BLASTN output

From BioPerl
Jump to: navigation, search
BLASTN 2.0.11 [Jan-20-2000]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= U51677
         (2575 letters)

Database: embl.fas
           442,729 sequences; 675,252,082 total letters

Searching...................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

U51677 Human non-histone chromatin protein HMG1 (HMG1) gene, co...  4129  0.0
L38477 Mus musculus (clone Clebp-1) high mobility group 1 prote...   353  7e-95
X80457 M.musculus HMG1 gene                                          353  7e-95
U00431 Mus musculus HMG-1 mRNA, complete cds.                        353  7e-95
L08048 Human non-histone chromosomal protein (HMG-1) retropseud...   349  1e-93
X12597 Human mRNA for high mobility group-1 protein (HMG-1).         349  1e-93
M64986 Rat amphoterin mRNA, complete cds.                            345  2e-92
Z11997 M.musculus mRNA for non-histone chromosomal high-mobilit...   345  2e-92
D63874 Human mRNA for HMG-1, complete cds.                           345  2e-92
Z95115 Human DNA sequence from BAC 445C9 on chromosome 22q12.1.      337  4e-90
X12796 Bovine mRNA for high mobility group 1 (HMG1) protein          335  2e-89
M26110 Bovine high-mobility-group protein (HMG-1) mRNA, 3' end.      327  4e-87
AF009343 Mus musculus HMG-like protein (Trf) mRNA, complete cds.     305  2e-80
M21683;M21684 Pig nonhistone protein HMG1 mRNA, complete cds.        303  6e-80
L13805 Homo sapiens (clone 06) high mobility group 1 protein mRNA    260  8e-67
D14718 Human chromosomal protein HMG1 related gene.                  252  2e-64
Y00365 Chinese hamster HMG-1 gene for high mobility group prote...   246  1e-62
M63852 Rat high mobility group 1 protein synthetic gene, comple...   226  1e-56
Y00463 Rat mRNA for high mobility group protein HMG1                 226  1e-56
X80466 M.musculus HMG1-R-227 gene                                    210  7e-52
X80462 M.musculus HMG1-R-154 gene                                    184  4e-44
X80461 M.musculus HMG1-R-145 gene                                    147  8e-33
X80459 M.musculus HMG1-R-177 gene                                    133  1e-28
X80467 M.musculus HMG1-R-87 gene                                     133  1e-28
X80465 M.musculus HMG1-R-168 gene                                    133  1e-28
X80463 M.musculus HMG1-R-159 gene                                    131  5e-28
L32859 Rainbow trout HMG-1 gene exons 2-5, complete cds.             127  8e-27
X80460 M.musculus HMG1-R-135 gene                                    127  8e-27
X80464 M.musculus HMG1-R-161 gene                                    125  3e-26
X02666 Trout mRNA for high mobility group protein HMG-T              117  7e-24
U21933 Xenopus laevis high mobility group protein-1 (HMG-1) mRN...   107  7e-21
I14731 Sequence 10 from patent US 5451670.                            92  4e-16
X63463 G.gallus HMG2a mRNA                                            90  2e-15
Z29356 Gallus domesticus of h71t7 gene encoding G.domesticus ex...    82  4e-13
D84418 Rat mRNA for chromosomal protein HMG2, complete cds.           78  6e-12
Z46757 M.musculus mRNA for high mobility group 2 protein.             78  6e-12
U31513 Ambystoma mexicanum high mobility group protein-2 (HMG-2...    76  3e-11
D14314 Chicken mRNA for HMG-1, complete cds.                          70  2e-09
Z17240 Homo sapiens for mRNA encoding HMG2B.                          70  2e-09
M83665 Human high mobility group 2 protein (HMG-2) gene, comple...    70  2e-09
X62534 H.sapiens HMG-2 mRNA                                           70  2e-09
X98857 L.fluviatilis mRNA for HMG protein                             68  6e-09
X67668 M.musculus mRNA for high mobility group 2 protein              62  4e-07
J02895 Pig non-histone chromosomal protein (HMG2) mRNA, complet...    62  4e-07
D30765 Xenopus laevis mRNA for HMG-X protein, complete cds.           60  2e-06
L32954 Rainbow trout HMG-T2 gene exons 1-4, complete cds.             54  9e-05
M83235 Gallus gallus non-histone chromosomal protein (HMG2) mRN...    52  4e-04
AF003626 Homo sapiens cosmids IM0525, LC1233, Qc3C1, LB1439, Qc...    50  0.001
M80574 Gallus domesticus high-mobility group-2 protein (HMG-2) ...    46  0.023
X80869 P.citri gene for cytochrome oxidase subunit I                  46  0.023
AF022465 Mus musculus high mobility group protein homolog HMG4 ...    44  0.090
AC002510 Arabidopsis thaliana chromosome II BAC T32G6 genomic s...    44  0.090
AB009838 Loligo bleekeri mitochondrial DNA, complete sequence.        44  0.090
Y10043 Homo sapiens mRNA for high mobility group protein HMG2a        44  0.090
AC004008 Human PAC clone DJ0899B21 from 7p15-p21, complete sequ...    42  0.36
AE001182;AE000783 Borrelia burgdorferi (section 68 of 70) of th...    40  1.4
AE000963;AE000782 Archaeoglobus fulgidus section 144 of 172 of ...    40  1.4
U60491 Nicotiana tabacum actin (Tob66) gene, partial cds.             40  1.4
AB001684 Chlorella vulgaris C-27 chloroplast DNA, complete sequ...    40  1.4
Z50742 Caenorhabditis elegans cosmid K09A11                           40  1.4
X64643 H.sapiens c6.1A mRNA                                           40  1.4
Z83838 Human DNA sequence from PAC 127B20 on chromosome 22q11.2...    40  1.4
L77118 Methanococcus jannaschii large extra-chromosomal element...    38  5.5
L08814 Rat CIIDBP (homologous to human SSRP-1 and mouse T160 ge...    38  5.5
M18222;J03590 Mouse CD3-delta (T3-delta) gene, 5' end; and CD3-...    38  5.5
X95600 M.musculus mRNA for cadherin-8                                 38  5.5
AB010437 Rattus rattus rCdh8-a1 mRNA for cadherin-8, complete cds.    38  5.5
AB010436 Rattus rattus rCdh8 mRNA for cadherin-8, complete cds.       38  5.5
AL021633 Arabidopsis thaliana DNA chromosome 4, BAC clone F8F16...    38  5.5
I55098 Sequence 53 from patent US 5646250.                            38  5.5
I55093 Sequence 43 from patent US 5646250.                            38  5.5
I55092 Sequence 41 from patent US 5646250.                            38  5.5
I46829 Sequence 47 from patent US 5639634.                            38  5.5
I34431 Sequence 53 from patent US 5597725.                            38  5.5
I34426 Sequence 43 from patent US 5597725.                            38  5.5
I34425 Sequence 41 from patent US 5597725.                            38  5.5
Z47547 C.crispus complete mitochondrial genome.                       38  5.5
Z46224 C.crispus Mitochondrion gene for large subunit ribosomal...    38  5.5
U84139 Bos taurus structure-specific recognition protein 1 (SSR...    38  5.5
AL010134 Plasmodium falciparum DNA *** SEQUENCING IN PROGRESS *...    38  5.5
Z99281 Caenorhabditis elegans cosmid Y57G11C                          38  5.5
Z35597 Caenorhabditis elegans cosmid C36E8                            38  5.5
AF003386 Caenorhabditis elegans cosmid F59E12.                        38  5.5
Z30950 C.crispus mitochondrial gene for small subunit ribosomal...    38  5.5
AF026208 Caenorhabditis elegans cosmid F52D1.                         38  5.5
Z69712 Human DNA sequence from cosmid N12G10, on chromosome 22q...    38  5.5
Z84495 Human DNA sequence from cosmid LUCA8                           38  5.5
L81635 Homo sapiens (subclone 2_c11 from P1 H33) DNA sequence, ...    38  5.5
Z68754 Human DNA sequence from cosmid cE78H10, on chromosome 22...    38  5.5
L34060 Homo sapiens cadherin-8 mRNA, complete cds.                    38  5.5
AC002378 Human PAC clone DJ438O4 from 22q12.1-qter, complete se...    38  5.5
AC002124 Human BAC clone RG180O01 from 7p15-p21, complete seque...    38  5.5
Z93931 Human DNA sequence from PAC 438G17 on chromosome 6q22. C...    38  5.5
AL008907 H.sapiens STS from genomic clone 404F18.                     38  5.5
AC004130 Homo sapiens BAC clone RG293F17 from 7p15-p21, complet...    38  5.5
AC004000 Human PAC clone DJ404F18 from Xq23, complete sequence.       38  5.5
AC003683 Homo sapiens Xp22 PAC RPCI1-147H15 (Research Park PAC ...    38  5.5
AC003013 Human PAC clone DJ0205E24 from Xq23, complete sequence.      38  5.5
AC002556 Human Chromosome 11 pac pDJ9j14, complete sequence.          38  5.5

>U51677 Human non-histone chromatin protein HMG1 (HMG1) gene, complete
            cds.
            Length = 2575
            
 Score = 4129 bits (2083), Expect = 0.0
 Identities = 2167/2209 (98%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60

                                                                        
Query: 61   caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120

                                                                        
Query: 121  ttttctaagaagtgctcagagaggtggaaggtaagagggcttaaaacatgctaacaaggt 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  ttttctaagaagtgctcagagaggtggaaggtaagagggcttaaaacatgctaacaaggt 180

                                                                        
Query: 181  aattaaaagacagtttccaattgaggatgcnnnnnnnngcctagttggcattctcgtagt 240
            ||||||||||||||||||||||||||||||        ||||||||||||||||||||||
Sbjct: 181  aattaaaagacagtttccaattgaggatgcaaaaaaaagcctagttggcattctcgtagt 240

                                                                        
Query: 241  gggacgctattacatagcaaaagacattggttttgaggataatttacttaaatgttacaa 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241  gggacgctattacatagcaaaagacattggttttgaggataatttacttaaatgttacaa 300

                                                                        
Query: 301  cttaaacttacaaattaattattttgtagaccatgtctgctaaagagaaaggaaaatttg 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301  cttaaacttacaaattaattattttgtagaccatgtctgctaaagagaaaggaaaatttg 360

                                                                        
Query: 361  aagatatggcaaaagcggacaaggcccgttatgaaagagaaatgaaaacctatatccctc 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361  aagatatggcaaaagcggacaaggcccgttatgaaagagaaatgaaaacctatatccctc 420

                                                                        
Query: 421  ccaaaggggagacaaaaaagaagttcaaggatcccaatgcacccaagaggcctccgtgag 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421  ccaaaggggagacaaaaaagaagttcaaggatcccaatgcacccaagaggcctccgtgag 480

                                                                        
Query: 481  tatcttgcctgtttttacttcccagacacgttttacagtagaatctgagagaaatttagc 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481  tatcttgcctgtttttacttcccagacacgttttacagtagaatctgagagaaatttagc 540

                                                                        
Query: 541  aagctactttgtcagtttagagtgtaaatgtacaatcaaagtttcttagctaatacttgt 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541  aagctactttgtcagtttagagtgtaaatgtacaatcaaagtttcttagctaatacttgt 600

                                                                        
Query: 601  tcatattggttatatttaaatagtataaaattcctgttgggtgggagtgttcccagagca 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601  tcatattggttatatttaaatagtataaaattcctgttgggtgggagtgttcccagagca 660

                                                                        
Query: 661  tttgaattagacatttggtctcctttgcccagtgtatctccttttgatctttttatttct 720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661  tttgaattagacatttggtctcctttgcccagtgtatctccttttgatctttttatttct 720

                                                                        
Query: 721  tgaaaaatactatccctttgaaatagtgtaattgtagaatgttcatctagggttctagct 780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 721  tgaaaaatactatccctttgaaatagtgtaattgtagaatgttcatctagggttctagct 780

                                                                        
Query: 781  agtataaattaaatagttgtaaattaagctttggttgtgaaggatatttagtatattata 840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 781  agtataaattaaatagttgtaaattaagctttggttgtgaaggatatttagtatattata 840

                                                                        
Query: 841  gtatttgcaccctgtccaatgcatcacagaaattcacaggcagctttaaatagcaatgca 900
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841  gtatttgcaccctgtccaatgcatcacagaaattcacaggcagctttaaatagcaatgca 900

                                                                        
Query: 901  gtgtacacctgatagtatttgtttttgtgatctgttaacttaaaatcctaaaattaannn 960
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
Sbjct: 901  gtgtacacctgatagtatttgtttttgtgatctgttaacttaaaatcctaaaattaattt 960

                                                                        
Query: 961  nnnnnnnagttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggaga 1020
                   |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 961  tttttttagttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggaga 1020

                                                                        
Query: 1021 acatcctggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacac 1080
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 acatcctggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacac 1080

                                                                        
Query: 1081 tgctgcagatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacga 1140
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1081 tgctgcagatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacga 1140

                                                                        
Query: 1141 aaaggtaagaagtgtgggtttgcttggtaaaatgatgacaagtacgccagatgtatgatt 1200
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1141 aaaggtaagaagtgtgggtttgcttggtaaaatgatgacaagtacgccagatgtatgatt 1200

                                                                        
Query: 1201 gtacttagtttgaggtgtaataagtttttagggtaacagctacattaagtatggtgttga 1260
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1201 gtacttagtttgaggtgtaataagtttttagggtaacagctacattaagtatggtgttga 1260

                                                                        
Query: 1261 tataagtcctcatccttcaaagaatgcagaggaccaaataaattagggnnnnnnngacta 1320
            ||||||||||||||||||||||||||||||||||||||||||||||||       |||||
Sbjct: 1261 tataagtcctcatccttcaaagaatgcagaggaccaaataaattagggtttttttgacta 1320

                                                                        
Query: 1321 aaatgtaatcagactcagacaaaggctgtgtacatttatgttggttttgttattccccag 1380
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1321 aaatgtaatcagactcagacaaaggctgtgtacatttatgttggttttgttattccccag 1380

                                                                        
Query: 1381 tatcttgaagttcatgaaaatgttggtagtcacttcaagtcaaaaatgagcattttcaaa 1440
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1381 tatcttgaagttcatgaaaatgttggtagtcacttcaagtcaaaaatgagcattttcaaa 1440

                                                                        
Query: 1441 tggcttggcatacagtacaaaaacaggctagacaaagtaatataggctatatttttctta 1500
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1441 tggcttggcatacagtacaaaaacaggctagacaaagtaatataggctatatttttctta 1500

                                                                        
Query: 1501 gtcatatcctgaaacatttatgttcttttcctttagatactcaaaaaaccacagcatcac 1560
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1501 gtcatatcctgaaacatttatgttcttttcctttagatactcaaaaaaccacagcatcac 1560

                                                                        
Query: 1561 taagttaaattacaagtctgctgctctgtccagtaaattaataagattaaggaaatctat 1620
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1561 taagttaaattacaagtctgctgctctgtccagtaaattaataagattaaggaaatctat 1620

                                                                        
Query: 1621 aactcttatagttcagtaaattgaaatattaaatacttaattttcagctttagtcattct 1680
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1621 aactcttatagttcagtaaattgaaatattaaatacttaattttcagctttagtcattct 1680

                                                                        
Query: 1681 gaaaagtgtttatttctagatgtttcttaacctaattgcatgtttattgacaaattaccn 1740
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1681 gaaaagtgtttatttctagatgtttcttaacctaattgcatgtttattgacaaattacct 1740

                                                                        
Query: 1741 nnnnnnnnnaagaccacatttcctactaaggattaaggtctgacagtgtaaacctgtaga 1800
                     |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1741 tttttttttaagaccacatttcctactaaggattaaggtctgacagtgtaaacctgtaga 1800

                                                                        
Query: 1801 gtgcttttttgcattcagaaggtggcagtgtctaccctttaatcaaagtctctacattct 1860
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1801 gtgcttttttgcattcagaaggtggcagtgtctaccctttaatcaaagtctctacattct 1860

                                                                        
Query: 1861 ggttttaatagagttaggatctggtagataattgcacctcaatgaggcataactttgcaa 1920
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1861 ggttttaatagagttaggatctggtagataattgcacctcaatgaggcataactttgcaa 1920

                                                                        
Query: 1921 atattagactatgccatttcatgagttatagattgttataatgatcttgtatttttatgt 1980
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1921 atattagactatgccatttcatgagttatagattgttataatgatcttgtatttttatgt 1980

                                                                        
Query: 1981 tcatttattgaagttctagttatttctggagttgctgtggatctacagatacgtgatatt 2040
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1981 tcatttattgaagttctagttatttctggagttgctgtggatctacagatacgtgatatt 2040

                                                                        
Query: 2041 ttggtataactagaatcttgatttctttcataaagttctgccatgttctatttctttcct 2100
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2041 ttggtataactagaatcttgatttctttcataaagttctgccatgttctatttctttcct 2100

                                                                        
Query: 2101 taatcnnnnnnncttccctactgttttatcctccctttgctttggaaggatattgctgca 2160
            |||||       ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2101 taatctttttttcttccctactgttttatcctccctttgctttggaaggatattgctgca 2160

                                                             
Query: 2161 tatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtcaagg 2209
            |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2161 tatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtcaagg 2209


 Score =  361 bits (182), Expect = 3e-97
 Identities = 210/224 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 2411

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 2471

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575


>L38477 Mus musculus (clone Clebp-1) high mobility group 1 protein
            (HMG-1)
            Length = 1225
            
 Score =  353 bits (178), Expect = 7e-95
 Identities = 209/224 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 746  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 805

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 806  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 865

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866  aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 925

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 926  aaccttgcctggtacagtctgggggttgtaaattggcatggaaa 969


 Score =  234 bits (118), Expect = 5e-59
 Identities = 142/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 74  atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 133

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 134 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 193

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||||||||||||||||
Sbjct: 194 ttctccaagaagtgctcagagaggtggaag 223


 Score =  214 bits (108), Expect = 4e-53
 Identities = 138/148 (93%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 222 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 281

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 282 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 341

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||||||||||||||||||
Sbjct: 342 aggaccccaatgcacccaagaggcctcc 369


 Score =  186 bits (94), Expect = 1e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 370  ttcggccttcttcttgttctgttctgagtaccgccccaaaatcaaaggcgagcatcctgg 429

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | ||||||||||||||||| |||||||| |||||||||||||| |||||||| |||||
Sbjct: 430  cttatccattggtgatgttgcaaagaaactaggagagatgtggaacaacactgcagcaga 489

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 490  tgacaagcagccctatgagaagaaagctgccaagctgaagga 531


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 541  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 600

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 601  caagg 605


>X80457 M.musculus HMG1 gene
            Length = 2547
            
 Score =  353 bits (178), Expect = 7e-95
 Identities = 209/224 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 2202 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 2261

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 2262 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 2321

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2322 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2381

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2382 aaccttgcctggtacagtctgggggttgtaaattggcatggaaa 2425


 Score =  266 bits (134), Expect = 1e-68
 Identities = 155/162 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 173 atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 232

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 233 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 292

                                                     
Query: 121 ttttctaagaagtgctcagagaggtggaaggtaagagggctt 162
           ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 293 ttttccaagaagtgctcagagaggtggaaggtaagagggctt 334


 Score =  232 bits (117), Expect = 2e-58
 Identities = 147/157 (93%)
 Strand = Plus / Plus

                                                                       
Query: 327 tagaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggcc 386
           |||||||||||||||||||| || || |||||||||||||||||||| || |||||||| 
Sbjct: 467 tagaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggct 526

                                                                       
Query: 387 cgttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttc 446
           |||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 527 cgttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttc 586

                                                
Query: 447 aaggatcccaatgcacccaagaggcctccgtgagtat 483
           ||||| |||||||||||||||||||||||||||||||
Sbjct: 587 aaggaccccaatgcacccaagaggcctccgtgagtat 623


 Score =  194 bits (98), Expect = 4e-47
 Identities = 161/182 (88%)
 Strand = Plus / Plus

                                                                        
Query: 968  agttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcct 1027
            ||||||||||||||| | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 1007 agttcggccttcttcttgttctgttctgagtaccgccccaaaatcaaaggcgagcatcct 1066

                                                                        
Query: 1028 ggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgca 1087
            ||| | ||||||||||||||||| |||||||| |||||||||||||| |||||||| |||
Sbjct: 1067 ggcttatccattggtgatgttgcaaagaaactaggagagatgtggaacaacactgcagca 1126

                                                                        
Query: 1088 gatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaaggta 1147
            |||||||||||||| ||||| ||||| ||||| ||||||||||| || || || ||||||
Sbjct: 1127 gatgacaagcagccctatgagaagaaagctgccaagctgaaggagaagtatgagaaggta 1186

              
Query: 1148 ag 1149
            ||
Sbjct: 1187 ag 1188


 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2141 tttggaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggag 2200
            ||||||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| |
Sbjct: 1992 tttggaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaaggggg 2051

                     
Query: 2201 ttgtcaagg 2209
            | |||||||
Sbjct: 2052 tggtcaagg 2060


 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 73/87 (83%), Gaps = 2/87 (2%)
 Strand = Plus / Plus

                                                                        
Query: 1869 tagagttaggatctggtagataattgcacctcaatgaggcataactttgcaaatattaga 1928
            |||| ||||||| ||||| |||||||||| ||| |||||||||||    |||||||||| 
Sbjct: 1777 tagaattaggatgtggtatataattgcacttcagtgaggcataacaacacaaatattag- 1835

                                       
Query: 1929 ctatgccatttcatgagttatagattg 1955
             | || ||||||||||||| |||||||
Sbjct: 1836 -tctgacatttcatgagttgtagattg 1861


 Score = 46.1 bits (23), Expect = 0.023
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 1791 aacctgtagagtgcttttttgcattcagaaggtggcagt 1829
            |||||||||| |||| |||||  ||||||||||||||||
Sbjct: 1699 aacctgtagaatgctgttttgtgttcagaaggtggcagt 1737


>U00431 Mus musculus HMG-1 mRNA, complete cds.
            Length = 1308
            
 Score =  353 bits (178), Expect = 7e-95
 Identities = 209/224 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 818  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 877

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 878  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 937

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 938  aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 997

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 998  aaccttgcctggtacagtctgggggttgtaaattggcatggaaa 1041


 Score =  234 bits (118), Expect = 5e-59
 Identities = 142/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 146 atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 205

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 206 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 265

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||||||||||||||||
Sbjct: 266 ttctccaagaagtgctcagagaggtggaag 295


 Score =  214 bits (108), Expect = 4e-53
 Identities = 138/148 (93%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 294 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 353

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 354 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 413

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||||||||||||||||||
Sbjct: 414 aggaccccaatgcacccaagaggcctcc 441


 Score =  186 bits (94), Expect = 1e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 442  ttcggccttcttcttgttctgttctgagtaccgccccaaaatcaaaggcgagcatcctgg 501

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | ||||||||||||||||| |||||||| |||||||||||||| |||||||| |||||
Sbjct: 502  cttatccattggtgatgttgcaaagaaactaggagagatgtggaacaacactgcagcaga 561

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 562  tgacaagcagccctatgagaagaaagctgccaagctgaagga 603


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 613  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 672

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 673  caagg 677


>L08048 Human non-histone chromosomal protein (HMG-1) retropseudogene.
            Length = 1814
            
 Score =  349 bits (176), Expect = 1e-93
 Identities = 176/176 (100%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 954  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1013

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1014 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1073

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1074 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1129


 Score =  337 bits (170), Expect = 4e-90
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            ||||||||||||||||||||||||||||||||||| |||||| ||||||||       ||
Sbjct: 1333 cttgtctataaagcatttaacccccctgtacacaattcactctttttaaagaaaaaaatt 1392

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 1393 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 1452

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1453 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 1512

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            ||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1513 aactttgcctggtacagtatgggggttgtaaattggcatggaaa 1556


 Score =  289 bits (146), Expect = 9e-76
 Identities = 149/150 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 658 atgggcaaaggagatcctaagaagccgacaggcaaaatgtcatcatatgcattttttgtg 717

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 718 caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 777

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||||||||||||||||||||||||||||
Sbjct: 778 ttttctaagaagtgctcagagaggtggaag 807


 Score =  278 bits (140), Expect = 3e-72
 Identities = 143/144 (99%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 806 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaggcggacaaggccc 865

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 925

                                   
Query: 448 aggatcccaatgcacccaagaggc 471
           ||||||||||||||||||||||||
Sbjct: 926 aggatcccaatgcacccaagaggc 949


 Score =  119 bits (60), Expect = 2e-24
 Identities = 63/64 (98%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1126 aaggatatagctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 1185

                
Query: 2206 aagg 2209
            ||||
Sbjct: 1186 aagg 1189


>X12597 Human mRNA for high mobility group-1 protein (HMG-1).
            Length = 1009
            
 Score =  349 bits (176), Expect = 1e-93
 Identities = 176/176 (100%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 349  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 408

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409  cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 468

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469  tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 524


 Score =  347 bits (175), Expect = 4e-93
 Identities = 210/225 (93%), Gaps = 1/225 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactcc-ttttaaagnnnnnnnt 2410
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||       |
Sbjct: 727  cttgtctataaagcatttaacccccctgtacacaactcactcccttttaaagaaaaaaat 786

                                                                        
Query: 2411 tgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagt 2470
            ||||||||||||||||||||||||||||||||||||||||||||||       |||||||
Sbjct: 787  tgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagt 846

                                                                        
Query: 2471 taacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccac 2530
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 847  taacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccac 906

                                                         
Query: 2531 taaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 907  taaccttgcctggtacagtatgggggttgtaaattggcatggaaa 951


 Score =  297 bits (150), Expect = 4e-78
 Identities = 150/150 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 53  atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 112

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 172

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||||||||||||||||||||||||||||
Sbjct: 173 ttttctaagaagtgctcagagaggtggaag 202


 Score =  293 bits (148), Expect = 6e-77
 Identities = 148/148 (100%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 260

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 320

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           ||||||||||||||||||||||||||||
Sbjct: 321 aggatcccaatgcacccaagaggcctcc 348


 Score =  119 bits (60), Expect = 2e-24
 Identities = 63/64 (98%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 521  aaggatatagctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 580

                
Query: 2206 aagg 2209
            ||||
Sbjct: 581  aagg 584


>M64986 Rat amphoterin mRNA, complete cds.
            Length = 1225
            
 Score =  345 bits (174), Expect = 2e-92
 Identities = 208/224 (92%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 796  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 855

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 856  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 915

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 916  aacacactaccgaatgtgtctttagctagccctgtcctggtggtattttcaatagccact 975

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 976  aaccttgcctggtacagtctgggggttgtaaattggcatggaaa 1019


 Score =  226 bits (114), Expect = 1e-56
 Identities = 141/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 123 atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 182

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||| || ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 183 caaacctgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 242

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||||||||||||||||
Sbjct: 243 ttctccaagaagtgctcagagaggtggaag 272


 Score =  210 bits (106), Expect = 7e-52
 Identities = 148/162 (91%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||||||||||||||| || ||||||||
Sbjct: 419  ttcggccttcttcttgttctgttctgagtaccgcccaaaaatcaaaggcgagcatcctgg 478

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | |||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||
Sbjct: 479  cttatccattggtgatgttgcgaagaaactaggagagatgtggaacaacactgctgcgga 538

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| |||||||||||||| || |||||||||||
Sbjct: 539  tgacaagcagccctatgaaaagaaggccgccaagctgaagga 580


 Score =  206 bits (104), Expect = 1e-50
 Identities = 137/148 (92%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 271 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 330

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 331 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 390

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||| ||||||||||||||
Sbjct: 391 aggaccccaatgcccccaagaggcctcc 418


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 590  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 649

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 650  caagg 654


>Z11997 M.musculus mRNA for non-histone chromosomal high-mobility
            group 1
            Length = 2231
            
 Score =  345 bits (174), Expect = 2e-92
 Identities = 208/224 (92%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 746  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 805

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       | ||||||
Sbjct: 806  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttggatagtt 865

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 866  aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 925

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 926  aaccttgcctggtacagtctgggggttgtaaattggcatggaaa 969


 Score =  242 bits (122), Expect = 2e-61
 Identities = 143/150 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 73  atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 132

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 133 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 192

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||| ||||||||||||||||||||||||
Sbjct: 193 ttttccaagaagtgctcagagaggtggaag 222


 Score =  214 bits (108), Expect = 4e-53
 Identities = 138/148 (93%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 221 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 280

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 281 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 340

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||||||||||||||||||
Sbjct: 341 aggaccccaatgcacccaagaggcctcc 368


 Score =  186 bits (94), Expect = 1e-44
 Identities = 145/162 (89%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||| ||||||||||| || ||||||||
Sbjct: 369  ttcggccttcttcttgttctgttctgagtaccgccccaaaatcaaaggcgagcatcctgg 428

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | ||||||||||||||||| |||||||| |||||||||||||| |||||||| |||||
Sbjct: 429  cttatccattggtgatgttgcaaagaaactaggagagatgtggaacaacactgcagcaga 488

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 489  tgacaagcagccctatgagaagaaagctgccaagctgaagga 530


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 540  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 599

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 600  caagg 604


>D63874 Human mRNA for HMG-1, complete cds.
            Length = 1194
            
 Score =  345 bits (174), Expect = 2e-92
 Identities = 208/224 (92%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 751  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 810

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 811  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 870

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 871  aacacactaccgaatgtgtctttagatagccctgtcctggtggtatcttcaatagccact 930

                                                        
Query: 2532 aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 931  aaccctgcctggtacagtatgggggttgtaaattggcatggaaa 974


 Score =  333 bits (168), Expect = 7e-89
 Identities = 174/176 (98%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 373  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 432

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 433  cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 492

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||||||||||||||||||||||||||  |||||||||||||||||||||||||
Sbjct: 493  tgacaagcagccttatgaaaagaaggctgaaaagctgaaggaaaaatacgaaaagg 548


 Score =  293 bits (148), Expect = 6e-77
 Identities = 148/148 (100%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 284

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 344

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           ||||||||||||||||||||||||||||
Sbjct: 345 aggatcccaatgcacccaagaggcctcc 372


 Score =  281 bits (142), Expect = 2e-73
 Identities = 148/150 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
Sbjct: 77  atgggcaaaggagatcctaagaagccgagacggaaaatgtcatcatatgcattttttgtg 136

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 196

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||||||||||||||||||||||||||||
Sbjct: 197 ttttctaagaagtgctcagagaggtggaag 226


 Score =  127 bits (64), Expect = 8e-27
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 545  aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 604

                
Query: 2206 aagg 2209
            ||||
Sbjct: 605  aagg 608


>Z95115 Human DNA sequence from BAC 445C9 on chromosome 22q12.1.
             Length = 131398
             
 Score =  337 bits (170), Expect = 4e-90
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                         
Query: 2352  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
             |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 58656 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 58715

                                                                         
Query: 2412  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
             |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 58716 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 58775

                                                                         
Query: 2472  aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccact 2531
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||
Sbjct: 58776 aacacactaccgaatgtgtctttagatagccctgtcctgatggtattttcaatagccgct 58835

                                                         
Query: 2532  aaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
             ||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 58836 aaccttgcctggtacagtatgggggctgtaaattggcatggaaa 58879


 Score =  325 bits (164), Expect = 2e-86
 Identities = 173/176 (98%)
 Strand = Plus / Plus

                                                                         
Query: 970   ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
             ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 58290 ttcggccttcttcctgttctgctctgcgtatcgcccaaaaatcaaaggagaacatcctgg 58349

                                                                         
Query: 1030  cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 58350 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgccgcaga 58409

                                                                     
Query: 1090  tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 58410 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 58465


 Score =  254 bits (128), Expect = 5e-65
 Identities = 143/148 (96%)
 Strand = Plus / Plus

                                                                         
Query: 328   agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 58142 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaggcggacaaggccc 58201

                                                                         
Query: 388   gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
              ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 58202 attacgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 58261

                                         
Query: 448   aggatcccaatgcacccaagaggcctcc 475
             ||||||| ||||||||||||||| ||||
Sbjct: 58262 aggatccgaatgcacccaagaggactcc 58289


 Score =  250 bits (126), Expect = 8e-64
 Identities = 141/146 (96%)
 Strand = Plus / Plus

                                                                         
Query: 5     gcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaa 64
             ||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||
Sbjct: 57998 gcaaaggagatcctaagaagctgagaggcaaaatgtcatcacatgcattttttgggcaaa 58057

                                                                         
Query: 65    cttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagtttt 124
             |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 58058 cttgtcgggaggcgcataagaagaagcacccagatgcttcagtcaacctctcagagtttt 58117

                                       
Query: 125   ctaagaagtgctcagagaggtggaag 150
             ||||||||||||||||||||||||||
Sbjct: 58118 ctaagaagtgctcagagaggtggaag 58143


 Score =  127 bits (64), Expect = 8e-27
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                         
Query: 2146  aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 58462 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 58521

                 
Query: 2206  aagg 2209
             ||||
Sbjct: 58522 aagg 58525


>X12796 Bovine mRNA for high mobility group 1 (HMG1) protein
            Length = 1236
            
 Score =  335 bits (169), Expect = 2e-89
 Identities = 209/226 (92%), Gaps = 2/226 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnn-- 2409
            |||||||||||||||||||||||||||||||||| ||||||||||||||||         
Sbjct: 794  cttgtctataaagcatttaacccccctgtacacacctcactccttttaaagaaaaaaaaa 853

                                                                        
Query: 2410 ttgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatag 2469
            |||||||||||||||||||||||||||||||||||||||||||||||       ||||||
Sbjct: 854  ttgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatag 913

                                                                        
Query: 2470 ttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcca 2529
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 914  ttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcca 973

                                                          
Query: 2530 ctaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 974  ctaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 1019


 Score =  258 bits (130), Expect = 3e-66
 Identities = 145/150 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 119 atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattctttgtg 178

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 179 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 238

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||||||||||||||||||||||||||||
Sbjct: 239 ttttctaagaagtgctcagagaggtggaag 268


 Score =  238 bits (120), Expect = 3e-60
 Identities = 141/148 (95%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 267 agaccatgtctgctaaagagaaaggaaaatttgaagacatggcaaaggcggacaaggccc 326

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           |||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||||||
Sbjct: 327 gttatgaaagagaaatgaaaacttatattcctcctaaaggggaaacaaaaaagaagttca 386

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||||||||||||||| |||||||||||
Sbjct: 387 aggatcccaatgcacctaagaggcctcc 414


 Score =  230 bits (116), Expect = 7e-58
 Identities = 161/176 (91%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||| ||| | || || ||||||||||| |||||||||||||| |||||||||||
Sbjct: 415  ttcggcctttttcttgttttgttctgagtatcgtccaaaaatcaaaggcgaacatcctgg 474

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 475  cctgtctattggtgatgttgcaaagaaactgggagagatgtggaataacactgctgcgga 534

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            ||| |||||||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 535  tgataagcagccttatgagaagaaggctgctaagctgaaggaaaagtatgaaaagg 590


 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            ||||||||||| ||||| ||||||||||| || |||||||||||||||||||||||||||
Sbjct: 587  aaggatattgccgcataccgagctaaagggaaacctgatgcagcaaaaaagggagttgtc 646

                
Query: 2206 aagg 2209
            ||||
Sbjct: 647  aagg 650


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2323 taagttggttctagcgcag 2341
            |||||||||||||||||||
Sbjct: 764  taagttggttctagcgcag 782


>M26110 Bovine high-mobility-group protein (HMG-1) mRNA, 3' end.
            Length = 791
            
 Score =  327 bits (165), Expect = 4e-87
 Identities = 208/226 (92%), Gaps = 2/226 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnn-- 2409
            |||||||||||||||||||||||||||||||||||||||||||||||||||         
Sbjct: 340  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaaaa 399

                                                                        
Query: 2410 ttgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatag 2469
            || ||||||||||||||||||||||||||||||||||||||||||||       ||||||
Sbjct: 400  ttaaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatag 459

                                                                        
Query: 2470 ttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcca 2529
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 460  ttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcca 519

                                                          
Query: 2530 ctaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 520  ctaaccctgcctggtacagtatgggggttgtaaattggcatggaaa 565


 Score =  163 bits (82), Expect = 1e-37
 Identities = 106/114 (92%)
 Strand = Plus / Plus

                                                                        
Query: 1032 tgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcagatg 1091
            |||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||
Sbjct: 14   tgtctattggtgatgttgcaaagaaactgggagagatgtggaataacactgctgcggatg 73

                                                                  
Query: 1092 acaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            | |||||||||||||| ||||||||||| |||||||||||||| || |||||||
Sbjct: 74   ataagcagccttatgagaagaaggctgctaagctgaaggaaaagtatgaaaagg 127


 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            ||||||||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 124  aaggatattgccgcataccgagccaaagggaagcctgatgcagcaaaaaagggagttgtc 183

                
Query: 2206 aagg 2209
            ||||
Sbjct: 184  aagg 187


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2323 taagttggttctagcgcag 2341
            |||||||||||||||||||
Sbjct: 301  taagttggttctagcgcag 319


>AF009343 Mus musculus HMG-like protein (Trf) mRNA, complete cds.
            Length = 1328
            
 Score =  305 bits (154), Expect = 2e-80
 Identities = 197/216 (91%)
 Strand = Plus / Plus

                                                                        
Query: 2360 taaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnnttgaaatgta 2419
            ||||||||||||||||||| | |||  ||||||||||||||||       ||||||||||
Sbjct: 814  taaagcatttaacccccctcttcacttctcactccttttaaagaaaaaaattgaaatgta 873

                                                                        
Query: 2420 aggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagttaacacact 2479
            |||||||||||||||||||||||||||||||||||||       ||||||||||||||||
Sbjct: 874  aggctgtgtaagatttgtttttaaactgtacagtgtctttttctgtatagttaacacact 933

                                                                        
Query: 2480 accgaatgtgtctttagatagccctgtcctggtggtattttcaatagccactaaccttgc 2539
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 934  accgaatgtgtctttagatagccctgtcctggtggtattttcaatagccactaaccttgc 993

                                                
Query: 2540 ctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||| |||||||||||||||||||||||||
Sbjct: 994  ctggtacagtctgggggttgtaaattggcatggaaa 1029


 Score =  220 bits (111), Expect = 7e-55
 Identities = 141/150 (94%), Gaps = 2/150 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||  ||||||||| ||||||||||| ||||||
Sbjct: 137 atgggcaaaggagatcctaagaagccgaga--caaaatgtcctcatatgcattctttgtg 194

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 195 caaacttgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 254

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||| ||||||||||||||||||||||||
Sbjct: 255 ttttccaagaagtgctcagagaggtggaag 284


 Score =  176 bits (89), Expect = 9e-42
 Identities = 134/148 (90%), Gaps = 2/148 (1%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 283 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 342

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           |||||| |||||||||||||||||| | ||| ||||||  |||||| |||||||||||||
Sbjct: 343 gttatggaagagaaatgaaaacctacaccccccccaaa--ggagaccaaaaagaagttca 400

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||||||||||||||||||
Sbjct: 401 aggaccccaatgcacccaagaggcctcc 428


 Score =  170 bits (86), Expect = 6e-40
 Identities = 143/162 (88%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||| ||||||||||| || |||||| |
Sbjct: 429  ttcggccttcttcttgttctgttctgagtaccgccccaaaatcaaaggcgagcatcctcg 488

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | |||||||||||| |||| |||||||| |||||||||||||| |||||||| |||||
Sbjct: 489  cttatccattggtgatcttgcaaagaaactaggagagatgtggaacaacactgcagcaga 548

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| ||||| ||||| ||||| |||||||||||
Sbjct: 549  tgacaagcagccctatgagaagaaagctgccaagctgaagga 590


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 600  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 659

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 660  caagg 664


>M21683;M21684 Pig nonhistone protein HMG1 mRNA, complete cds.
            Length = 2192
            
 Score =  303 bits (153), Expect = 6e-80
 Identities = 209/227 (92%), Gaps = 4/227 (1%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccc-tgtacacaactcactccttttaaagnnnnnnn- 2409
            |||||||||||||||||||||||||| |||||||||||||||||||||||||        
Sbjct: 682  cttgtctataaagcatttaaccccccctgtacacaactcactccttttaaagaaaaaaaa 741

                                                                        
Query: 2410 ttgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnn-gtata 2468
            |||||||||||||||||||||||||||||||||||||||||||||||        |||||
Sbjct: 742  ttgaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcttttttttgtata 801

                                                                        
Query: 2469 gttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcc 2528
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 802  gttaacacactaccgaatgtg-ctttagatagccctgtcctggtggtattttcaatagcc 860

                                                           
Query: 2529 actaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 861  actaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 907


 Score =  274 bits (138), Expect = 5e-71
 Identities = 147/150 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 9   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattctttgtg 68

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 69  caaacttgccgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 128

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           |||||||||||||||||||| |||||||||
Sbjct: 129 ttttctaagaagtgctcagaaaggtggaag 158


 Score =  246 bits (124), Expect = 1e-62
 Identities = 142/148 (95%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||
Sbjct: 157 agaccatgtctgctaaagagaaaggaaaatttgaagacatggcaaaggcggacaaggccc 216

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           |||||||||||||||||||||| || || ||||| |||||||||||||||||||||||||
Sbjct: 217 gttatgaaagagaaatgaaaacttacatacctcctaaaggggagacaaaaaagaagttca 276

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           ||||||||||||||||||||||||||||
Sbjct: 277 aggatcccaatgcacccaagaggcctcc 304


 Score =  238 bits (120), Expect = 3e-60
 Identities = 162/176 (92%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||| ||| | || || ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 305  ttcggcctttttcttgttttgttctgagtatcgtccaaaaatcaaaggagagcatcctgg 364

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            ||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 365  cctatccattggtgatgttgcaaagaaactgggagagatgtggaataacaccgctgcaga 424

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            ||||||||| |||||||||||||||||||| ||||||||||| || ||||||||||
Sbjct: 425  tgacaagcacccttatgaaaagaaggctgctaagctgaaggagaagtacgaaaagg 480


 Score =  103 bits (52), Expect = 1e-19
 Identities = 61/64 (95%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 477  aaggatattgctgcataccgagctaaagggaagcctgatgcagcaaaaaagggagtcgtc 536

                
Query: 2206 aagg 2209
            ||||
Sbjct: 537  aagg 540


>L13805 Homo sapiens (clone 06) high mobility group 1 protein mRNA
            Length = 273
            
 Score =  260 bits (131), Expect = 8e-67
 Identities = 166/181 (91%), Gaps = 1/181 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 85   cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 144

                                                                        
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagtt 2471
            |||||||||||||||||||||||||||||||||||||||||||||       ||||||||
Sbjct: 145  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtctttttttgtatagtt 204

                                                                        
Query: 2472 aacacactaccgaatgtgtctttagatagccctgtcctggtggtatttt-caatagccac 2530
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 205  aacacactaccgaatgtgtctttagatagccctgtcctggtggtattttgcaatagccac 264

             
Query: 2531 t 2531
            |
Sbjct: 265  t 265


>D14718 Human chromosomal protein HMG1 related gene.
            Length = 2140
            
 Score =  252 bits (127), Expect = 2e-64
 Identities = 194/221 (87%)
 Strand = Plus / Plus

                                                                        
Query: 2355 gtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnnttgaa 2414
            ||||||||||||||||||||  |||| ||||| |||||||||||||||       | |||
Sbjct: 1582 gtctataaagcatttaaccctactgttcacaagtcactccttttaaagaaaaaaatggaa 1641

                                                                        
Query: 2415 atgtaaggctgtgtaagatttgtttttaaactgtacagtgtcnnnnnnngtatagttaac 2474
            ||||||| ||||||| ||||||||||||||||||||||||||        || |||||||
Sbjct: 1642 atgtaagtctgtgtaggatttgtttttaaactgtacagtgtctttttttataaagttaac 1701

                                                                        
Query: 2475 acactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagccactaac 2534
            |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||
Sbjct: 1702 acactaccgaatgtgtctttagatagccctctcctggtggtgttttcaatagccactaac 1761

                                                     
Query: 2535 cttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||||| ||||||| ||||||||||||||||||||||
Sbjct: 1762 cttgcctggtgcagtatgcgggttgtaaattggcatggaaa 1802


 Score =  244 bits (123), Expect = 5e-62
 Identities = 141/147 (95%)
 Strand = Plus / Plus

                                                                        
Query: 4    ggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaa 63
            |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 922  ggcaaaggagattctaagaagccaagaggcaaaatgtcatcatatgcattttttgtgcaa 981

                                                                        
Query: 64   acttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttt 123
            ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 982  acttgtcgggaagagcataagaagcagcacccagatgcttcagtcaacttctcagagttt 1041

                                       
Query: 124  tctaagaagtgctcagagaggtggaag 150
            ||||||||  |||||||||||||||||
Sbjct: 1042 tctaagaaaggctcagagaggtggaag 1068


 Score =  230 bits (116), Expect = 7e-58
 Identities = 141/148 (95%), Gaps = 1/148 (0%)
 Strand = Plus / Plus

                                                                        
Query: 328  agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
            |||||||||||||||||||||||||| ||||||||||||||||||| | | |||||||||
Sbjct: 1067 agaccatgtctgctaaagagaaaggacaatttgaagatatggcaaaggtg-acaaggccc 1125

                                                                        
Query: 388  gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
             ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1126 attatgaaagagaagtgaaaacctaaatccctcccaaaggggagacaaaaaagaagttca 1185

                                        
Query: 448  aggatcccaatgcacccaagaggcctcc 475
            ||||||||||||||||||||||||||||
Sbjct: 1186 aggatcccaatgcacccaagaggcctcc 1213


 Score =  222 bits (112), Expect = 2e-55
 Identities = 157/172 (91%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||| ||||| |||||||||||||||| ||||||||| ||||||||||| | |||||||
Sbjct: 1218 gcctttttcctgttctgctctgagtatcacccaaaaattaaaggagaacaacttggcctg 1277

                                                                        
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcagatgac 1093
             ||||| ||||||| | ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 1278 cccattagtgatgtcgtgaagaaactgggagagatgtggaataacactgctgcagaagac 1337

                                                                
Query: 1094 aagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||||||| ||||||||||||||| ||||| |||||||||||| ||||||
Sbjct: 1338 aagcagccttgtgaaaagaaggctgcaaagctaaaggaaaaatacaaaaagg 1389


 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgtc 2205
            |||||||||||||||||| |||||||||| |||||||||||||||||||||||| || ||
Sbjct: 1386 aaggatattgctgcatattgagctaaagggaagcctgatgcagcaaaaaagggatttatc 1445

                
Query: 2206 aagg 2209
            ||||
Sbjct: 1446 aagg 1449


>Y00365 Chinese hamster HMG-1 gene for high mobility group protein 1
            Length = 2058
            
 Score =  246 bits (124), Expect = 1e-62
 Identities = 163/176 (92%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||| ||
Sbjct: 192  ttcggccttcttcttgttctgttctgagtatcgcccaaaaatcaaaggagaacatccagg 251

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
             |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 252  gctgtccattggtgatgttgcaaagaaactgggagagatgtggaacaacactgctgcaga 311

                                                                    
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||||||||| ||||||||||||||||| || |||||||| || || |||||||
Sbjct: 312  tgacaagcagccctatgaaaagaaggctgctaaactgaaggagaagtatgaaaagg 367


 Score =  198 bits (100), Expect = 3e-48
 Identities = 136/148 (91%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || ||||||||||| || |||||||| || ||||| || |
Sbjct: 44  agaccatgtctgctaaagaaaagggaaaatttgaggacatggcaaaggctgacaaagctc 103

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 104 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 163

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||||||||||||||||||
Sbjct: 164 aggaccccaatgcacccaagaggcctcc 191


 Score =  117 bits (59), Expect = 7e-24
 Identities = 89/99 (89%), Gaps = 3/99 (3%)
 Strand = Plus / Plus

                                                                        
Query: 2360 taaagcatttaacccccctgtacacaactcactccttttaaag--nnnnnnnttgaaatg 2417
            |||||||||||||||||||||||||||||||||||||||||||         ||||| ||
Sbjct: 599  taaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaaaattgaa-tg 657

                                                   
Query: 2418 taaggctgtgtaagatttgtttttaaactgtacagtgtc 2456
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 658  taaggctgtgtaagatttgtttttaaactgtacagtgtc 696


 Score =  117 bits (59), Expect = 7e-24
 Identities = 98/107 (91%), Gaps = 3/107 (2%)
 Strand = Plus / Plus

                                                                        
Query: 2469 gttaacacactaccgaatgtgtctttagatagccctgtcctggtggtattttcaatagcc 2528
            |||||||||||||||| ||||||||  ||| | |||||||||||||||||||||||  ||
Sbjct: 709  gttaacacactaccga-tgtgtcttg-gatggtcctgtcctggtggtattttcaatgacc 766

                                                           
Query: 2529 actaaccttgcctggtacagtatgggggttgtaaattggcatggaaa 2575
            |||||||| |||||||||||| |||||||||||||||||||||||||
Sbjct: 767  actaacct-gcctggtacagtctgggggttgtaaattggcatggaaa 812


 Score = 65.9 bits (33), Expect = 2e-08
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 106 gtcaacttctcagagttttctaagaagtgctcagagaggtggaag 150
           ||||||||||||||||| || |||||||||||||| |||||||||
Sbjct: 1   gtcaacttctcagagttctcgaagaagtgctcagaaaggtggaag 45


 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                 
Query: 2146 aaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaaggg 2198
            |||||||||||||| ||  ||||||||||||| || |||||||| ||||||||
Sbjct: 364  aaggatattgctgcttacagagctaaaggaaaacccgatgcagcgaaaaaggg 416


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2323 taagttggttctagcgcag 2341
            |||||||||||||||||||
Sbjct: 541  taagttggttctagcgcag 559


>M63852 Rat high mobility group 1 protein synthetic gene, complete
           cds.
           Length = 924
           
 Score =  226 bits (114), Expect = 1e-56
 Identities = 141/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 89  atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 148

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||| || ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 149 caaacctgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 208

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||||||||||||||||
Sbjct: 209 ttctccaagaagtgctcagagaggtggaag 238


 Score =  206 bits (104), Expect = 1e-50
 Identities = 137/148 (92%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 237 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 296

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 297 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 356

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||| ||||||||||||||
Sbjct: 357 aggaccccaatgcccccaagaggcctcc 384


 Score =  202 bits (102), Expect = 2e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||||||||||||||| || ||||||||
Sbjct: 385  ttcggccttcttcttgttctgttctgagtaccgcccaaaaatcaaaggcgagcatcctgg 444

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | |||||||||||||||||||||||| | |||||||||||||| ||||||||||| ||
Sbjct: 445  cttatccattggtgatgttgcgaagaaattaggagagatgtggaacaacactgctgcgga 504

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| |||||||||||||| || |||||||||||
Sbjct: 505  tgacaagcagccctatgaaaagaaggccgccaagctgaagga 546


 Score =  167 bits (84), Expect = 9e-39
 Identities = 98/105 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 762  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 821

                                                         
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtc 2456
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 822  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtc 866


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 556  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 615

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 616  caagg 620


>Y00463 Rat mRNA for high mobility group protein HMG1
           Length = 825
           
 Score =  226 bits (114), Expect = 1e-56
 Identities = 141/150 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 28  atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtg 87

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||| || ||||||||||| |||||||||||||| |||||||| |||||||||||||||
Sbjct: 88  caaacctgccgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcagag 147

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||||||||||||||||
Sbjct: 148 ttctccaagaagtgctcagagaggtggaag 177


 Score =  206 bits (104), Expect = 1e-50
 Identities = 137/148 (92%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||||||||| || || |||||||||||||||||||| || |||||||| |
Sbjct: 176 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaaggctgacaaggctc 235

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 236 gttatgaaagagaaatgaaaacctacatcccccccaaaggggagaccaaaaagaagttca 295

                                       
Query: 448 aggatcccaatgcacccaagaggcctcc 475
           |||| |||||||| ||||||||||||||
Sbjct: 296 aggaccccaatgcccccaagaggcctcc 323


 Score =  202 bits (102), Expect = 2e-49
 Identities = 147/162 (90%)
 Strand = Plus / Plus

                                                                        
Query: 970  ttcggccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctgg 1029
            ||||||||||||| | ||||| |||||||| ||||||||||||||||| || ||||||||
Sbjct: 324  ttcggccttcttcttgttctgttctgagtaccgcccaaaaatcaaaggcgagcatcctgg 383

                                                                        
Query: 1030 cctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgcaga 1089
            | | |||||||||||||||||||||||| | |||||||||||||| ||||||||||| ||
Sbjct: 384  cttatccattggtgatgttgcgaagaaattaggagagatgtggaacaacactgctgcgga 443

                                                      
Query: 1090 tgacaagcagccttatgaaaagaaggctgcgaagctgaagga 1131
            |||||||||||| |||||||||||||| || |||||||||||
Sbjct: 444  tgacaagcagccctatgaaaagaaggccgccaagctgaagga 485


 Score =  167 bits (84), Expect = 9e-39
 Identities = 98/105 (93%)
 Strand = Plus / Plus

                                                                        
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagnnnnnnntt 2411
            |||||||||||||||||||||||||||||||||||||||||||||||||||       ||
Sbjct: 701  cttgtctataaagcatttaacccccctgtacacaactcactccttttaaagaaaaaaatt 760

                                                         
Query: 2412 gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtc 2456
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 761  gaaatgtaaggctgtgtaagatttgtttttaaactgtacagtgtc 805


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                        
Query: 2145 gaaggatattgctgcatatcgagctaaaggaaagcctgatgcagcaaaaaagggagttgt 2204
            ||||||||||||||| ||  ||||||||||||| ||||||||||| |||||||| || ||
Sbjct: 495  gaaggatattgctgcctacagagctaaaggaaaacctgatgcagcgaaaaagggggtggt 554

                 
Query: 2205 caagg 2209
            |||||
Sbjct: 555  caagg 559


>X80466 M.musculus HMG1-R-227 gene
           Length = 184
           
 Score =  210 bits (106), Expect = 7e-52
 Identities = 130/138 (94%)
 Strand = Plus / Plus

                                                                       
Query: 13  gatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgg 72
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 1   gatcctaagaagccgagaggcaaaatgtcctcatatgcattctttgtgcaaacttgccgg 60

                                                                       
Query: 73  gaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaag 132
           |||||||| |||||||||||||| |||||||| ||||||||||||||||| || ||||||
Sbjct: 61  gaggagcacaagaagaagcacccggatgcttctgtcaacttctcagagttctccaagaag 120

                             
Query: 133 tgctcagagaggtggaag 150
           ||||||||||||||||||
Sbjct: 121 tgctcagagaggtggaag 138


 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaa 373
           ||||||||||||||||||| || || ||||||||||||||||||||
Sbjct: 137 agaccatgtctgctaaagaaaaggggaaatttgaagatatggcaaa 182


>X80462 M.musculus HMG1-R-154 gene
           Length = 190
           
 Score =  184 bits (93), Expect = 4e-44
 Identities = 135/149 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||  | ||||||
Sbjct: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcctcatatgcgctctttgtg 60

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
            |||| ||  |||||||||| |||||||||||||| |||||||| ||||||||||||| |
Sbjct: 61  aaaacctgctgggaggagcacaagaagaagcacccggatgcttctgtcaacttctcaggg 120

                                        
Query: 121 ttttctaagaagtgctcagagaggtggaa 149
           || || |||||||||||||||||||||||
Sbjct: 121 ttctccaagaagtgctcagagaggtggaa 149


 Score = 48.1 bits (24), Expect = 0.006
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 330 accatgtctgctaaagagaaaggaaaatttgaagatatgg 369
           ||||||||||||||||| || || |||||||||| |||||
Sbjct: 151 accatgtctgctaaagaaaaggggaaatttgaaggtatgg 190


>X80461 M.musculus HMG1-R-145 gene
           Length = 196
           
 Score =  147 bits (74), Expect = 8e-33
 Identities = 126/142 (88%), Gaps = 1/142 (0%)
 Strand = Plus / Plus

                                                                       
Query: 9   aggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttg 68
           |||||||||||||||||| ||||||| |||||| | ||||||||| ||||||||||| ||
Sbjct: 9   aggagatcctaagaagccaagaggcacaatgtccttatatgcattctttgtgcaaacctg 68

                                                                       
Query: 69  tcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaa 128
            ||||||||||| | || ||  |||||||||||||| ||||||||||||||| | || ||
Sbjct: 69  ccgggaggagcacagga-gagacacccagatgcttctgtcaacttctcagagctctccaa 127

                                 
Query: 129 gaagtgctcagagaggtggaag 150
           ||||||||||||||||||||||
Sbjct: 128 gaagtgctcagagaggtggaag 149


 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 332 catgtctgctaaagagaaaggaaaatttgaagatatggcaa 372
           ||||||||||||||| || || |||||||||||||||||||
Sbjct: 151 catgtctgctaaagaaaaggggaaatttgaagatatggcaa 191


>X80459 M.musculus HMG1-R-177 gene
           Length = 173
           
 Score =  133 bits (67), Expect = 1e-28
 Identities = 127/146 (86%), Gaps = 2/146 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgc 61
           ||||||||  |||||||||||||| ||||||||||||||| ||||||||||| ||| |||
Sbjct: 2   tgggcaaaaaagatcctaagaagctgagaggcaaaatgtcctcatatgcattctttttgc 61

                                                                       
Query: 62  aaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagt 121
           |||| | | ||| | |||| |||||||||||||  |||||||   ||||||| |||||||
Sbjct: 62  aaaccttttgggtgtagcacaagaagaagcacctggatgctt--ttcaacttttcagagt 119

                                     
Query: 122 tttctaagaagtgctcagagaggtgg 147
           | ||||||||||||||||||||||||
Sbjct: 120 tctctaagaagtgctcagagaggtgg 145


>X80467 M.musculus HMG1-R-87 gene
           Length = 190
           
 Score =  133 bits (67), Expect = 1e-28
 Identities = 127/146 (86%), Gaps = 2/146 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgc 61
           ||||||||  |||||||||||||| ||||||||||||||| ||||||||||| ||| |||
Sbjct: 2   tgggcaaaaaagatcctaagaagctgagaggcaaaatgtcctcatatgcattctttttgc 61

                                                                       
Query: 62  aaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagt 121
           |||| | | ||| | |||| |||||||||||||  |||||||   ||||||| |||||||
Sbjct: 62  aaaccttttgggtgtagcacaagaagaagcacctggatgctt--ttcaacttttcagagt 119

                                     
Query: 122 tttctaagaagtgctcagagaggtgg 147
           | ||||||||||||||||||||||||
Sbjct: 120 tctctaagaagtgctcagagaggtgg 145


 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatgg 369
           |||||||| |||||||||| || || ||||||||||||||||
Sbjct: 147 agaccatgactgctaaagaaaaggggaaatttgaagatatgg 188


>X80465 M.musculus HMG1-R-168 gene
           Length = 181
           
 Score =  133 bits (67), Expect = 1e-28
 Identities = 131/151 (86%), Gaps = 1/151 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatc-atatgcattttttgt 59
           ||||||||||||||||||||||||| |||| |||||||||| |  ||||||||| ||| |
Sbjct: 1   atgggcaaaggagatcctaagaagctgagacgcaaaatgtcctgtatatgcattctttat 60

                                                                       
Query: 60  gcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcaga 119
           |||||| || | ||||||||| ||||  ||| |||  |||||||| ||||||||||||||
Sbjct: 61  gcaaacctgccaggaggagcacaagacaaagtacctggatgcttctgtcaacttctcaga 120

                                          
Query: 120 gttttctaagaagtgctcagagaggtggaag 150
           ||| || |||||||| |||||||||||||||
Sbjct: 121 gttctccaagaagtgttcagagaggtggaag 151


 Score = 48.1 bits (24), Expect = 0.006
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 328 agaccatgtctgctaaagagaaaggaaaattt 359
           ||||||||||||||||||| ||||| ||||||
Sbjct: 150 agaccatgtctgctaaagaaaaagggaaattt 181


>X80463 M.musculus HMG1-R-159 gene
           Length = 192
           
 Score =  131 bits (66), Expect = 5e-28
 Identities = 127/146 (86%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgc 61
           ||||||||  |||||||||||||| ||||||||||||||| ||||||||||| ||| |||
Sbjct: 2   tgggcaaaaaagatcctaagaagctgagaggcaaaatgtcctcatatgcattctttttgc 61

                                                                       
Query: 62  aaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagt 121
           |||| | | ||| | |||| |||||||||||||  ||||||||  ||||||| |||||||
Sbjct: 62  aaaccttttgggtgtagcacaagaagaagcacctggatgcttc-ttcaacttttcagagt 120

                                     
Query: 122 tttctaagaagtgctcagagaggtgg 147
           | |||| |||||||||||||||||||
Sbjct: 121 tctctatgaagtgctcagagaggtgg 146


 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatgg 369
           |||||||| |||||||||| || || ||||||||||||||||
Sbjct: 148 agaccatgactgctaaagaaaaggggaaatttgaagatatgg 189


>L32859 Rainbow trout HMG-1 gene exons 2-5, complete cds.
            Length = 3882
            
 Score =  127 bits (64), Expect = 8e-27
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                        
Query: 12   agatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcg 71
            |||||| | ||||||||| ||||| ||||| || ||||| |  ||||| || || |||||
Sbjct: 1285 agatccaaggaagccgaggggcaagatgtcctcctatgcctactttgtccagacctgtcg 1344

                                                                        
Query: 72   ggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaa 131
            ||||||||| |||||||| |||||||| ||||| ||||||||||||||||| || |||||
Sbjct: 1345 ggaggagcacaagaagaaacacccagaagcttccgtcaacttctcagagttctccaagaa 1404

                                    
Query: 132  gtgctcagagaggtggaaggtaag 155
            |||||| ||||| |||||||||||
Sbjct: 1405 gtgctctgagagatggaaggtaag 1428


 Score = 50.1 bits (25), Expect = 0.001
 Identities = 97/121 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1028 ggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataacactgctgca 1087
            |||||||| || |||||||| || ||||| |||||||||| |||||| |||    | || 
Sbjct: 2358 ggcctgtctatcggtgatgtggccaagaagctgggagagaagtggaacaacctaacagcg 2417

                                                                        
Query: 1088 gatgacaagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaaggta 1147
            || ||||||   || ||||| ||||||||| | ||||||||||| || ||||| ||||||
Sbjct: 2418 gaggacaaggtaccctatgagaagaaggcttccaagctgaaggagaagtacgagaaggta 2477

             
Query: 1148 a 1148
            |
Sbjct: 2478 a 2478


 Score = 46.1 bits (23), Expect = 0.023
 Identities = 122/155 (78%)
 Strand = Plus / Plus

                                                                        
Query: 328  agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
            ||||||||||||| || ||||| || || ||||| ||| |||| |||  ||||||||  |
Sbjct: 1845 agaccatgtctgccaaggagaaggggaagtttgaggatctggccaaactggacaaggtgc 1904

                                                                        
Query: 388  gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
            | ||||| || || ||||  | ||| || |||||||| || ||||  || |||| |||||
Sbjct: 1905 gatatgagagggagatgaggagctacattcctcccaagggagagaagaagaagaggttca 1964

                                               
Query: 448  aggatcccaatgcacccaagaggcctccgtgagta 482
            |||| ||||| || |||||||| ||  ||||||||
Sbjct: 1965 aggaccccaacgcccccaagagaccatcgtgagta 1999


 Score = 44.1 bits (22), Expect = 0.090
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 2352 cttgtctataaagcatttaacccccc 2377
            ||||| ||||||||||||||||||||
Sbjct: 3186 cttgtttataaagcatttaacccccc 3211


>X80460 M.musculus HMG1-R-135 gene
           Length = 190
           
 Score =  127 bits (64), Expect = 8e-27
 Identities = 126/144 (87%), Gaps = 2/144 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgc 61
           ||||||||  |||||||||||||| ||||||||||||||| ||||||||||| ||| |||
Sbjct: 2   tgggcaaaaaagatcctaagaagctgagaggcaaaatgtcctcatatgcattctttttgc 61

                                                                       
Query: 62  aaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagt 121
           |||| |   ||| | |||| |||||||||||||| ||||||||  ||||||| |||||||
Sbjct: 62  aaaccttctgggtgtagcacaagaagaagcacccggatgcttc-ttcaactt-tcagagt 119

                                   
Query: 122 tttctaagaagtgctcagagaggt 145
           | ||||||||||||||||||||||
Sbjct: 120 tctctaagaagtgctcagagaggt 143


 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatgg 369
           |||||||| |||||||||| || || ||||||||||||||||
Sbjct: 147 agaccatgactgctaaagaaaaggggaaatttgaagatatgg 188


>X80464 M.musculus HMG1-R-161 gene
           Length = 195
           
 Score =  125 bits (63), Expect = 3e-26
 Identities = 128/147 (87%), Gaps = 2/147 (1%)
 Strand = Plus / Plus

                                                                       
Query: 2   tgggcaaaggagatcctaagaagcc-gagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||  ||||||||||||| | ||||||||||||||| ||||||||||| ||| ||
Sbjct: 2   tgggcaaaaaagatcctaagaaggctgagaggcaaaatgtcctcatatgcattctttttg 61

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||| | | ||| | |||| |||||||||||||  ||||||||  ||||||| ||||||
Sbjct: 62  caaaccttttgggtgtagcacaagaagaagcacctggatgcttc-ttcaacttttcagag 120

                                      
Query: 121 ttttctaagaagtgctcagagaggtgg 147
           || ||||||||||||||||||||||||
Sbjct: 121 ttctctaagaagtgctcagagaggtgg 147


 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatgg 369
           |||||||| |||||||||| || || ||||||||||||||||
Sbjct: 149 agaccatgactgctaaagaaaaggggaaatttgaagatatgg 190


>X02666 Trout mRNA for high mobility group protein HMG-T
           Length = 716
           
 Score =  117 bits (59), Expect = 7e-24
 Identities = 119/139 (85%)
 Strand = Plus / Plus

                                                                       
Query: 12  agatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcg 71
           |||||| | ||||||||| ||||| ||||| || ||||| |  ||||| || ||| ||||
Sbjct: 9   agatccaaggaagccgaggggcaagatgtcctcctatgcctactttgtccagactcgtcg 68

                                                                       
Query: 72  ggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaa 131
           ||||||||| |||||||| |||||||| ||||| ||||||||||||||||| || |||||
Sbjct: 69  ggaggagcacaagaagaaacacccagaagcttccgtcaacttctcagagttctccaagaa 128

                              
Query: 132 gtgctcagagaggtggaag 150
           |||||| ||||| ||||||
Sbjct: 129 gtgctctgagagatggaag 147


 Score = 44.1 bits (22), Expect = 0.090
 Identities = 112/142 (78%)
 Strand = Plus / Plus

                                                                       
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaagcggacaaggccc 387
           ||||||||||||| || ||||| || || ||||| ||| |||| |||  ||||||||  |
Sbjct: 146 agaccatgtctgccaaggagaaggggaagtttgaggatctggccaaactggacaaggtgc 205

                                                                       
Query: 388 gttatgaaagagaaatgaaaacctatatccctcccaaaggggagacaaaaaagaagttca 447
           | ||||| || || ||||  | ||| || |||||||| || ||||  || |||| |||||
Sbjct: 206 gatatgagagggagatgaggagctacattcctcccaagggagagaagaagaagaggttca 265

                                 
Query: 448 aggatcccaatgcacccaagag 469
           |||| ||||| || ||||||||
Sbjct: 266 aggaccccaacgcccccaagag 287


 Score = 44.1 bits (22), Expect = 0.090
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 2352 cttgtctataaagcatttaacccccc 2377
            ||||| ||||||||||||||||||||
Sbjct: 648  cttgtttataaagcatttaacccccc 673


>U21933 Xenopus laevis high mobility group protein-1 (HMG-1) mRNA,
           complete
           Length = 1552
           
 Score =  107 bits (54), Expect = 7e-21
 Identities = 126/150 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| |  ||||||
Sbjct: 57  atgggtaaaggtgatcctaagaagccaagaggaaaaatgtcctcatatgcttactttgtg 116

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           ||||| ||  | || ||||| ||||| |||||||| ||||| || || || ||  |||||
Sbjct: 117 caaacatgcagagaagagcacaagaaaaagcaccctgatgcctctgtaaattttgcagag 176

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||||||||| |||||||| |||||||||
Sbjct: 177 ttttctaagaaatgctcagaaaggtggaag 206


 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 45/45 (100%)
 Strand = Plus / Plus

                                                         
Query: 2353 ttgtctataaagcatttaacccccctgtacacaactcactccttt 2397
            |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 705  ttgtctataaagcatttaacccccctgtacacaactcactccttt 749


 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 96/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 357 tttgaagatatggcaaaagcggacaaggcccgttatgaaagagaaatgaaaacctatatc 416
           |||||||||||||||||||| ||||| |  || ||||| || ||||||||||  ||||| 
Sbjct: 231 tttgaagatatggcaaaagccgacaaagttcgctatgagagggaaatgaaaagttatatt 290

                                                                
Query: 417 cctcccaaaggggagacaaaaaagaagttcaaggatcccaatgcacccaagag 469
           || |||||||| || |||||||||| ||||||||| || |||||||| |||||
Sbjct: 291 ccacccaaaggagaaacaaaaaagaggttcaaggaccctaatgcaccaaagag 343


 Score = 87.7 bits (44), Expect = 7e-15
 Identities = 82/92 (89%), Gaps = 2/92 (2%)
 Strand = Plus / Plus

                                                                        
Query: 1055 aaactgggagagatgtggaataacactgctgcagatgacaagcagccttatgaaaagaag 1114
            |||||||||||||||||||||||||||||| |||||||||| | ||| |||| || ||||
Sbjct: 435  aaactgggagagatgtggaataacactgctacagatgacaaactgccctatg-aacgaag 493

                                            
Query: 1115 -gctgcgaagctgaaggaaaaatacgaaaagg 1145
             ||||| ||||||||||| ||||| |||||||
Sbjct: 494  agctgccaagctgaaggagaaatatgaaaagg 525


 Score = 73.8 bits (37), Expect = 1e-10
 Identities = 94/111 (84%), Gaps = 4/111 (3%)
 Strand = Plus / Plus

                                                                        
Query: 2464 gtatagttaacacactaccgaatgtgtctttagatagccctgtc--ctggtggtattttc 2521
            ||||||||||||||||||||||||||||  ||| ||| ||||||   | ||||| || | 
Sbjct: 851  gtatagttaacacactaccgaatgtgtc--tagctagtcctgtcttatagtggttttgtt 908

                                                               
Query: 2522 aatagccactaaccttgcctggtacagtatgggggttgtaaattggcatgg 2572
            ||| ||||||||||||||||  |||||||  ||||||||||| ||||||||
Sbjct: 909  aattgccactaaccttgcctcttacagtaaaggggttgtaaactggcatgg 959


 Score = 42.1 bits (21), Expect = 0.36
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                     
Query: 2413 aaatgtaaggctgtgtaagatttgtttttaaactgtacagt 2453
            |||| ||| ||||||||||||||| |||| |||||||||||
Sbjct: 763  aaatataatgctgtgtaagatttgatttt-aactgtacagt 802


>I14731 Sequence 10 from patent US 5451670.
            Length = 2188
            
 Score = 91.7 bits (46), Expect = 4e-16
 Identities = 46/46 (100%)
 Strand = Plus / Minus

                                                          
Query: 2352 cttgtctataaagcatttaacccccctgtacacaactcactccttt 2397
            ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 46   cttgtctataaagcatttaacccccctgtacacaactcactccttt 1


>X63463 G.gallus HMG2a mRNA
           Length = 1073
           
 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 46  tatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttca 105
           ||||| || |||||||| || || || |||||||| ||||||||| ||||||| | | | 
Sbjct: 106 tatgccttctttgtgcagacgtgccgtgaggagcacaagaagaagaacccagaggttcct 165

                                                        
Query: 106 gtcaacttctcagagttttctaagaagtgctcagagaggtggaag 150
           ||||||||  ||||||| |||||||||||||||||||||||||||
Sbjct: 166 gtcaactttgcagagttctctaagaagtgctcagagaggtggaag 210


 Score = 40.1 bits (20), Expect = 1.4
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                
Query: 1094 aagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||||| ||| | || |||||||| ||||||||||| || ||||| ||||
Sbjct: 475  aagcagccctataacaataaggctgctaagctgaaggagaagtacgagaagg 526


>Z29356 Gallus domesticus of h71t7 gene encoding G.domesticus
           expressed sequence
           Length = 237
           
 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||||||||| ||||| |||||||||||||| |||||||| ||||| || || ||||||
Sbjct: 153 atgggcaaaggtgatcccaagaagccgagaggtaaaatgtcttcatacgccttctttgtg 212

                                    
Query: 61  caaacttgtcgggaggagcataaga 85
           ||||| || ||| ||||||| ||||
Sbjct: 213 caaacctgccggcaggagcacaaga 237


>D84418 Rat mRNA for chromosomal protein HMG2, complete cds.
            Length = 1072
            
 Score = 77.8 bits (39), Expect = 6e-12
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| |||||| | ||||| || ||||||
Sbjct: 375  gccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccccggcctg 434

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            || ||||| |||  ||| ||||||||||| |||||||||
Sbjct: 435  tctattggagatactgcaaagaaactgggggagatgtgg 473


 Score = 44.1 bits (22), Expect = 0.090
 Identities = 118/150 (78%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           |||||||| || || || || |||||| | ||||| ||||| || || || || || |||
Sbjct: 75  atgggcaagggggaccccaacaagccgcggggcaagatgtcctcgtacgccttcttcgtg 134

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || || ||||||||||| ||||||||||| || ||  | || ||||||||| | |||
Sbjct: 135 cagacctgccgggaggagcacaagaagaagcatcccgactcgtcggtcaacttcgccgag 194

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||| || || ||||| ||||||
Sbjct: 195 ttctcgaagaaatgttcggagagatggaag 224


>Z46757 M.musculus mRNA for high mobility group 2 protein.
            Length = 870
            
 Score = 77.8 bits (39), Expect = 6e-12
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| ||||||   ||||| || ||||||
Sbjct: 397  gccttcttcctgttttgctctgaaaatcgcccaaagatcaaaattgaacacccaggcctg 456

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            || ||||| |||  ||||||||||||||| |||||||||
Sbjct: 457  tctattggagatactgcgaagaaactgggtgagatgtgg 495


 Score = 44.1 bits (22), Expect = 0.090
 Identities = 118/150 (78%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           |||||||| || || || || |||||| | ||||||||||| || || || || || |||
Sbjct: 97  atgggcaagggtgaccccaacaagccgcggggcaaaatgtcctcgtacgccttcttcgtg 156

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || || || |||||||| ||||||||||| || ||  | || || |||||| | |||
Sbjct: 157 cagacctgccgcgaggagcacaagaagaagcatcccgactcgtcggtgaacttcgccgag 216

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||| ||||| ||||| ||||||
Sbjct: 217 ttctccaagaaatgctccgagagatggaag 246


>U31513 Ambystoma mexicanum high mobility group protein-2 (HMG-2)
           mRNA,
           Length = 1048
           
 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 122/150 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||| ||||||||||| || |||||  | ||||| ||||| || || || |  ||||||
Sbjct: 19  atgggtaaaggagatccgaacaagccccggggcaagatgtcgtcctacgcctactttgtg 78

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || || |||||||||||||||||||||||||| || || || || |||||| | |||
Sbjct: 79  cagacgtgccgggaggagcataagaagaagcacccggacgcctccgtaaacttcgccgag 138

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || ||||| |||||||| ||  ||||||||
Sbjct: 139 ttctctaaaaagtgctccgaacggtggaag 168


 Score = 46.1 bits (23), Expect = 0.023
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 447 aaggatcccaatgcacccaagag 469
           |||||||||||||||||||||||
Sbjct: 289 aaggatcccaatgcacccaagag 311


>D14314 Chicken mRNA for HMG-1, complete cds.
           Length = 740
           
 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 88/105 (83%), Gaps = 3/105 (2%)
 Strand = Plus / Plus

                                                                       
Query: 46  tatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttca 105
           ||||| || |||||||| || || || |||||||| ||||||||   |||||| | | | 
Sbjct: 66  tatgccttctttgtgcagacgtgccgtgaggagcacaagaagaa---cccagaggttcct 122

                                                        
Query: 106 gtcaacttctcagagttttctaagaagtgctcagagaggtggaag 150
           ||||||||  ||||||| |||||||||||||||||||||||||||
Sbjct: 123 gtcaactttgcagagttctctaagaagtgctcagagaggtggaag 167


 Score = 40.1 bits (20), Expect = 1.4
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                
Query: 1094 aagcagccttatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||||| ||| | || |||||||| ||||||||||| || ||||| ||||
Sbjct: 432  aagcagccctataacaataaggctgctaagctgaaggagaagtacgagaagg 483


>Z17240 Homo sapiens for mRNA encoding HMG2B.
            Length = 1066
            
 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| |||||| | ||||| |||||||| 
Sbjct: 232  gccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggccta 291

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            |||||||| |||  ||| |||||| |||| || ||||||
Sbjct: 292  tccattggggatactgcaaagaaattgggtgaaatgtgg 330


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                          
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaa 374
           ||||||||||||| || |||||    || ||||||||||||||||||
Sbjct: 80  agaccatgtctgcaaaggagaagtcgaagtttgaagatatggcaaaa 126


>M83665 Human high mobility group 2 protein (HMG-2) gene, complete
            cds.
            Length = 4341
            
 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| |||||| | ||||| |||||||| 
Sbjct: 2327 gccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggccta 2386

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            |||||||| |||  ||| |||||| |||| || ||||||
Sbjct: 2387 tccattggggatactgcaaagaaattgggtgaaatgtgg 2425


 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 121/152 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
            ||||| |||||||| || || |||||| | ||||||||||| || || || || || |||
Sbjct: 1669 atgggtaaaggagaccccaacaagccgcggggcaaaatgtcctcgtacgccttcttcgtg 1728

                                                                        
Query: 61   caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
            || || || ||||| ||||| |||||||| ||||| ||  |||| ||||| ||| | || 
Sbjct: 1729 cagacctgccgggaagagcacaagaagaaacacccggactcttccgtcaatttcgcggaa 1788

                                            
Query: 121  ttttctaagaagtgctcagagaggtggaaggt 152
            || || |||||||| || ||||| ||||||||
Sbjct: 1789 ttctccaagaagtgttcggagagatggaaggt 1820


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 2147 aggatattgctgcatatcg 2165
            |||||||||||||||||||
Sbjct: 3078 aggatattgctgcatatcg 3096


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                           
Query: 328  agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaa 374
            ||||||||||||| || |||||    || ||||||||||||||||||
Sbjct: 2102 agaccatgtctgcaaaggagaagtcgaagtttgaagatatggcaaaa 2148


>X62534 H.sapiens HMG-2 mRNA
            Length = 1301
            
 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| |||||| | ||||| |||||||| 
Sbjct: 515  gccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggccta 574

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            |||||||| |||  ||| |||||| |||| || ||||||
Sbjct: 575  tccattggggatactgcaaagaaattgggtgaaatgtgg 613


 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||| |||||||| || || |||||| | ||||||||||| || || || || || |||
Sbjct: 215 atgggtaaaggagaccccaacaagccgcggggcaaaatgtcctcgtacgccttcttcgtg 274

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || || ||||| ||||| |||||||| ||||| ||  |||| ||||| ||| | || 
Sbjct: 275 cagacctgccgggaagagcacaagaagaaacacccggactcttccgtcaatttcgcggaa 334

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || |||||||| || ||||| ||||||
Sbjct: 335 ttctccaagaagtgttcggagagatggaag 364


 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2146 aaggatattgctgcatatcg 2165
            ||||||||||||||||||||
Sbjct: 683  aaggatattgctgcatatcg 702


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                          
Query: 328 agaccatgtctgctaaagagaaaggaaaatttgaagatatggcaaaa 374
           ||||||||||||| || |||||    || ||||||||||||||||||
Sbjct: 363 agaccatgtctgcaaaggagaagtcgaagtttgaagatatggcaaaa 409


>X98857 L.fluviatilis mRNA for HMG protein
           Length = 1650
           
 Score = 67.9 bits (34), Expect = 6e-09
 Identities = 121/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           ||||| || |||||||| |||||||| |  ||||| ||||| ||||| || |  || |||
Sbjct: 73  atgggtaagggagatccgaagaagcccaagggcaagatgtcgtcatacgcctacttcgtg 132

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || || || |||||||| ||||||||| ||||||| || || ||||||||  | |||
Sbjct: 133 cagacgtgccgcgaggagcacaagaagaagaacccagaggcgtcggtcaactttgccgag 192

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||||||||| ||| ||||||||
Sbjct: 193 ttctccaagaagtgctccgagcggtggaag 222


 Score = 40.1 bits (20), Expect = 1.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 1047 ttgcgaagaaactgggagagatgtggaa 1074
            |||| ||||||||||| |||||||||||
Sbjct: 449  ttgccaagaaactgggtgagatgtggaa 476


>X67668 M.musculus mRNA for high mobility group 2 protein
            Length = 847
            
 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||| ||| || ||||||||  |||||||||| ||||||   ||| | || ||||||
Sbjct: 436  gccttctgcctgttttgctctgaaaatcgcccaaagatcaaaattgaatacccgggcctg 495

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            || ||||| |||  ||||||||||||||| |||||||||
Sbjct: 496  tctattggagatactgcgaagaaactgggtgagatgtgg 534


 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 31  ggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaag 90
           ||||||||||| || || || ||||||||||| || || ||||||||||| |||||||||
Sbjct: 166 ggcaaaatgtcctcttacgccttttttgtgcagacctgccgggaggagcacaagaagaag 225

             
Query: 91  ca 92
           ||
Sbjct: 226 ca 227


>J02895 Pig non-histone chromosomal protein (HMG2) mRNA, complete cds.
            Length = 1153
            
 Score = 61.9 bits (31), Expect = 4e-07
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                        
Query: 974  gccttcttcctcttctgctctgagtatcgcccaaaaatcaaaggagaacatcctggcctg 1033
            ||||||||||| || ||||||||  |||||||||| |||||| | ||||| |||||| | 
Sbjct: 444  gccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggctta 503

                                                   
Query: 1034 tccattggtgatgttgcgaagaaactgggagagatgtgg 1072
            |||||||| |||  ||| |||||| |||| || ||||||
Sbjct: 504  tccattggggatactgcaaagaaattgggtgaaatgtgg 542


 Score = 58.0 bits (29), Expect = 6e-06
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  cgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaag 129
           ||||||||||| |||||||| ||||| ||| | || ||||||||| | ||||| || |||
Sbjct: 213 cgggaggagcacaagaagaaacaccccgattcctcggtcaacttcgccgagttctccaag 272

                                
Query: 130 aagtgctcagagaggtggaag 150
           |||||||| ||| | ||||||
Sbjct: 273 aagtgctccgagcgatggaag 293


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                       
Query: 1103 tatgaaaagaaggctgcgaagctgaaggaaaaatacgaaaagg 1145
            |||||| |||| || || ||||| ||||||||||| |||||||
Sbjct: 573  tatgaacagaaagcagctaagctaaaggaaaaatatgaaaagg 615


>D30765 Xenopus laevis mRNA for HMG-X protein, complete cds.
           Length = 1081
           
 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 120/150 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtg 60
           |||||||| ||||||||||| |||||  | || || ||||| || || || | ||| |||
Sbjct: 105 atgggcaagggagatcctaacaagcctcgggggaagatgtcctcctacgcctatttcgtg 164

                                                                       
Query: 61  caaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagag 120
           || || ||  |||||||||| |||||||||||||| ||  | || ||||||||||| || 
Sbjct: 165 cagacctgcagggaggagcacaagaagaagcacccggacacctccgtcaacttctccgac 224

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           || || ||||| ||||| ||||| ||||||
Sbjct: 225 ttctccaagaaatgctccgagagatggaag 254


 Score = 38.2 bits (19), Expect = 5.5
 Identities = 31/35 (88%)
 Strand = Plus / Plus

                                              
Query: 402 atgaaaacctatatccctcccaaaggggagacaaa 436
           ||||| ||||||||||| || ||||| ||||||||
Sbjct: 327 atgaagacctatatcccaccaaaaggagagacaaa 361


>L32954 Rainbow trout HMG-T2 gene exons 1-4, complete cds.
           Length = 1368
           
 Score = 54.0 bits (27), Expect = 9e-05
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 101 cttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaaggtaag 155
           ||||||| ||||| || ||||| || ||||| |||||||||||||||| ||||||
Sbjct: 130 cttcagtgaacttttccgagttctcaaagaaatgctcagagaggtggagggtaag 184


>M83235 Gallus gallus non-histone chromosomal protein (HMG2) mRNA,
           complete
           Length = 1083
           
 Score = 52.0 bits (26), Expect = 4e-04
 Identities = 65/78 (83%)
 Strand = Plus / Plus

                                                                       
Query: 73  gaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaag 132
           |||||||| |||||||||||||| ||  | |||||||||||| | ||||| ||   ||||
Sbjct: 155 gaggagcacaagaagaagcacccggactcgtcagtcaacttcgccgagttctcgcggaag 214

                             
Query: 133 tgctcagagaggtggaag 150
           ||||| ||| ||||||||
Sbjct: 215 tgctcggagcggtggaag 232


>AF003626 Homo sapiens cosmids IM0525, LC1233, Qc3C1, LB1439, Qc12C11
             and
             Length = 86769
             
 Score = 50.1 bits (25), Expect = 0.001
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 121   ttttctaagaagtgctcagagaggtggaaggta 153
             ||||| ||||||||||| |||||||||||||||
Sbjct: 66881 ttttccaagaagtgctctgagaggtggaaggta 66913


>M80574 Gallus domesticus high-mobility group-2 protein (HMG-2)
           mRNA,
           Length = 995
           
 Score = 46.1 bits (23), Expect = 0.023
 Identities = 62/75 (82%)
 Strand = Plus / Plus

                                                                       
Query: 76  gagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgc 135
           ||||| |||||||||||||| ||  | |||||||||||| | ||||| ||   |||||||
Sbjct: 175 gagcacaagaagaagcacccggactcgtcagtcaacttcgccgagttctcgcggaagtgc 234

                          
Query: 136 tcagagaggtggaag 150
           || ||| ||||||||
Sbjct: 235 tcggagcggtggaag 249


>X80869 P.citri gene for cytochrome oxidase subunit I
            Length = 366
            
 Score = 46.1 bits (23), Expect = 0.023
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 1627 tatagttcagtaaattgaaatattaaa 1653
            ||||| |||||||||||||||||||||
Sbjct: 276  tatagatcagtaaattgaaatattaaa 250


>AF022465 Mus musculus high mobility group protein homolog HMG4 (Hmg4)
            mRNA,
            Length = 1502
            
 Score = 44.1 bits (22), Expect = 0.090
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 1025 cctggcctgtccattggtgatgttgcgaagaaactgggagagatgtggaataac 1078
            |||||| | |||||||| ||||| || || || ||||| |||||||||||||||
Sbjct: 373  cctggcatctccattggagatgtggcaaaaaagctgggtgagatgtggaataac 426


 Score = 42.1 bits (21), Expect = 0.36
 Identities = 84/105 (80%)
 Strand = Plus / Plus

                                                                       
Query: 46  tatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttca 105
           ||||| || |||||||| || ||  |||| || |||||||||||  ||||||| | | | 
Sbjct: 73  tatgccttctttgtgcagacatgcagggaagaacataagaagaaaaacccagaggttccc 132

                                                        
Query: 106 gtcaacttctcagagttttctaagaagtgctcagagaggtggaag 150
           ||||| ||  | ||||| || ||||||||||| ||||||||||||
Sbjct: 133 gtcaattttgctgagttctccaagaagtgctcggagaggtggaag 177


>AC002510 Arabidopsis thaliana chromosome II BAC T32G6 genomic sequence,
             Length = 91979
             
 Score = 44.1 bits (22), Expect = 0.090
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 299   aacttaaacttacaaattaattattt 324
             ||||||||||||||| ||||||||||
Sbjct: 75922 aacttaaacttacaagttaattattt 75947


>AB009838 Loligo bleekeri mitochondrial DNA, complete sequence.
            Length = 8148
            
 Score = 44.1 bits (22), Expect = 0.090
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 610  ttatatttaaatagtataaaat 631
            ||||||||||||||||||||||
Sbjct: 6884 ttatatttaaatagtataaaat 6863


>Y10043 Homo sapiens mRNA for high mobility group protein HMG2a
           Length = 1633
           
 Score = 44.1 bits (22), Expect = 0.090
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 121 ttttctaagaagtgctcagagaggtggaag 150
           ||||| ||||||||||| ||||||||||||
Sbjct: 207 ttttccaagaagtgctctgagaggtggaag 236


>AC004008 Human PAC clone DJ0899B21 from 7p15-p21, complete sequence.
             Length = 90389
             
 Score = 42.1 bits (21), Expect = 0.36
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 703   tttgatctttttatttcttgaaaaa 727
             |||||| ||||||||||||||||||
Sbjct: 74760 tttgatttttttatttcttgaaaaa 74784


>AE001182;AE000783 Borrelia burgdorferi (section 68 of 70) of the
            complete genome.
            Length = 11228
            
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1861 ggttttaatagagttaggat 1880
            ||||||||||||||||||||
Sbjct: 2644 ggttttaatagagttaggat 2663


>AE000963;AE000782 Archaeoglobus fulgidus section 144 of 172 of the
            complete genome.
            Length = 22014
            
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 129  gaagtgctcagagaggtgga 148
            ||||||||||||||||||||
Sbjct: 4060 gaagtgctcagagaggtgga 4079


>U60491 Nicotiana tabacum actin (Tob66) gene, partial cds.
           Length = 1677
           
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 346 agaaaggaaaatttgaagat 365
           ||||||||||||||||||||
Sbjct: 934 agaaaggaaaatttgaagat 915


>AB001684 Chlorella vulgaris C-27 chloroplast DNA, complete sequence.
              Length = 150613
              
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 700    ccttttgatctttttatttcttgaaaaa 727
              ||||||||||||||| ||| ||||||||
Sbjct: 142202 ccttttgatcttttttttttttgaaaaa 142175


>Z50742 Caenorhabditis elegans cosmid K09A11
            Length = 20856
            
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 1422 aaaaatgagcattttcaaat 1441
            ||||||||||||||||||||
Sbjct: 3011 aaaaatgagcattttcaaat 2992


>X64643 H.sapiens c6.1A mRNA
            Length = 2407
            
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 396  agagaaatgaaaacctatat 415
            ||||||||||||||||||||
Sbjct: 2198 agagaaatgaaaacctatat 2217


>Z83838 Human DNA sequence from PAC 127B20 on chromosome 22q11.2-qter,
              Length = 135258
              
 Score = 40.1 bits (20), Expect = 1.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 395    aagagaaatgaaaacctatatccc 418
              ||||||||||||||||| ||||||
Sbjct: 123039 aagagaaatgaaaacctgtatccc 123062


>L77118 Methanococcus jannaschii large extra-chromosomal element,
            complete
            Length = 58407
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1513 aacatttatgttcttttccttta 1535
            |||||||||||| ||||||||||
Sbjct: 5014 aacatttatgttgttttccttta 5036


>L08814 Rat CIIDBP (homologous to human SSRP-1 and mouse T160 genes)
            mRNA,
            Length = 2082
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 447  aaggatcccaatgcacccaagaggcct 473
            |||||||| ||||| ||||||||||||
Sbjct: 1180 aaggatccaaatgcccccaagaggcct 1206


>M18222;J03590 Mouse CD3-delta (T3-delta) gene, 5' end; and
           CD3-gamma (T3-gamma)
           Length = 1726
           
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 857 caatgcatcacagaaattcacag 879
           |||||||| ||||||||||||||
Sbjct: 990 caatgcataacagaaattcacag 968


>X95600 M.musculus mRNA for cadherin-8
            Length = 2812
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1422 cttgaagttcatgaaaatg 1440


>AB010437 Rattus rattus rCdh8-a1 mRNA for cadherin-8, complete cds.
            Length = 3015
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1725 cttgaagttcatgaaaatg 1743


>AB010436 Rattus rattus rCdh8 mRNA for cadherin-8, complete cds.
            Length = 3126
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1725 cttgaagttcatgaaaatg 1743


>AL021633 Arabidopsis thaliana DNA chromosome 4, BAC clone F8F16 (ESSAII
             project)
             Length = 93037
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1659  aattttcagctttagtcat 1677
             |||||||||||||||||||
Sbjct: 29677 aattttcagctttagtcat 29659


>I55098 Sequence 53 from patent US 5646250.
            Length = 2550
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1177 cttgaagttcatgaaaatg 1195


>I55093 Sequence 43 from patent US 5646250.
            Length = 3043
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1733 cttgaagttcatgaaaatg 1751


>I55092 Sequence 41 from patent US 5646250.
            Length = 3136
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1733 cttgaagttcatgaaaatg 1751


>I46829 Sequence 47 from patent US 5639634.
            Length = 2550
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1177 cttgaagttcatgaaaatg 1195


>I34431 Sequence 53 from patent US 5597725.
            Length = 2550
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1177 cttgaagttcatgaaaatg 1195


>I34426 Sequence 43 from patent US 5597725.
            Length = 3043
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1733 cttgaagttcatgaaaatg 1751


>I34425 Sequence 41 from patent US 5597725.
            Length = 3136
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1733 cttgaagttcatgaaaatg 1751


>Z47547 C.crispus complete mitochondrial genome.
            Length = 25836
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 707  atctttttatttcttgaaaaata 729
            |||||||||||| ||||||||||
Sbjct: 4779 atctttttattttttgaaaaata 4801


>Z46224 C.crispus Mitochondrion gene for large subunit ribosomal RNA
            Length = 2583
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 707  atctttttatttcttgaaaaata 729
            |||||||||||| ||||||||||
Sbjct: 1091 atctttttattttttgaaaaata 1113


>U84139 Bos taurus structure-specific recognition protein 1 (SSRP1)
           mRNA,
           Length = 1834
           
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 446 caaggatcccaatgcacccaagaggcc 472
           |||||| |||||||| |||||||||||
Sbjct: 876 caaggaccccaatgcccccaagaggcc 902


>AL010134 Plasmodium falciparum DNA *** SEQUENCING IN PROGRESS *** from
             contig
             Length = 57824
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1512  aaacatttatgttcttttccttt 1534
             |||||||| ||||||||||||||
Sbjct: 41809 aaacatttctgttcttttccttt 41787


>Z99281 Caenorhabditis elegans cosmid Y57G11C
             Length = 313573
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 279   ataatttacttaaatgtta 297
             |||||||||||||||||||
Sbjct: 64328 ataatttacttaaatgtta 64310


>Z35597 Caenorhabditis elegans cosmid C36E8
             Length = 31808
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1423  aaaatgagcattttcaaatggct 1445
             |||||||||||||| ||||||||
Sbjct: 15395 aaaatgagcattttgaaatggct 15373


>AF003386 Caenorhabditis elegans cosmid F59E12.
             Length = 42430
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 308   ttacaaattaattattttg 326
             |||||||||||||||||||
Sbjct: 30744 ttacaaattaattattttg 30762


>Z30950 C.crispus mitochondrial gene for small subunit ribosomal RNA,
            NADH-
            Length = 3235
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 707  atctttttatttcttgaaaaata 729
            |||||||||||| ||||||||||
Sbjct: 2864 atctttttattttttgaaaaata 2886


>AF026208 Caenorhabditis elegans cosmid F52D1.
             Length = 29138
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 711   ttttatttcttgaaaaata 729
             |||||||||||||||||||
Sbjct: 17793 ttttatttcttgaaaaata 17775


>Z69712 Human DNA sequence from cosmid N12G10, on chromosome
             22q11.2-qter.
             Length = 45353
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 614   atttaaatagtataaaatt 632
             |||||||||||||||||||
Sbjct: 44395 atttaaatagtataaaatt 44413


>Z84495 Human DNA sequence from cosmid LUCA8
            Length = 28031
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 975  ccttcttcctcttctgctc 993
            |||||||||||||||||||
Sbjct: 2973 ccttcttcctcttctgctc 2955


>L81635 Homo sapiens (subclone 2_c11 from P1 H33) DNA sequence,
            complete
            Length = 4078
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 395  aagagaaatgaaaacctatatcc 417
            ||||||||||||||| |||||||
Sbjct: 1988 aagagaaatgaaaacatatatcc 2010


>Z68754 Human DNA sequence from cosmid cE78H10, on chromosome
             22q11.2-qter.
             Length = 24888
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 614   atttaaatagtataaaatt 632
             |||||||||||||||||||
Sbjct: 19682 atttaaatagtataaaatt 19700


>L34060 Homo sapiens cadherin-8 mRNA, complete cds.
            Length = 2545
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1384 cttgaagttcatgaaaatg 1402
            |||||||||||||||||||
Sbjct: 1177 cttgaagttcatgaaaatg 1195


>AC002378 Human PAC clone DJ438O4 from 22q12.1-qter, complete
            sequence.
            Length = 77516
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1422 aaaaatgagcattttcaaa 1440
            |||||||||||||||||||
Sbjct: 1772 aaaaatgagcattttcaaa 1754


>AC002124 Human BAC clone RG180O01 from 7p15-p21, complete sequence.
             Length = 100923
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 302   ttaaacttacaaattaatt 320
             |||||||||||||||||||
Sbjct: 91664 ttaaacttacaaattaatt 91682


>Z93931 Human DNA sequence from PAC 438G17 on chromosome 6q22. Contains
             Length = 148198
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                                
Query: 116   cagagttttctaagaagtgctcagagaggtggaag 150
             |||| ||||| ||||| ||||| ||||||||||||
Sbjct: 95695 cagaattttccaagaattgctctgagaggtggaag 95661


>AL008907 H.sapiens STS from genomic clone 404F18.
            Length = 348
            
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 1097 cagccttatgaaaagaagg 1115
            |||||||||||||||||||
Sbjct: 95   cagccttatgaaaagaagg 77


>AC004130 Homo sapiens BAC clone RG293F17 from 7p15-p21, complete
             sequence.
             Length = 116215
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2128  atcctccctttgctttgga 2146
             |||||||||||||||||||
Sbjct: 10116 atcctccctttgctttgga 10098


>AC004000 Human PAC clone DJ404F18 from Xq23, complete sequence.
              Length = 128117
              
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 1097   cagccttatgaaaagaagg 1115
              |||||||||||||||||||
Sbjct: 128007 cagccttatgaaaagaagg 128025


>AC003683 Homo sapiens Xp22 PAC RPCI1-147H15 (Research Park PAC library)
              Length = 127683
              
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 357    tttgaagatatggcaaaag 375
              |||||||||||||||||||
Sbjct: 118606 tttgaagatatggcaaaag 118588


>AC003013 Human PAC clone DJ0205E24 from Xq23, complete sequence.
             Length = 173452
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 395   aagagaaatgaaaacctat 413
             |||||||||||||||||||
Sbjct: 88016 aagagaaatgaaaacctat 87998


>AC002556 Human Chromosome 11 pac pDJ9j14, complete sequence.
             Length = 123234
             
 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 395   aagagaaatgaaaacctat 413
             |||||||||||||||||||
Sbjct: 21414 aagagaaatgaaaacctat 21432


  Database: embl.fas
    Posted date:  May 15, 1998  5:37 PM
  Number of letters in database: 675,252,082
  Number of sequences in database:  442,729
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1123218
Number of Sequences: 442729
Number of extensions: 1123218
Number of successful extensions: 86816
Number of sequences better than 10.0: 106
length of query: 2575
length of database: 675,252,082
effective HSP length: 21
effective length of query: 2554
effective length of database: 665,954,773
effective search space: 1700848490242
effective search space used: 1700848490242
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox