PLN sequence format

From BioPerl
Jump to: navigation, search


Description

The PLN format stores a single sequence over one or more lines, with no annotation - it's plain !

This file format can be parsed by the Bio::SeqIO system using the Bio::SeqIO::pln module.

Example

GGGATAGATATATAGCGCGCTCGCCTCGCTCCGCTCTCGCGTC
GTTGTCGCTCTCGCTCGCGCTCTCTCTCCGTCCTTCTTTATATA
GGCTCTCG
Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox