from MYMETA.json ... > >> Checking if you have Test::More 0 ... Yes (0.98) > >> Checking if you have Test::Harness 2.62 ... Yes (3.25) > >> Checking if you have CPAN 1.81 ... Yes (1.9800) > >> Checking if you have Module::Build 0.2805 ... Yes (0.4003) > >> Checking if you have Scalar::Util 0 ... Yes (1.23) > >> Checking if you have IO::String 0 ... Yes (1.08) > >> Checking if you have Data::Stag 0.11 ... Yes (0.11) > >> Checking if you have DB_File 0 ... Yes (1.821) > >> Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) > >> Building and testing BioPerl-1.006901 > >> Building BioPerl > >> t/Align/AlignStats.t ......................... ok > >> t/Align/AlignUtil.t .......................... ok > >> t/Align/Graphics.t ........................... ok > >> t/Align/SimpleAlign.t ........................ ok > >> t/Align/TreeBuild.t .......................... ok > >> > >> ? > >> > >> t/Assembly/IO/bowtie.t ....................... skipped: The optional > >> module Bio::Tools::Run::Samtools (or dependencies thereof) was not installed > >> t/Assembly/IO/sam.t .......................... skipped: The optional > >> module Bio::DB::Sam (or dependencies thereof) was not installed > >> > >> ? > >> > >> t/Restriction/Analysis-refac.t ............... ok > >> t/Restriction/Analysis.t ..................... ok > >> t/Restriction/Gel.t .......................... ok > >> t/Restriction/IO.t ........................... ok > >> t/Root/Exception.t ........................... ok > >> t/Root/HTTPget.t ............................. skipped: Network tests have > >> not been requested > >> Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. > >> # Looks like you planned 63 tests but ran 51. > >> # Looks like your test exited with 255 just after 51. > >> t/Root/RootI.t ............................... > >> Dubious, test returned 255 (wstat 65280, 0xff00) > >> Failed 12/63 subtests > >> > >> ? > >> > >> > >> ------------- EXCEPTION: Bio::Root::Exception ------------- > >> MSG: Unallowed parameter: clone ! > >> STACK: Error::throw > >> STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 > >> STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 > >> STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 > >> STACK: t/Tools/Primer3.t:26 > >> ----------------------------------------------------------- > >> > >> ? > >> > >> Test Summary Report > >> ------------------- > >> t/Root/RootI.t (Wstat: 65280 Tests: 51 Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 63 tests but ran 51. > >> t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 17 tests but ran 0. > >> t/Tools/Primer3.t (Wstat: 65280 Tests: 8 Failed: > >> 0) > >> Non-zero exit status: 255 > >> Parse errors: Bad plan. You planned 14 tests but ran 8. > >> Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + 141.69 > >> cusr 9.30 csys = 155.30 CPU) > >> Result: FAIL > >> Failed 3/349 test programs. 0/22654 subtests failed. > >> -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log > >> for details. > >> > >> > >> Any suggestions are greatly appreciated! > >> > >> Many thanks, > >> > >> Geo > >> > >> > >> > >> _______________________________________________ > >> Bioperl-l mailing list > >> Bioperl-l at lists.open-bio.org > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >> > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From gvogler at sanfordburnham.org Tue Oct 23 22:57:09 2012 From: gvogler at sanfordburnham.org (Georg Vogler) Date: Tue, 23 Oct 2012 19:57:09 -0700 Subject: [Bioperl-l] compiling Bio::Perl error in Bio/Root In-Reply-To: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu> Message-ID: Thanks for your replies. Yes, the Ubuntu package is up-to-date, but since I'm installing all tools from source I think it should be possible for Bioperl as well. Installing Ubuntu packages also seems to interfere with my custom installations. Chris, you were right on the spot (it seems). perldoc Clone shows a manpage. I then did 'cpanm Clone' and that installed it and the problem was solved (it also solved a 'clone' problem in WebGBrowse :-) _. Bio::root compiled just fine. t/Root/HTTPget.t ............................. skipped: Network tests have not been requested t/Root/RootI.t ............................... ok t/Root/RootIO.t .............................. ok t/Root/Storable.t ............................ ok t/Root/Tempfile.t ............................ ok Since I tried installing the Ubuntu Bioperl package before, I have another problem when compiling Bioperl (I'm stubborn). It seems the package now threw off my original samtools installation, and I an error occurs where there was none before Bio::Assembly::IO: could not load sam - for more details on supported formats please see the Assembly::IO docs But that's another story. Thanks again, Geo Am 10/23/12 7:10 PM schrieb "Fields, Christopher J" unter : >If this package represents the latest CPAN release, then that works. >Otherwise it may be quite out of date. > >The error in question is a bit odd, as it hasn't popped up before with >testing (at least that I have seen). The clone() method will alias to >Storable's dclone() if Clone isn't installed; somehow it thinks Clone is >present when it isn't (or there is a Clone module installed w/o the >clone() method). Can you run 'perldoc Clone' to see if Clone is >installed? > >chris > >On Oct 23, 2012, at 8:31 PM, longbow leo > wrote: > >> Hi, >> >> There is a "bioperl" package in ubuntu repository. It is not need to >> compile and install it. >> >> Best, >> >> Haizhou >> >> On Wed, Oct 24, 2012 at 8:42 AM, Georg Vogler >>wrote: >> >>> Hi! >>> >>> I'm having trouble compiling Bio::Perl on my Ubuntu 12.04 server. Here >>>is >>> the excerpt (I removed some lines from tests that passed) from the >>> build.log after running "sudo cpanm Bio::Perl": >>> >>> Searching Bio::Perl on cpanmetadb ... >>> --> Working on Bio::Perl >>> Fetching >>> http://www.cpan.org/authors/id/C/CJ/CJFIELDS/BioPerl-1.6.901.tar.gz >>> -> OK >>> Unpacking BioPerl-1.6.901.tar.gz >>> Entering BioPerl-1.6.901 >>> Checking configure dependencies from META.yml >>> Checking if you have Module::Build 0.38 ... Yes (0.4003) >>> Configuring BioPerl-1.006901 >>> Running Build.PL >>> Do you want to run the Bio::DB::GFF or Bio::DB::SeqFeature::Store live >>> database tests? y/n [n] - will not run the BioDBGFF or >>>BioDBSeqFeature >>> live database t >>> ests >>> >>> Install [a]ll BioPerl scripts, [n]one, or choose groups >>>[i]nteractively? >>> [a] - will install all scripts >>> >>> Do you want to run tests that require connection to servers across the >>> internet >>> (likely to cause some failures)? y/n [n] - will not run >>> internet-requiring tests >>> Created MYMETA.yml and MYMETA.json >>> Creating new 'Build' script for 'BioPerl' version '1.006901' >>> -> OK >>> Checking dependencies from MYMETA.json ... >>> Checking if you have Test::More 0 ... Yes (0.98) >>> Checking if you have Test::Harness 2.62 ... Yes (3.25) >>> Checking if you have CPAN 1.81 ... Yes (1.9800) >>> Checking if you have Module::Build 0.2805 ... Yes (0.4003) >>> Checking if you have Scalar::Util 0 ... Yes (1.23) >>> Checking if you have IO::String 0 ... Yes (1.08) >>> Checking if you have Data::Stag 0.11 ... Yes (0.11) >>> Checking if you have DB_File 0 ... Yes (1.821) >>> Checking if you have ExtUtils::Manifest 1.52 ... Yes (1.61) >>> Building and testing BioPerl-1.006901 >>> Building BioPerl >>> t/Align/AlignStats.t ......................... ok >>> t/Align/AlignUtil.t .......................... ok >>> t/Align/Graphics.t ........................... ok >>> t/Align/SimpleAlign.t ........................ ok >>> t/Align/TreeBuild.t .......................... ok >>> >>> ? >>> >>> t/Assembly/IO/bowtie.t ....................... skipped: The optional >>> module Bio::Tools::Run::Samtools (or dependencies thereof) was not >>>installed >>> t/Assembly/IO/sam.t .......................... skipped: The optional >>> module Bio::DB::Sam (or dependencies thereof) was not installed >>> >>> ? >>> >>> t/Restriction/Analysis-refac.t ............... ok >>> t/Restriction/Analysis.t ..................... ok >>> t/Restriction/Gel.t .......................... ok >>> t/Restriction/IO.t ........................... ok >>> t/Root/Exception.t ........................... ok >>> t/Root/HTTPget.t ............................. skipped: Network tests >>>have >>> not been requested >>> Undefined subroutine &Clone::clone called at Bio/Root/Root.pm line 214. >>> # Looks like you planned 63 tests but ran 51. >>> # Looks like your test exited with 255 just after 51. >>> t/Root/RootI.t ............................... >>> Dubious, test returned 255 (wstat 65280, 0xff00) >>> Failed 12/63 subtests >>> >>> ? >>> >>> >>> ------------- EXCEPTION: Bio::Root::Exception ------------- >>> MSG: Unallowed parameter: clone ! >>> STACK: Error::throw >>> STACK: Bio::Root::Root::throw Bio/Root/Root.pm:472 >>> STACK: Bio::Tools::Primer3::AUTOLOAD Bio/Tools/Primer3.pm:150 >>> STACK: Bio::Tools::Primer3::next_primer Bio/Tools/Primer3.pm:338 >>> STACK: t/Tools/Primer3.t:26 >>> ----------------------------------------------------------- >>> >>> ? >>> >>> Test Summary Report >>> ------------------- >>> t/Root/RootI.t (Wstat: 65280 Tests: 51 >>>Failed: >>> 0) >>> Non-zero exit status: 255 >>> Parse errors: Bad plan. You planned 63 tests but ran 51. >>> t/SeqFeature/Clone.t (Wstat: 65280 Tests: 0 >>>Failed: >>> 0) >>> Non-zero exit status: 255 >>> Parse errors: Bad plan. You planned 17 tests but ran 0. >>> t/Tools/Primer3.t (Wstat: 65280 Tests: 8 >>>Failed: >>> 0) >>> Non-zero exit status: 255 >>> Parse errors: Bad plan. You planned 14 tests but ran 8. >>> Files=349, Tests=22654, 157 wallclock secs ( 3.58 usr 0.73 sys + >>>141.69 >>> cusr 9.30 csys = 155.30 CPU) >>> Result: FAIL >>> Failed 3/349 test programs. 0/22654 subtests failed. >>> -> FAIL Installing Bio::Perl failed. See /home/gvogler/.cpanm/build.log >>> for details. >>> >>> >>> Any suggestions are greatly appreciated! >>> >>> Many thanks, >>> >>> Geo >>> >>> >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > From jovel_juan at hotmail.com Wed Oct 24 11:08:06 2012 From: jovel_juan at hotmail.com (Juan Jovel) Date: Wed, 24 Oct 2012 15:08:06 +0000 Subject: [Bioperl-l] Is more than Perl and Bioperl necessary In-Reply-To: References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu>, Message-ID: Hello Guys! I am a biologist, not a bioinformatician; however, I have educated myself a bit on Perl programming (and before in Turbo Pascal, C++, and Visual Basic). Even when I am not a good programmer, I manage to solve most (if not all) of my needs by using Perl and Bioperl (and occasionally R). However, I see a great enthusiasm for other languages (i.e. Phyton, for example). As experts, do you think it is worth investing some time learning Python for example? Does it offer advantages in terms of efficiency when solving bioinformatic problems? Or on the contrary, it is advisable to invest such time improving and refining the rudiments of Perl and Bioperl I already have? Sorry for the somewhat philosophical question. Regards, Juan From freire at ime.usp.br Wed Oct 24 12:01:05 2012 From: freire at ime.usp.br (Caio Freire) Date: Wed, 24 Oct 2012 14:01:05 -0200 Subject: [Bioperl-l] Problems when retrieve sequences from GenBank In-Reply-To: <118F034CF4C3EF48A96F86CE585B94BF3FC71979@CHIMBX5.ad.uillinois.edu> References: <118F034CF4C3EF48A96F86CE585B94BF3FC71979@CHIMBX5.ad.uillinois.edu> Message-ID: Dear Chris, Tx for your rapid answer. We're anxious to see the next Bioperl update. It's an useful tool. I agree that 'strict pragma' is important, but sometimes we have hurry... Caio 2012/10/23 Fields, Christopher J > The 'Bad Gateway' error may very well be a server-side issue (see the HTML > output, which gives a NCBI email). The other issue with the BioProject > should be addressed in the latest bipoperl code. > > However, I'm really not sure how you managed to get the script working > correctly to begin with; are you sure this script is complete? I gave up > testing just b/c there are too many fundamental problems I was correcting > (my limit is usually 2-3 corrections, I went past that in this case): > > 1) Missing variables, arrays, hashes ($seq, @names, %hash) > 2) Possibly mislabeled variable, $cont1 -> $cont? > 3) No localization > > I want to point out (and I hate to be the grammar police) but adding 'use > strict; use warnings;' would have caught pretty much all of these issues. > > chris > > On Oct 23, 2012, at 6:33 AM, Caio Freire wrote: > > > Hi BioPerl users, > > > > A couple of year ago, I wrote a script to retrieve sequences from > GenBank, > > using Bio::DB::GenBank module and it worked very well in my machine on > > Ubuntu 10.04. Now, I'm having some problems to do this job on Ubuntu > 12.04, > > since my script returns a warning like this "MSG: Unrecognized DBSOURCE > > data: BioProject: PRJNA37833". I don't find an obvious solution in > Google.. > > Could anyone help me? My script is in the bottom of this mail. > > > > > > > > Sometimes the message is: > > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: WebDBSeqI Request Error: > > HTTP/1.1 502 Bad Gateway > > Connection: close > > Date: Tue, 23 Oct 2012 11:08:47 GMT > > Accept-Ranges: bytes > > Server: Apache > > Vary: accept-language,accept-charset > > Content-Language: en > > Content-Type: text/html; charset=iso-8859-1 > > Client-Date: Tue, 23 Oct 2012 11:09:25 GMT > > Client-Peer: 165.112.7.20:80 > > Client-Response-Num: 1 > > Client-Transfer-Encoding: chunked > > Link: ; rev="made" > > Title: Bad Gateway! > > > > > > > "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> > > > > > > Bad Gateway! > > > > > > > > > > > >

Bad Gateway!

> >

> > > > > > The proxy server received an invalid > > response from an upstream server. > > > > > >

> >

> > > > The proxy server could not handle the request > > href="/entrez/eutils/efetch.fcgi">GET /entrez/eutils/efetch.fcgi.

> > Reason: Error reading from remote server

> > > > > >

> >

> > If you think this is a server error, please contact > > the webmaster. > > > >

> > > >

Error 502

> >
> > eutils.ncbi.nlm.nih.gov
> > > > Tue Oct 23 07:08:47 2012
> > Apache > >
> > > > > > > > > > STACK: Error::throw > > STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 > > STACK: Bio::DB::WebDBSeqI::_stream_request > > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:773 > > STACK: Bio::DB::WebDBSeqI::get_seq_stream > > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:467 > > STACK: Bio::DB::WebDBSeqI::get_Stream_by_id > > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:288 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:158 > > STACK: check.pl:28 > > ----------------------------------------------------------- > > > > ------------- EXCEPTION: Bio::Root::Exception ------------- > > MSG: id does not exist > > STACK: Error::throw > > STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:472 > > STACK: Bio::DB::WebDBSeqI::get_Seq_by_id > > /usr/share/perl5/Bio/DB/WebDBSeqI.pm:167 > > STACK: check.pl:28 > > ----------------------------------------------------------- > > > > > > > > > > My script: > > > > #!/usr/bin/perl -w > > > > use Bio::DB::GenBank; > > > > $file = shift @ARGV; > > open FH, "<$file"; > > @content = ; > > $cont1=0; > > foreach $line (@content){ > > if ($line =~ /^>.+/g){ > > $name = $line; > > $name =~ s/>//g; > > push (@names, $name); > > $seq = ''; > > $cont++; > > }#close if > > elsif($line !~ /^>/){ > > $seq .= $line; > > $seq =~ s/\s//g; > > $seq = uc($seq); > > }#close elsif > > $hash1{$name} = $seq; > > } > > > > ###################################################### > > $db_obj = Bio::DB::GenBank->new; > > foreach $name(@names){ > > @split = split (/_/, $name); > > $ident = $split[-1]; > > $Bio::Seq::seq_obj = $db_obj->get_Seq_by_id($ident); > > $GBsequencia = $Bio::Seq::seq_obj->seq(); > > $GBsequencia =~ s/\n+//g; > > $seq = $hash1{$name}; > > if ($GBsequencia ne $seq){ > > $cont1++; > > print "Problems: $name\n" > > } > > } > > print "Total: $cont\tProblems: $cont1\n"; > > > > > > > > > > > > Best, > > =============================================================== > > Caio C?sar de Melo Freire, BSc Biomedicine > > > > PhD candidate - Bioinformatics > > > > Laboratory of Molecular Evolution and Bioinformatics > > Institute of Biomedical Sciences - II > > > > University of Sao Paulo > > +551130918453 > > Av. Prof. Lineu Prestes, 1374 - Cidade Universit?ria "Armando Salles > > Oliveira", Butant? - S?o Paulo - SP - CEP 05508-900 > > ================================================================ > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From JEAN-FRANCOIS.TOMB at dupont.com Wed Oct 24 11:34:23 2012 From: JEAN-FRANCOIS.TOMB at dupont.com (JEAN-FRANCOIS.TOMB at dupont.com) Date: Wed, 24 Oct 2012 15:34:23 +0000 Subject: [Bioperl-l] Position available: Bioinformatics Programmer - Analyst at DuPont CR&D Message-ID: <5B48C5021A875340B8DE05DA134416A07FB50B@033-CH1MPN1-015.033d.mgd.msft.net> Colleagues, This position was just posted. If interested, please apply at: https://dupontimpl.taleo.net/careersection/2/jobdetail.ftl?job=145180&lang Kind regards, Jean-Francois Tomb, Ph.D. Research Manager, Bioinformatics DuPont, Central Research and Development -------------------------------------------------------------- Bioinformatics Programmer - Analyst -1040121017 Description The Central Research & Development (CR&D) organization is seeking a Bioinformatics Programmer/Analyst to join the bioinformatics group located at our research facility in Wilmington, Delaware. The position is embedded in a strongly collaborative multi-disciplinary setting. The person hired is expected to be strong on communication, with significant programming and infrastructure (tools and resources for information storage, curation, and retrieval) development experience, and exposure to Biology. He/she will develop or deploy tools that will be used by several teams of biologists working on diverse projects. He/she will also train biologists to use standard commercial software packages and tools our group develops and/or deploys. The position will involve opportunities to engage in project support, delivering real-world solutions affecting the bottom line of the company. A healthy team playing attitude is expected. Qualifications * PhD in Bioinformatics, Computer Science or related field with at least 2 years of relevant experience in a professional/industrial biotechnology setting. A Master's degree in the same disciplines with at least 6 years of relevant experience will be considered. * Expert knowledge of biological databases and bioinformatics applications and packages - commercial and/or open source. * Experience integrating and deploying tools. * Experience in database design and management (Oracle, MySQL). * Proficient in Perl/CGI, skilled in Java / C/C++, Python/PHP; working knowledge of R and Matlab is desirable * Skilled in web portal and front-end design and development. * Proficient in system administration (Linux/Unix). * Excellent communication and interpersonal skills and experience in collaborating with biologists and other bioinformatics scientists in cross-functional team settings. * Demonstrated ability to clearly communicate bioinformatics principles and practices to a largely non-computational community of molecular biologists, physiologists, and geneticists. This communication is for use by the intended recipient and contains information that may be Privileged, confidential or copyrighted under applicable law. If you are not the intended recipient, you are hereby formally notified that any use, copying or distribution of this e-mail, in whole or in part, is strictly prohibited. Please notify the sender by return e-mail and delete this e-mail from your system. Unless explicitly and conspicuously designated as "E-Contract Intended", this e-mail does not constitute a contract offer, a contract amendment, or an acceptance of a contract offer. This e-mail does not constitute a consent to the use of sender's contact information for direct marketing purposes or for transfers of data to third parties. Francais Deutsch Italiano Espanol Portugues Japanese Chinese Korean http://www.DuPont.com/corp/email_disclaimer.html From jimhu at tamu.edu Wed Oct 24 13:05:49 2012 From: jimhu at tamu.edu (Jim Hu) Date: Wed, 24 Oct 2012 12:05:49 -0500 Subject: [Bioperl-l] six frame translation to gff? Message-ID: <1B5F7BD0-35D5-4A4D-8538-536AEEDF3E76@tamu.edu> Is there a simple way to do this? For teaching we want to illustrate how all possible reading frames are NOT real CDS features. Most browsers display the 6 frame translation, but I would like to convert this information to GFF so they can be viewed, filtered etc. Thanks, Jim ===================================== Jim Hu Professor Dept. of Biochemistry and Biophysics 2128 TAMU Texas A&M Univ. College Station, TX 77843-2128 979-862-4054 From Russell.Smithies at agresearch.co.nz Wed Oct 24 15:18:46 2012 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Thu, 25 Oct 2012 08:18:46 +1300 Subject: [Bioperl-l] six frame translation to gff? In-Reply-To: <1B5F7BD0-35D5-4A4D-8538-536AEEDF3E76@tamu.edu> References: <1B5F7BD0-35D5-4A4D-8538-536AEEDF3E76@tamu.edu> Message-ID: <18DF7D20DFEC044098A1062202F5FFF34CD29DED0D@exchsth.agresearch.co.nz> Not a Bioperl solution, but sixpack from Emboss will output gff http://emboss.sourceforge.net/apps/cvs/emboss/apps/sixpack.html You could probably do something tricky with a regex to chunk the sequence into frames and $my_seq_object->translate http://www.bioperl.org/wiki/HOWTO:Beginners#Translating --Russell -----Original Message----- From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Jim Hu Sent: Thursday, 25 October 2012 6:06 a.m. To: bioperl-l at bioperl.org; GMOD GBrowse List Subject: [Bioperl-l] six frame translation to gff? Is there a simple way to do this? For teaching we want to illustrate how all possible reading frames are NOT real CDS features. Most browsers display the 6 frame translation, but I would like to convert this information to GFF so they can be viewed, filtered etc. Thanks, Jim ===================================== Jim Hu Professor Dept. of Biochemistry and Biophysics 2128 TAMU Texas A&M Univ. College Station, TX 77843-2128 979-862-4054 _______________________________________________ Bioperl-l mailing list Bioperl-l at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From jimhu at tamu.edu Wed Oct 24 15:59:09 2012 From: jimhu at tamu.edu (Jim Hu) Date: Wed, 24 Oct 2012 14:59:09 -0500 Subject: [Bioperl-l] six frame translation to gff? In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF34CD29DED0D@exchsth.agresearch.co.nz> References: <1B5F7BD0-35D5-4A4D-8538-536AEEDF3E76@tamu.edu> <18DF7D20DFEC044098A1062202F5FFF34CD29DED0D@exchsth.agresearch.co.nz> Message-ID: <3C555B68-EAC0-44BE-BBB5-DD9101B74FA7@tamu.edu> Unfortunately, the sixpack gff output is worthless. It just makes each orf a gff file and catenates them. It doesn't preserve the genome coordinates. However, I came up with two possible solutions: - use EMBOSS sixpack or getorf to make fasta, and blast it against the original genome. Really ugly, but it should work, and we already have the tools to convert blast output to gff. - use getorf to make fasta instead of sixpack. getorf writes the coordinates in the fasta header, so I could parse the getorf fasta into gff. I also had a vague idea that it might be possible to cannibalize Bio::Graphics::Glyph::translation, but I didn't spend much time on that. I had hoped that this was common enough to have already been done many times, and someone would just say that I had missed an obvious BioPerl HOWTO. But upon reflection, it's kind of a straw man. We're making something to show that it's not the way to do things, so we wouldn't want a HOWTO to show people how to go down the wrong path. I sometimes think that sixpack is pretty close to how some of the prokaryotic or phage annotations were done, especially the older ones. Jim On Oct 24, 2012, at 2:18 PM, Smithies, Russell wrote: > Not a Bioperl solution, but sixpack from Emboss will output gff > http://emboss.sourceforge.net/apps/cvs/emboss/apps/sixpack.html > > You could probably do something tricky with a regex to chunk the sequence into frames and $my_seq_object->translate > http://www.bioperl.org/wiki/HOWTO:Beginners#Translating > > --Russell > > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Jim Hu > Sent: Thursday, 25 October 2012 6:06 a.m. > To: bioperl-l at bioperl.org; GMOD GBrowse List > Subject: [Bioperl-l] six frame translation to gff? > > Is there a simple way to do this? For teaching we want to illustrate how all possible reading frames are NOT real CDS features. Most browsers display the 6 frame translation, but I would like to convert this information to GFF so they can be viewed, filtered etc. > > Thanks, > > Jim > ===================================== > Jim Hu > Professor > Dept. of Biochemistry and Biophysics > 2128 TAMU > Texas A&M Univ. > College Station, TX 77843-2128 > 979-862-4054 > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > ======================================================================= > Attention: The information contained in this message and/or attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or privileged > material. Any review, retransmission, dissemination or other use of, or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > ======================================================================= ===================================== Jim Hu Professor Dept. of Biochemistry and Biophysics 2128 TAMU Texas A&M Univ. College Station, TX 77843-2128 979-862-4054 From cjfields at illinois.edu Wed Oct 24 16:36:41 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Wed, 24 Oct 2012 20:36:41 +0000 Subject: [Bioperl-l] Is more than Perl and Bioperl necessary In-Reply-To: References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu>, Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC752AF@CHIMBX5.ad.uillinois.edu> That completely depends on what you want to accomplish. For instance, if Perl/BioPerl get the work done for you, then there may be less of an incentive to use Python/Biopython, Ruby/BioRuby, etc. If you find yourself having to script around using any of these, or you are simply interested in learning another language then that is another matter entirely, and learning the bioinformatics tools associated with would naturally come along. Frankly, I've grown more agnostic over time with lang preferences, but I do suggest you learn one language very well (warts and all), simply b/c it makes learning others so much easier. I know Perl best, but I have been picking up Python and Ruby as well via other projects I'm involved with. Frankly, all have advantages and disadvantages, and I find that people's lang preferences tends to be more of a personal (possibly artistic?) choice based on a language's design, coding practices, etc. TIMTOWDI vs TIOOWTDI. chris On Oct 24, 2012, at 10:08 AM, Juan Jovel wrote: > > Hello Guys! > I am a biologist, not a bioinformatician; however, I have educated myself a bit on Perl programming (and before in Turbo Pascal, C++, and Visual Basic). Even when I am not a good programmer, I manage to solve most (if not all) of my needs by using Perl and Bioperl (and occasionally R). However, I see a great enthusiasm for other languages (i.e. Phyton, for example). As experts, do you think it is worth investing some time learning Python for example? Does it offer advantages in terms of efficiency when solving bioinformatic problems? Or on the contrary, it is advisable to invest such time improving and refining the rudiments of Perl and Bioperl I already have? > Sorry for the somewhat philosophical question. > Regards, > Juan > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From jovel_juan at hotmail.com Wed Oct 24 17:32:02 2012 From: jovel_juan at hotmail.com (Juan Jovel) Date: Wed, 24 Oct 2012 21:32:02 +0000 Subject: [Bioperl-l] Is more than Perl and Bioperl necessary In-Reply-To: <118F034CF4C3EF48A96F86CE585B94BF3FC752AF@CHIMBX5.ad.uillinois.edu> References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu>, , , , <118F034CF4C3EF48A96F86CE585B94BF3FC752AF@CHIMBX5.ad.uillinois.edu> Message-ID: Thanks Chris! I appreciate your answer and agree with that. Once the need to learn a different language comes, I will learn it. Very likely, getting stronger in Perl will also make it easier to learn a new language, if necessary in the future. cheers, Juan > From: cjfields at illinois.edu > To: jovel_juan at hotmail.com > Date: Wed, 24 Oct 2012 20:36:41 +0000 > CC: bioperl-l at lists.open-bio.org > Subject: Re: [Bioperl-l] Is more than Perl and Bioperl necessary > > That completely depends on what you want to accomplish. For instance, if Perl/BioPerl get the work done for you, then there may be less of an incentive to use Python/Biopython, Ruby/BioRuby, etc. If you find yourself having to script around using any of these, or you are simply interested in learning another language then that is another matter entirely, and learning the bioinformatics tools associated with would naturally come along. > > Frankly, I've grown more agnostic over time with lang preferences, but I do suggest you learn one language very well (warts and all), simply b/c it makes learning others so much easier. I know Perl best, but I have been picking up Python and Ruby as well via other projects I'm involved with. Frankly, all have advantages and disadvantages, and I find that people's lang preferences tends to be more of a personal (possibly artistic?) choice based on a language's design, coding practices, etc. TIMTOWDI vs TIOOWTDI. > > chris > > On Oct 24, 2012, at 10:08 AM, Juan Jovel wrote: > > > > > Hello Guys! > > I am a biologist, not a bioinformatician; however, I have educated myself a bit on Perl programming (and before in Turbo Pascal, C++, and Visual Basic). Even when I am not a good programmer, I manage to solve most (if not all) of my needs by using Perl and Bioperl (and occasionally R). However, I see a great enthusiasm for other languages (i.e. Phyton, for example). As experts, do you think it is worth investing some time learning Python for example? Does it offer advantages in terms of efficiency when solving bioinformatic problems? Or on the contrary, it is advisable to invest such time improving and refining the rudiments of Perl and Bioperl I already have? > > Sorry for the somewhat philosophical question. > > Regards, > > Juan > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Wed Oct 24 17:59:06 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Wed, 24 Oct 2012 21:59:06 +0000 Subject: [Bioperl-l] Is more than Perl and Bioperl necessary In-Reply-To: References: <118F034CF4C3EF48A96F86CE585B94BF3FC742D2@CHIMBX5.ad.uillinois.edu>, , , , <118F034CF4C3EF48A96F86CE585B94BF3FC752AF@CHIMBX5.ad.uillinois.edu> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC75607@CHIMBX5.ad.uillinois.edu> There are definitely areas where we can improve; feel free to jump in and help if you can! chris On Oct 24, 2012, at 4:32 PM, Juan Jovel wrote: > Thanks Chris! > > I appreciate your answer and agree with that. Once the need to learn a different language comes, I will learn it. Very likely, getting stronger in Perl will also make it easier to learn a new language, if necessary in the future. > > cheers, > > Juan > > > From: cjfields at illinois.edu > > To: jovel_juan at hotmail.com > > Date: Wed, 24 Oct 2012 20:36:41 +0000 > > CC: bioperl-l at lists.open-bio.org > > Subject: Re: [Bioperl-l] Is more than Perl and Bioperl necessary > > > > That completely depends on what you want to accomplish. For instance, if Perl/BioPerl get the work done for you, then there may be less of an incentive to use Python/Biopython, Ruby/BioRuby, etc. If you find yourself having to script around using any of these, or you are simply interested in learning another language then that is another matter entirely, and learning the bioinformatics tools associated with would naturally come along. > > > > Frankly, I've grown more agnostic over time with lang preferences, but I do suggest you learn one language very well (warts and all), simply b/c it makes learning others so much easier. I know Perl best, but I have been picking up Python and Ruby as well via other projects I'm involved with. Frankly, all have advantages and disadvantages, and I find that people's lang preferences tends to be more of a personal (possibly artistic?) choice based on a language's design, coding practices, etc. TIMTOWDI vs TIOOWTDI. > > > > chris > > > > On Oct 24, 2012, at 10:08 AM, Juan Jovel wrote: > > > > > > > > Hello Guys! > > > I am a biologist, not a bioinformatician; however, I have educated myself a bit on Perl programming (and before in Turbo Pascal, C++, and Visual Basic). Even when I am not a good programmer, I manage to solve most (if not all) of my needs by using Perl and Bioperl (and occasionally R). However, I see a great enthusiasm for other languages (i.e. Phyton, for example). As experts, do you think it is worth investing some time learning Python for example? Does it offer advantages in terms of efficiency when solving bioinformatic problems? Or on the contrary, it is advisable to invest such time improving and refining the rudiments of Perl and Bioperl I already have? > > > Sorry for the somewhat philosophical question. > > > Regards, > > > Juan > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l at lists.open-bio.org > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l From pcantalupo at gmail.com Fri Oct 26 12:25:00 2012 From: pcantalupo at gmail.com (Paul Cantalupo) Date: Fri, 26 Oct 2012 12:25:00 -0400 Subject: [Bioperl-l] fixed bug #3298 Message-ID: Hi all, Just wanted to let the Bioperl community that I posted a patch to fix bug #3298. Please see: https://redmine.open-bio.org/issues/3298 and let me know if I should do anything else. Thank you, Paul From shlomif at shlomifish.org Fri Oct 26 13:22:03 2012 From: shlomif at shlomifish.org (Shlomi Fish) Date: Fri, 26 Oct 2012 19:22:03 +0200 Subject: [Bioperl-l] [Request] Please Help Add Some Information about Perl for Bio-Informatics to http://perl-begin.org/uses/bio-info/ Message-ID: <20121026192203.6d1e59c0@lap.shlomifish.org> Hi all, I am the maintainer of http://perl-begin.org/ , the Perl Beginners' Site. I had this page there for a long time, but it's empty: http://perl-begin.org/uses/bio-info/ Can someone help me add some information there? A short XHTML page will be OK. For reference, see the other pages in the section ( http://perl-begin.org/uses/ ) such as: * http://perl-begin.org/uses/web/ * http://perl-begin.org/uses/sys-admin/ * http://perl-begin.org/uses/qa/ Note that you agree that the content will be licensed under the Creative Commons Attribution 3.0 Unported License (or higher versions) and so you should make sure it is original. I shall be obliged for any help. Regards, Shlomi Fish -- ----------------------------------------------------------------- Shlomi Fish http://www.shlomifish.org/ First stop for Perl beginners - http://perl-begin.org/ Jack: Hi Sophie! Sophie: Don?t ?Hi, Sophie!? me. Jack: Don?t ?Don?t ?Hi, Sophie!? me? me! Please reply to list if it's a mailing list post - http://shlom.in/reply . From cjfields at illinois.edu Sun Oct 28 18:24:48 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Sun, 28 Oct 2012 22:24:48 +0000 Subject: [Bioperl-l] Bio::DB::Fasta changes Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> There have been a number of significant changes to Bio::DB::Fasta recently that haven't been discussed on the bioperl list. In particular, much of the code has been moved to Bio::DB::IndexedBase. At the moment some of these changes are breaking compatibility with other tools (namely MAKER, see: https://redmine.open-bio.org/issues/3389). In the latter case I would consider this a significant API change that needs to be addressed. Generally, whenever we make significant changes to modules these should always be run on a branch first (see recent changes to Bio::Tree), and we should at least discuss this on-list prior to merging with master. I do think we should start that discussion now and decide what to do, e.g. roll back changes and push these to a branch, allow these to stay in master with revisions, etc. chris From florent.angly at gmail.com Sun Oct 28 22:50:57 2012 From: florent.angly at gmail.com (Florent Angly) Date: Mon, 29 Oct 2012 12:50:57 +1000 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> Message-ID: <508DEF11.4030909@gmail.com> Hi Chris, I have done a bunch of work on Bio::DB::Fasta and associated modules lately, with the goal of making them more useful and less redundant. There was no intentional change of interface that would make it backward incompatible and all bioperl tests passed fine. In fact, if I recall correctly, I even added more tests because I noticed some holes in test coverage. I suspect that this bug report you cited unveiled a corner case that was not covered by the tests. I'll assign the bug to myself and investigate. Florent On 29/10/12 08:24, Fields, Christopher J wrote: > There have been a number of significant changes to Bio::DB::Fasta recently that haven't been discussed on the bioperl list. In particular, much of the code has been moved to Bio::DB::IndexedBase. At the moment some of these changes are breaking compatibility with other tools (namely MAKER, see: https://redmine.open-bio.org/issues/3389). In the latter case I would consider this a significant API change that needs to be addressed. > > Generally, whenever we make significant changes to modules these should always be run on a branch first (see recent changes to Bio::Tree), and we should at least discuss this on-list prior to merging with master. I do think we should start that discussion now and decide what to do, e.g. roll back changes and push these to a branch, allow these to stay in master with revisions, etc. > > chris From cjfields at illinois.edu Sun Oct 28 23:04:46 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Mon, 29 Oct 2012 03:04:46 +0000 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <508DEF11.4030909@gmail.com> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> <508DEF11.4030909@gmail.com> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC7AE5A@CHIMBX5.ad.uillinois.edu> On Oct 28, 2012, at 9:50 PM, Florent Angly wrote: > Hi Chris, > > I have done a bunch of work on Bio::DB::Fasta and associated modules lately, with the goal of making them more useful and less redundant. There was no intentional change of interface that would make it backward incompatible and all bioperl tests passed fine. In fact, if I recall correctly, I even added more tests because I noticed some holes in test coverage. More tests never hurt (well, unless we're adding a ton of files to the repository). > I suspect that this bug report you cited unveiled a corner case that was not covered by the tests. I'll assign the bug to myself and investigate. Okay. I just want to ensure that everything for this particular module is covered for the GMOD folks. chris > Florent > > > > On 29/10/12 08:24, Fields, Christopher J wrote: >> There have been a number of significant changes to Bio::DB::Fasta recently that haven't been discussed on the bioperl list. In particular, much of the code has been moved to Bio::DB::IndexedBase. At the moment some of these changes are breaking compatibility with other tools (namely MAKER, see: https://redmine.open-bio.org/issues/3389). In the latter case I would consider this a significant API change that needs to be addressed. >> >> Generally, whenever we make significant changes to modules these should always be run on a branch first (see recent changes to Bio::Tree), and we should at least discuss this on-list prior to merging with master. I do think we should start that discussion now and decide what to do, e.g. roll back changes and push these to a branch, allow these to stay in master with revisions, etc. >> >> chris > From dhoworth at mrc-lmb.cam.ac.uk Mon Oct 29 06:38:29 2012 From: dhoworth at mrc-lmb.cam.ac.uk (Dave Howorth) Date: Mon, 29 Oct 2012 10:38:29 +0000 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <508DEF11.4030909@gmail.com> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> <508DEF11.4030909@gmail.com> Message-ID: <508E5CA5.6070706@mrc-lmb.cam.ac.uk> Florent Angly wrote: > I suspect that this bug report you cited unveiled a corner case that was > not covered by the tests. I'll assign the bug to myself and investigate. It looks to me like the previous code and documentation don't match. The CPAN docs, the git docs and the git code all appear to agree that there is a single scalar result. But the CPAN code implements an array result. >From the sound of it, people have been relying on an undocumented feature. But there was a specific change in the code behaviour. As Chris says, it seems like some discussion of the correct resolution would be sensible. Cheers, Dave From florent.angly at gmail.com Mon Oct 29 19:25:05 2012 From: florent.angly at gmail.com (Florent Angly) Date: Tue, 30 Oct 2012 09:25:05 +1000 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <508E5CA5.6070706@mrc-lmb.cam.ac.uk> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> <508DEF11.4030909@gmail.com> <508E5CA5.6070706@mrc-lmb.cam.ac.uk> Message-ID: <508F1051.1050504@gmail.com> Hi all, I resolved the issue, i.e. restored the ability to return a list of IDs (or a single scalar one), added some documentation to make it explicit and added unit tests: https://redmine.open-bio.org/issues/3389 Florent On 29/10/12 20:38, Dave Howorth wrote: > Florent Angly wrote: >> I suspect that this bug report you cited unveiled a corner case that was >> not covered by the tests. I'll assign the bug to myself and investigate. > It looks to me like the previous code and documentation don't match. The > CPAN docs, the git docs and the git code all appear to agree that there > is a single scalar result. But the CPAN code implements an array result. > > >From the sound of it, people have been relying on an undocumented > feature. But there was a specific change in the code behaviour. As Chris > says, it seems like some discussion of the correct resolution would be > sensible. > > Cheers, Dave > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Mon Oct 29 20:22:33 2012 From: cjfields at illinois.edu (Fields, Christopher J) Date: Tue, 30 Oct 2012 00:22:33 +0000 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <508F1051.1050504@gmail.com> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> <508DEF11.4030909@gmail.com> <508E5CA5.6070706@mrc-lmb.cam.ac.uk> <508F1051.1050504@gmail.com> Message-ID: <118F034CF4C3EF48A96F86CE585B94BF3FC7C187@CHIMBX5.ad.uillinois.edu> Thanks Florent, that helps tremendously. chris On Oct 29, 2012, at 6:25 PM, Florent Angly wrote: > Hi all, > > I resolved the issue, i.e. restored the ability to return a list of IDs (or a single scalar one), added some documentation to make it explicit and added unit tests: > https://redmine.open-bio.org/issues/3389 > > Florent > > > On 29/10/12 20:38, Dave Howorth wrote: >> Florent Angly wrote: >>> I suspect that this bug report you cited unveiled a corner case that was >>> not covered by the tests. I'll assign the bug to myself and investigate. >> It looks to me like the previous code and documentation don't match. The >> CPAN docs, the git docs and the git code all appear to agree that there >> is a single scalar result. But the CPAN code implements an array result. >> >> >From the sound of it, people have been relying on an undocumented >> feature. But there was a specific change in the code behaviour. As Chris >> says, it seems like some discussion of the correct resolution would be >> sensible. >> >> Cheers, Dave >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From lincoln.stein at gmail.com Tue Oct 30 06:38:25 2012 From: lincoln.stein at gmail.com (Lincoln Stein) Date: Tue, 30 Oct 2012 06:38:25 -0400 Subject: [Bioperl-l] Bio::DB::Fasta changes In-Reply-To: <508F1051.1050504@gmail.com> References: <118F034CF4C3EF48A96F86CE585B94BF3FC7ABB1@CHIMBX5.ad.uillinois.edu> <508DEF11.4030909@gmail.com> <508E5CA5.6070706@mrc-lmb.cam.ac.uk> <508F1051.1050504@gmail.com> Message-ID: Much obliged to you. Lincoln On Mon, Oct 29, 2012 at 7:25 PM, Florent Angly wrote: > Hi all, > > I resolved the issue, i.e. restored the ability to return a list of IDs > (or a single scalar one), added some documentation to make it explicit and > added unit tests: > https://redmine.open-bio.org/**issues/3389 > > Florent > > > > On 29/10/12 20:38, Dave Howorth wrote: > >> Florent Angly wrote: >> >>> I suspect that this bug report you cited unveiled a corner case that was >>> not covered by the tests. I'll assign the bug to myself and investigate. >>> >> It looks to me like the previous code and documentation don't match. The >> CPAN docs, the git docs and the git code all appear to agree that there >> is a single scalar result. But the CPAN code implements an array result. >> >> >From the sound of it, people have been relying on an undocumented >> feature. But there was a specific change in the code behaviour. As Chris >> says, it seems like some discussion of the correct resolution would be >> sensible. >> >> Cheers, Dave >> ______________________________**_________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/**mailman/listinfo/bioperl-l >> > > ______________________________**_________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/**mailman/listinfo/bioperl-l > -- Lincoln D. Stein Director, Informatics and Biocomputing Platform Ontario Institute for Cancer Research 101 College St., Suite 800 Toronto, ON, Canada M5G0A3 416 673-8514 Assistant: Renata Musa