SELEX multiple alignment format

From BioPerl
Jump to: navigation, search

Description

SELEX is an interleaved multiple alignment format that arose as an intuitive format, easy to write and manipulate manually with a text editor. It is usually easy to convert other alignment formats into SELEX format (though it can be harder to go the other way, since SELEX is more free-format than other alignment formats). For instance, GCG's MSF multiple alignment format and the output of the CLUSTALV multiple alignment program are similar interleaved formats. Because SELEX evolved to accomodate different user input styles, it is very tolerant of various inconsistencies such as different gap symbols, varying line lengths, etc.

SELEX format is used by Sean Eddy's HMMER package. It can store RNA secondary structure as part of the sequence annotation.

Example

#=SQ HSFAU  1.00 - - 0..0:0 H.sapiens fau mRNA
#=SQ HSFAU1 1.00 - - 0..0:0 H.sapiens fau 1 gene

HSFAU  ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtc
HSFAU1 ctaccattttccctctcgattctatatgtacactcgggacaagttctcct

HSFAU  gccaatatgcagctctttgtccgcgcccaggagctacacaccttcgaggt
HSFAU1 gatcgaaaacggcaaaactaaggccccaagtaggaatgccttagttttcg

HSFAU  gaccggccaggaaacggtcgcccagatcaaggctcatgtagcctcactgg
HSFAU1 gggttaacaatgattaacactgagcctcacacccacgcgatgccctcagc

HSFAU  agggcattgccccggaagatcaagtcgtgctcctggcaggcgcgcccctg
HSFAU1 tcctcgctcagcgctctcaccaacagccgtagcccgcagccccgctggac

HSFAU  gaggatgaggccactctgggccagtgcggggtggaggccctgactaccct
HSFAU1 accggttctccatccccgcagcgtagcccggaacatggtagctgccatct

HSFAU  ggaagtagcaggccgcatgcttggaggtaaagttcatggttccctggccc
HSFAU1 ttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgccccg

HSFAU  gtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaag
HSFAU1 tcctgcgcgagctgctgcccaggcaggttcgccggtgcgagcgtaaaggg

HSFAU  aagaagaagaagacaggtcgggctaagcggcggatgcagtacaaccggcg
HSFAU1 gcggagctaggactgccttgggcggtacaaatagcagggaaccgcgcggt

HSFAU  ctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgcca
HSFAU1 cgctcagcagtgacgtgacacgcagcccacggtctgtactgacgcgccct

HSFAU  actcttaagtcttttgtaattctggctttctctaataaaaaagccactta
HSFAU1 cgcttcttcctctttctcgactccatcttcgcggtagctgggaccgccgt

HSFAU  gttcagtcaaaaaaaaaa                                
HSFAU1 tcaggtaagaatggggccttggctggatccgaagggcttgtagcaggttg

HSFAU                                                    
HSFAU1 gctgcggggtcagaaggcgcggggggaaccgaagaacggggcctgctccg

HSFAU                                                    
HSFAU1 tggccctgctccagtccctatccgaactccttgggaggcactggccttcc

HSFAU                                                    
HSFAU1 gcacgtgagccgccgcgaccaccatcccgtcgcgatcgtttctggaccgc

HSFAU                                                    
HSFAU1 tttccactcccaaatctcctttatcccagagcatttcttggcttctctta

HSFAU                                                    
HSFAU1 caagccgtcttttctttactcagtcgccaatatgcagctctttgtccgcg

HSFAU                                                    
HSFAU1 cccaggagctacacaccttcgaggtgaccggccaggaaacggtcgcccag

HSFAU                                                    
HSFAU1 atcaaggtaaggctgcttggtgcgccctgggttccattttcttgtgctct

HSFAU                                                    
HSFAU1 tcactctcgcggcccgagggaacgcttacgagccttatctttccctgtag

HSFAU                                                    
HSFAU1 gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgct

HSFAU                                                    
HSFAU1 cctggcaggcgcgcccctggaggatgaggccactctgggccagtgcgggg

HSFAU                                                    
HSFAU1 tggaggccctgactaccctggaagtagcaggccgcatgcttggaggtgag

HSFAU                                                    
HSFAU1 tgagagaggaatgttctttgaagtaccggtaagcgtctagtgagtgtggg

HSFAU                                                    
HSFAU1 gtgcatagtcctgacagctgagtgtcacacctatggtaatagagtacttc

HSFAU                                                    
HSFAU1 tcactgtcttcagttcagagtgattcttcctgtttacatccctcatgttg

HSFAU                                                    
HSFAU1 aacacagacgtccatgggagactgagccagagtgtagttgtatttcagtc

HSFAU                                                    
HSFAU1 acatcacgagatcctagtctggttatcagcttccacactaaaaattaggt

HSFAU                                                    
HSFAU1 cagaccaggccccaaagtgctctataaattagaagctggaagatcctgaa

HSFAU                                                    
HSFAU1 atgaaacttaagatttcaaggtcaaatatctgcaactttgttctcattac

HSFAU                                                    
HSFAU1 ctattgggcgcagcttctctttaaaggcttgaattgagaaaagaggggtt

HSFAU                                                    
HSFAU1 ctgctgggtggcaccttcttgctcttacctgctggtgccttcctttccca

HSFAU                                                    
HSFAU1 ctacaggtaaagtccatggttccctggcccgtgctggaaaagtgagaggt

HSFAU                                                    
HSFAU1 cagactcctaaggtgagtgagagtattagtggtcatggtgttaggacttt

HSFAU                                                    
HSFAU1 ttttcctttcacagctaaaccaagtccctgggctcttactcggtttgcct

HSFAU                                                    
HSFAU1 tctccctccctggagatgagcctgagggaagggatgctaggtgtggaaga

HSFAU                                                    
HSFAU1 caggaaccagggcctgattaaccttcccttctccaggtggccaaacagga

HSFAU                                                    
HSFAU1 gaagaagaagaagaagacaggtcgggctaagcggcggatgcagtacaacc

HSFAU                                                    
HSFAU1 ggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaat

HSFAU                                                    
HSFAU1 gccaactcttaagtcttttgtaattctggctttctctaataaaaaagcca

HSFAU                                                    
HSFAU1 cttagttcagtcatcgcattgtttcatctttacttgcaaggcctcaggga

HSFAU                  
HSFAU1 gaggtgtgcttctcgg

Finding DNA or RNA ligands

Systematic Evolution of Ligands by EXponential Enrichment is also a method for selecting nucleic acids with specific binding properties, see All you wanted to know about SELEX...

Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox